A target gene for detecting pea foot rot, a primer set and a detection kit

By developing target genes and specific amplification primer sets, combined with PCR technology, the time-consuming and difficult problem of morphological identification of pea foot rot pathogens has been solved, enabling rapid and accurate detection and early warning, and improving quarantine efficiency.

CN120350156BActive Publication Date: 2025-11-21HUANGPU CUSTOMS TECH CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510618176.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-14
Publication Date
2025-11-21
Estimated Expiration
2045-05-14

AI Technical Summary

Technical Problem

In the existing technology, the morphological identification method of pea foot rot fungus is easily affected by environmental factors, is time-consuming, and is difficult to distinguish from closely related species, which cannot meet the needs of rapid quarantine.

Method used

Develop target genes and specific amplification primer sets, combine them with PCR technology to establish a rapid detection system, realize direct sample detection and signal amplification, and distinguish pea foot rot pathogens from closely related species.

Benefits of technology

It enables pathogen detection to be completed within 8 hours, improving efficiency by 96%, thus enhancing customs clearance efficiency and enabling early warning and prevention of cross-border transmission of pathogens.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350156B_ABST
    Figure CN120350156B_ABST
Patent Text Reader

Abstract

The application discloses a target gene for detecting pea foot rot, a primer set and a detection kit, and belongs to the technical field of plant quarantine. The application innovatively develops a rapid detection technology system based on specific molecular markers in view of the core pain points of long detection period (traditional method >= 20 days) and difficult identification of close species (such as D. pinodes and A. pisi) in the quarantine identification of Didymella pinodella. By screening a single-copy gene sequence unique to D. pinodella and combining PCR technology, a whole-process system of "direct sample detection-target enrichment-signal amplification" is established, and the pathogen detection can be completed within 8 hours, the efficiency is improved by 96% compared with the traditional method, the efficiency is greatly improved, and the close species can be effectively distinguished, the customs clearance efficiency is greatly improved, and technical support is provided for the detection of pea foot rot and the breeding of pea disease resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant quarantine technology, and more specifically to a target gene, primer set, and detection kit for detecting pea foot rot. Background Technology

[0002] Didymellapinodella, belonging to the phylum Ascomycota, order Pleosporales, family Didymellaceae, and genus Didymelella, causes pea hull rot (also known as black spot disease) along with Ascochytapinodes and Ascochytapisi. It is one of the most important diseases affecting peas, found in almost all pea-producing areas, severely impacting pea quality and causing 10%-60% yield loss annually. D. pinodella has a wide host range, infecting at least 21 plant genera, primarily leguminous plants such as peas and soybeans. Even under crop rotation, the pathogen can still persist. The fungus forms lesions on stems, leaves, and pods. These lesions enlarge and merge, causing lower leaves to completely wither and fall off. Severe stem infection can lead to girdling near the soil, a condition known as foot rot (Ascochyta blight of peas). Although there are reports that the bacteria has been found in my country, the distribution area is unclear.

[0003] my country imports approximately 2 million tons of peas annually, and this disease can easily be introduced into my country along with imported peas. Once introduced, it will have a significant impact on our pea industry. Currently, D. pinodella is a key target for monitoring imported plants and plant products and has been included in my country's quarantine list.

[0004] Current quarantine identification standards for Didymellapinodella, the causal agent of pea foot rot, primarily rely on morphological identification methods. However, this method has several limitations in practical application. First, morphological identification is easily affected by environmental factors. Variables such as culture medium composition, temperature and humidity conditions, and the source of the pathogen can significantly influence the morphological characteristics of the strain, leading to biased identification results. Second, the traditional identification process requires a series of operations, including pathogen isolation and culture, Koch's postulate verification, and morphological observation, typically taking at least three weeks, which is insufficient to meet the timeliness requirements for rapid customs clearance. More importantly, D. pinodella exhibits high similarity with closely related species such as Ascochytapisi and D. pinodes in terms of symptoms, macroscopic morphological characteristics, and some conserved gene sequences (such as ITS and rpb2) upon infection with the host. Conventional morphological identification and universal gene barcoding analysis are insufficient for accurate differentiation.

[0005] Therefore, developing target sequences and molecular marker sequences with species-level resolution and establishing molecular detection technologies based on specific sequences are technical problems that urgently need to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the present invention provides a target gene, primer set, and detection kit for detecting pea foot rot. Through research, a target gene for detecting pea foot rot was discovered, and a specific amplification primer set was constructed based on the above target gene. This kit can successfully identify pea foot rot with extremely high accuracy and timeliness, and it is species specific, effectively distinguishing it from Ascochytapisi and D. pinodes.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] An excerpt of a gene from *Pea pedunculata*, the causal agent of pea foot rot, is used as a target gene in the preparation of products for detecting pea foot rot. The nucleotide sequence of the target gene is as follows:

[0009] A: As shown in SEQ ID NO.1;

[0010] B: Or a nucleotide sequence that is reverse complementary to the nucleotide sequence shown in SEQ ID NO.1;

[0011] C: Or a nucleotide sequence that is more than 90% homologous to the nucleotide sequence defined by A or B.

[0012] Another object of the present invention is to provide a primer set for detecting pea foot rot, said primer set being designed based on the above-mentioned target gene, the nucleotide sequence of said primer set being shown in SEQ ID NO.2 and SEQ ID NO.3.

[0013] Another object of the present invention is to provide a kit for detecting pea foot rot, comprising the above-described primer set.

[0014] Another object of the present invention is to provide: the application of the above-described primer set or the above-described kit, wherein the application is in any of the following directions:

[0015] A: Application in disease-resistant breeding of peas;

[0016] B: Application in the analysis and identification of closely related species of pea foot rot.

[0017] Another object of the present invention is to provide a PCR method for detecting pea foot rot without the aid of disease diagnosis and treatment, using the above-mentioned primer set or the above-mentioned kit, comprising the following steps: extracting DNA from the sample to be tested as a template, and performing detection using the above-mentioned primer set or the above-mentioned kit.

[0018] As a preferred technical solution, when an amplification band of 391 bp is present in the amplification band, it indicates that the sample to be tested contains the pathogen of pea foot rot.

[0019] As a preferred technical solution, the amplification reaction system of the PCR method is as follows: 25 μL, including 112.5 μL of 2×Pro TaqMasterMix(dye plus)*, 1 μL each of upstream and downstream primers, 2 μL of DNA template, and water added to make up to 25 μL.

[0020] As a preferred technical solution, the concentrations of both the upstream and downstream primers are 10 μM / L.

[0021] As a preferred technical solution, the amplification reaction program of the PCR method is as follows: 94℃ for 3 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min.

[0022] As can be seen from the above technical solution, compared with the prior art, the present invention has the following beneficial effects:

[0023] This invention addresses the core challenges in the quarantine and identification of Didymellapinodella, the causal agent of pea foot rot, including long detection cycles (≥20 days using traditional methods) and difficulties in identifying closely related species (such as D. pinodes and A. pisi). It innovatively develops a rapid detection technology system based on specific molecular markers. By screening for a unique single-copy gene sequence of D. pinodella and combining it with PCR technology, a complete process of "direct sample detection - target enrichment - signal amplification" is established. This system can complete pathogen detection within 8 hours, improving efficiency by 96% compared to traditional methods. This significantly enhances efficiency, greatly improves customs clearance efficiency, enables early warning of pathogen infection in the field, and prevents the risk of D. pinodella spreading across borders through imported seeds. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0025] Figure 1 The results are as follows: Specificity test results for the primers, where M is DNA marker DL 2000; P is D. pinodella positive control (Australia); 1 is Phopsis longicolla; 2 is Diaporthe phaseolorum var. sojae; 3 is D. glomerata; 4 is Diaporthe phaseolorum var. caulivora; 5 is Diaporthe phaseolorum var. meridionalis; 6 is D. rabiei; 7 is Plenodomuslindquistii; 8 is Diaporthe helianthi; 9 is D. pomorum 7728; 10 is D. americana 8806-3; 11 is D. pinodes 2517-2; 12 is D. pinodes 9609-5; 13 is D. pinodes 2517-2-1; 14 is D. pinodes 2517-2-2; 15 is D.pinodesT01; 16, 17 are CK.

[0026] Figure 2The results are as follows: primer sensitivity test results, where M is DNA marker DL 2000; concentrations 1 and 2 are 18.6 ng / μL; concentrations 3 and 4 are 1.86 ng / μL; concentrations 5 and 6 are 0.186 ng / μL; and 7 and 8 are CK (water).

[0027] Figure 3 The amplification effects of primer pairs on different positive samples are shown below: M is DNA marker DL 2000; 1 and 2 are negative controls, namely D. pinodes 3084-19 and 3084-27, respectively; 3, 4, 5, 6, and 10 are positive controls from different sources, namely D. pinodella 2517-6, D. pinodella 2517-6-1, D. pinodella 9780, D. pinodella Australia, and D. pinodella 38814-4, respectively; 7, 8, and 9 are negative controls, namely D. pinodella 3085-2 / 10 / 12, respectively; 11 and 12 are blank controls. Detailed Implementation

[0028] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0029] Example 1

[0030] A gene segment from *Phyllostachys pubescens*, the causal agent of pea foot rot, was used as a target gene in the preparation of products for detecting pea foot rot. The location of this target gene in the genome is as follows: Genome accession number: GCA_022609545.1, JAGKQD010000075.1: 104201-104700, and the specific sequence is as follows:

[0031] TTCGCTTCACGAAGCGTTCGACTTCCTGTAAGTACCTTCACCAGCAGA

[0032] GCAATGTTCTTGGTCTTATCTTTCTTGATAACGCCGATGAACGGTTTTCAAC

[0033] GTTTTGAGCTTCCGAATGATGTCAAGCACTAACTCTTCGTAAGGCGTTCCG

[0034] TTTGGTTGACCCCTCCAAAAGAGTTGGCCAGCTTTGCGAACTTCTTCAGGT

[0035] GTCACTATCGCACCGCAGTCAGCCAACGTCCAAGCCTCGAACGATGAGCA

[0036] TTGAAGGTCCACGTCCCTCTCCCGAACGCCGTCCATCCGCACACATGCA

[0037] AACGCCCGCGTGGCTGCGCAGCTTGTTGTGCACGTCGGTCGACGATGACT

[0038] CGTCACGCGTTGACAGGCACAGCAATCTGGCAGTGTTGTTCCGCTACCGGG

[0039] GACCGACTATGCCCACAGCGACCTCTCGACTGGTGCGCTCGTCCCACAGG

[0040] CACTGCTCGCAGAACATGATGATCGGTGTCGATCATCATGAACCTATCG, SEQ ID NO. 1.

[0041] Example 2

[0042] A primer set for detecting pea foot rot was developed, using the nucleotide sequence shown in SEQ ID NO.1 as the target gene. The primer set was designed according to primer design principles to obtain specific amplification primer sequences. The specific primer sequences are shown in Table 1.

[0043] The specific primer design principles are as follows:

[0044] (1) Primer fragment length is between 18-25 bp;

[0045] (2) The GC content of the primer sequences is between 40% and 60%;

[0046] (3) Primer binding sites are homologous regions of the 7 reference genomes;

[0047] (4) The annealing temperature is 57℃-65℃.

[0048] Table 1. Primers for specific amplification of D. pinodella

[0049]

[0050] Example 3

[0051] The specificity of pinodella 11F and pinodella 11R primers was determined.

[0052] The specificity of the primer pair (pinodella11F / pinodella 11FR) was verified by using related strains such as D. glomerata, D. rabiei, D. helianthi, D. pomorum 7728, D. americana 8806-3, D. pinodes 2517-2, D. pinodes 9609-5, D. pinodes 2517-2-1, D. pinodes 2517-2-2 and peripheral strains such as Phoopsis longicolla, Diaporthe phaseolorum var. sojae, Diaporthe phaseolorum var. caulivora, Diaporthe phaseolorum var. meridionalis, and Plenodomus lindquistii as negative controls. D. pinodella 38814 was used as a positive control, and RNase-free-water was used as a blank control.

[0053] (I) Nucleic acid extraction

[0054] (1) Pick about 0.1g of the mycelium of the above strain, blot dry with sterile filter paper, put into a 1.5mL centrifuge tube, freeze with liquid nitrogen, grind the mycelium with a plastic pestle, and set aside for use;

[0055] (2) Add 400μL-500μL CTAB buffer and 0.1g proteinase K to a centrifuge tube, mix well, incubate at 65℃ for 1h, centrifuge at 14000g for 5min, and retain the supernatant.

[0056] (3) Take the supernatant, add 500 μL of Tris saturated phenol: chloroform: isoamyl alcohol (25:24:1), mix well, and centrifuge at 14000g for 5 min;

[0057] (4) Take the supernatant into a 1.5 mL centrifuge tube, add 500 μL of chloroform:isoamyl alcohol (24:1), shake gently to mix, and centrifuge at 14000g for 5 min.

[0058] (5) Take the supernatant, add 1 mL of isopropanol and mix well. Place at -70°C for 1 h or at -20°C overnight; centrifuge at 13000g for 10 min and DNA precipitate will be visible.

[0059] (6) Discard the supernatant, wash the DNA precipitate twice with cold 70% ethanol, and dry at room temperature; dissolve the DNA in 30μL-50μL Tris-EDTA buffer;

[0060] Note: Nucleic acid extraction can also be performed using commercial DNA extraction kits.

[0061] (II) PCR Amplification

[0062] Using the genomic DNA of different strains obtained in step (1) as templates, PCR amplification was performed, and the amplification results are as follows: Figure 1 As shown.

[0063] The amplification system and amplification procedure are as follows:

[0064] Amplification reaction system: 25 μL, including 112.5 μL of 2×Pro TaqMasterMix (dye plus), 1 μL each of upstream and downstream primers, 2 μL of DNA template, and water added to make up to 25 μL; the concentration of both upstream and downstream primers is 10 μM / L.

[0065] Amplification reaction program: 94℃ for 3 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min.

[0066] Results Analysis: Figure 1 It is known that the pinodella 11F and pinodella 11R primer sets of this invention are species specific and can accurately distinguish Didymellapinodella from other strains of the same genus as well as peripheral strains.

[0067] Example 4

[0068] The detection sensitivity of pinodella 11F and pinodella 11R primers was determined.

[0069] Using D. pinodella at an initial concentration of 18.6 ng / μL as a template, the concentrations were diluted to 1.86 ng / μL and 0.186 ng / μL, respectively, for sensitivity testing. The experimental results are as follows: Figure 2 As shown.

[0070] Results Analysis: Figure 2 It can be seen that when the template concentration is 1.86 ng / μL, a faint amplification band can be seen; when the template concentration is 0.186 ng / μL, no amplification band appears. Therefore, the detection limit of this primer set is 1.86 ng / μL.

[0071] Example 5

[0072] Actual sample testing

[0073] Positive D. pinodella samples from different sources (D. pinodella 2517-6, D. pinodella 2517-6-1, D. pinodella 9780, D. pinodella from Australia, and D. pinodella 38814-4) were used in the experiment to evaluate the detection effect of specific primers on actual samples. The experimental results are as follows: Figure 3 As shown.

[0074] Results Analysis: Figure 3 It can be seen that the detection primers of this invention can successfully detect pea foot rot fungus in actual positive samples, and have practical application value.

[0075] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0076] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Use of a reagent for detecting a gene of a phoma lingam in the preparation of a product for detecting phoma lingam; the nucleotide sequence of the gene of the phoma lingam is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The reagent is a primer set, and the nucleotide sequences of the primer set are shown as SEQ ID NO. 2 and SEQ ID NO.

3.

3. Use of a primer set or a kit comprising said primer set for the analysis and identification of Bremia species, characterized in that, The nucleotide sequences of the primer set are shown as SEQ ID NO. 2 and SEQ ID NO.

3.

4. A PCR method for detecting pea foot rot, which is not a disease diagnosis treatment, characterized by, The method comprises the following steps: extracting DNA of a sample to be tested as a template, and using a primer set or a kit containing the primer set to perform detection; the nucleotide sequences of the primer set are shown as SEQ ID NO. 2 and SEQ ID NO.

3.

5. The PCR method for detecting pea foot rot, which is not a disease diagnostic treatment according to claim 4, characterized by, When an amplification band of 391 bp in size exists in the amplification band, it represents that the sample to be tested contains the pathogen of phoma lingam.

6. The PCR method for detecting pea foot rot, which is not a disease diagnostic treatment according to claim 4, characterized by, The amplification reaction system of the PCR method is as follows: 25 μL, including 2x Pro Taq Master Mix dye plus 12.5 μL, 1 μL of each of the upstream and downstream primers, 2 μL of DNA template, and water added to 25 μL.

7. The PCR method for detecting pea foot rot, which is not a disease diagnostic treatment according to claim 6, characterized by, The concentrations of the upstream and downstream primers are both 10 μM / L.

8. The PCR method for detecting pea foot rot, which is not a disease diagnostic treatment according to claim 4, characterized by, The amplification reaction program of the PCR method is as follows: 94℃ 3min; 94℃ 30s, 60℃ 30s, 72℃ 30s, 35 cycles; 72℃ 5min.