Spatial immune repertoire sequencing method based on DNA cyclization strategy

By constructing a spatial immune repertoire sequencing method based on DNA circularization strategy on a microfluidic chip, the problems of low sensitivity, insufficient resolution, and high cost in existing technologies have been solved, achieving high-precision and low-cost single-cell level immune receptor analysis.

CN121428067APending Publication Date: 2026-01-30TAN KAH KEE INNOVATION LAB
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511541415.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-27
Publication Date
2026-01-30

Smart Images

  • Figure CN121428067A_ABST
    Figure CN121428067A_ABST
Patent Text Reader

Abstract

The invention discloses a spatial immune repertoire sequencing method based on a DNA cyclization strategy. The method comprises the following steps: (1) preparing an STB chip; (2) preparing a tissue sample; (3) obtaining cDNA (complementary deoxyribonucleic acid) with a space bar code; (4) cDNA amplification and quality control; (5) cyclizing the cDNA; (6) amplifying cDNA V (D) J; (7) library construction; and (8) sequencing and data analysis. The core problems of high-resolution in-situ capture, targeted enrichment and low-cost analysis are solved, and spatial immune repertoire analysis which is high in sensitivity, easy to operate, high in success rate and low in cost is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of spatial immunomics analysis technology, specifically relating to a spatial immune repertoire sequencing method based on a DNA circularization strategy. Background Technology

[0002] The immune system is the core defense mechanism for maintaining physiological homeostasis and resisting external invasions, mainly consisting of two components: innate immunity and adaptive immunity. Adaptive immunity, with its high specificity and memory function, plays a crucial role in responding to pathological states such as infection, inflammation, and tumors. The adaptive immune response is primarily mediated by B cell receptors (BCRs) and T cell receptors (TCRs), which are expressed on the surface of B lymphocytes and T lymphocytes, respectively, and can recognize and bind to specific antigens. The diversity of BCRs and TCRs originates from the V(D)J gene rearrangement process: during T and B cell development, V (variable), D (diversity), and J (connection) gene segments in the genome undergo random recombination and combination to form unique α / β chain (TCR) or heavy / light chain (BCR) sequences. This rearrangement mechanism ensures a vast diversity of immune receptors; it is estimated that human TCR diversity can reach 10-1. 15 The above is true, and the diversity of BCR is equally astonishing.

[0003] The TCR structure consists of an α chain and a β chain. The α chain includes a C (constant) region, a J region, and a V region, while the β chain additionally includes a D region. The VDJ region of the β chain forms the complementarity-determining region (CDR) of the antigen-binding site, particularly the CDR3 region, which exhibits the highest sequence variability and directly determines the receptor's ability to recognize specific antigen peptides. One CDR3 sequence typically corresponds to a unique T cell clone; therefore, by measuring the abundance and distribution of CDR3 sequences, the extent of expansion of specific T cell clones and the dynamics of the immune response can be assessed. Similarly, the VDJ rearrangements of the BCR determine antibody affinity and specificity, which are crucial in vaccine development and autoimmune disease research. In recent years, with the advancement of high-throughput sequencing technology, repertoire analysis has become a standard method for elucidating immune diversity and clonal dynamics, revealing VDJ rearrangement patterns, clonal frequencies, and the synergistic mechanisms of humoral / cellular immunity.

[0004] However, traditional immune repertoire sequencing is mostly limited to bulk level or single-cell suspension analysis, failing to capture the spatial heterogeneity of immune cells in the tissue microenvironment. The tissue microenvironment is a key battleground for the immune response. For example, in tumor tissue, the spatial distribution of T cells directly affects their anti-tumor effect; at sites of infection or inflammation, the local aggregation of B cells and T cells regulates the formation of immune memory. Comprehensively analyzing the complete receptor sequence information of T / B cells in tissues (including BCR heavy / light chains and TCR α / β chains) and mapping their spatial distribution is a necessary approach to revealing the complex regulatory mechanisms of antigen-receptor interactions and adaptive immunity under physiological and pathological conditions. This not only helps to understand the occurrence and development of immune tolerance and autoimmune diseases, but also provides spatially guided biomarkers for precision immunotherapy (such as CAR-T cell therapy).

[0005] The rise of spatial omics technologies has provided technical support for these needs. Spatial transcriptomics reveals the location, state, and interactions of cells within tissues by directly linking gene expression information with tissue structure. For example, 10xGenomics' Visium platform uses spatial barcoding to capture mRNA, enabling subcellular resolution transcriptome mapping. This technology has been widely applied in neuroscience, tumor microenvironment, and developmental biology, allowing researchers to observe spatial patterns of gene expression, such as the gradient distribution of inflammatory factors in tissues. Integrating immune repertoire information into the spatial omics framework can further reveal the location, density, and interactions of immune cells within tissues, thereby elucidating how immune cells coordinate their fight against pathogens or regulate inflammatory responses. For example, in lymphoid organs, the spatial partitioning of T cells and B cells directly influences germinal center formation; in tumor-infiltrating lymphocytes (TILs), spatial clustering of TCR clones predicts treatment response.

[0006] In existing technologies, spatial immune repertoire sequencing methods mainly include Slide-TCR-seq (Immunity, 2022, 55(10): 1940-1952) and Spatial VDJ (Science, 2023, 382(6675): eadf8486). Slide-TCR-seq is an extended technology based on Slide-seq, which captures TCR transcripts and integrates transcriptome information by constructing a spatial barcode array on tissue slices. This method uses a 10μm resolution bead array to achieve spatial mapping of TCR sequences, revealing the distribution of different immune microenvironments (such as effector T cell regions and regulatory T cell regions) and intercellular interactions in adaptive immune responses. For example, in mouse models, this technology identified spatial clustering of TCR clones in inflamed tissues, demonstrating the correlation between clonal amplification and local antigen presentation. Similarly, Spatial VDJ, based on the Visium platform and third-generation sequencing, simultaneously captures VDJ rearranged sequences of BCR and TCR to elucidate lymphocyte clonal dynamics. This method reveals spatial co-localization patterns of B / T cells in human tumor samples, helping to elucidate tumor immune escape mechanisms, such as the enrichment of exhausted T cells at the tumor periphery.

[0007] Despite significant advancements in these technologies, several limitations remain. First, in terms of sensitivity, Slide-TCR-seq faces the challenge of low TCR transcript abundance. Since TCR mRNA expression levels are much lower than those of housekeeping genes, high-depth sequencing (typically exceeding 50M reads) is required, which not only increases sequencing costs but may also introduce noise, affecting the accuracy of detecting low-abundance clones. Second, insufficient spatial resolution is a common problem: Slide-TCR-seq's 10μm resolution may cover multiple cells in densely populated T-cell regions (such as lymph nodes), leading to clonality confounding and making it impossible to accurately distinguish the unique TCR sequences of adjacent T cells. Spatial VDJ relies on Visium's 55μm spot resolution, where a single spot often covers 50-200 cells, further amplifying this limitation and restricting the resolution of single-cell-level spatial heterogeneity. Furthermore, operational complexity and low experimental success rates are also significant obstacles. Slide-TCR-seq involves multiple chip bonding and tissue fluid flow, which can easily lead to tissue tearing or deformation, especially when processing large-volume samples. Spatial VDJ requires the combination of third-generation sequencing and Visium microarrays, resulting in massive data volumes and a cumbersome analysis process. It also requires the development of dedicated algorithms to integrate spatial TCR cloning, gene expression, and morphological information, which increases the difficulty and cost of bioinformatics processing. Finally, the overall cost is high: the combination of high-depth second-generation sequencing from Slide-TCR-seq and third-generation sequencing from Spatial VDJ often makes the cost of a single sample analysis exceed tens of thousands of RMB, limiting its widespread application in preclinical research.

[0008] These limitations highlight the necessity of developing a highly sensitive, high-resolution, and low-cost spatial immune repertoire sequencing method. The limitations of existing technologies not only hinder a deeper understanding of the fine-grained regulation of the immune microenvironment but also restrict its translational potential in the diagnosis and personalized treatment of immune diseases. For example, in research on post-COVID-19 syndrome, precise spatial TCR mapping helps track tissue residence of memory T cells; in cancer immunotherapy, revealing the spatial distribution of TILs can optimize checkpoint inhibitor dosing strategies. Therefore, there is an urgent need for an innovative method integrating in-situ capture, targeted enrichment, and high-throughput sequencing to achieve spatial multi-omics analysis of immune receptor sequences, driving the transformation of immunology from a bulk approach to a spatially precise one. Summary of the Invention

[0009] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a spatial immune repertoire sequencing method based on a DNA circularization strategy.

[0010] The technical solution of the present invention is as follows:

[0011] A spatial immunomics sequencing method based on a DNA circularization strategy includes the following steps:

[0012] (1) STB chip preparation: The glass slide is modified to obtain a microfluidic chip, and a spatial barcode capture array is constructed in it. The microfluidic chip is orthogonally arranged and contains two sets of microchannels: the horizontal X-axis and the vertical Y-axis. Several X-strand DNAs are connected in the horizontal X-axis microchannel group, and several Y-strand DNAs are connected in the vertical Y-axis microchannel group. Several Y-strands are connected to a capture sequence with reverse Read 1.

[0013] (2) Tissue sample preparation: Tissue sections of spleen and thymus were attached to the STB chip prepared in step (1), and the tissue sections were fixed, stained and permeabilized;

[0014] (3) Obtaining cDNA with spatial barcode: The tissue samples prepared in step (2) were subjected to mRNA reverse transcription, cDNA double strand synthesis and cDNA denaturation in sequence;

[0015] (4) cDNA amplification and quality control: The cDNA obtained in step (3) is pre-amplified, purified and quantified, amplified a second time, and quality controlled and quantified.

[0016] (5) cDNA circularization: The cDNA obtained in step (4) is subjected to double-strand circularization or single-strand circularization;

[0017] (6) cDNA V(D)J amplification: The double-stranded or single-stranded circularized cDNA obtained in step (5) is subjected to TCR amplification or BCR amplification to obtain products corresponding to the thymus and spleen mentioned above.

[0018] (7) Library construction: The products obtained in steps (4) and (6) are fragmented, end-repaired and A-added, adapter ligated and PCR amplified to construct spatial transcriptome libraries and spatial immunome libraries, respectively.

[0019] (8) Sequencing and data analysis: The library constructed in step (7) was subjected to high-throughput sequencing, and the spatial distribution of the immunogen library was analyzed based on spatial barcode mapping.

[0020] In a preferred embodiment of the present invention, step (1) includes: modifying a glass slide with γ-aminopropyltriethoxysilane and a fifth-generation polyamide-amine dendritic polymer, introducing X-chain DNA and Y-chain DNA as barcodes into two sets of microchannels along the X-axis and Y-axis respectively using microfluidic technology to form a capture sequence array, and connecting a capture sequence with reverse Read1; wherein the X-chain DNA sequence is shown in SEQ ID NO. 01 to 96, the Y-chain DNA sequence is shown in SEQ ID NO. 97 to 192, the XY linker sequence is shown in SEQ ID NO. 193, and the capture sequence is formed by annealing the STBlinker shown in SEQ ID NO. 194 and the STB-Chip shown in SEQ ID NO. 195.

[0021] In a preferred embodiment of the present invention, in step (2), the tissue section is a 10 μm thick frozen tissue section, stained with HE staining solution, and permeabilized at 37 °C for 20 min using 0.1 M permeabilizing enzyme working solution.

[0022] In a preferred embodiment of the present invention, in step (3), mRNA reverse transcription is performed using RT MasterMix at 42 °C for 2 h, second-strand synthesis is performed using Second Strand Mix according to the procedure of 37 °C for 15 min, 45 °C for 15 min, 55 °C for 15 min, and 65 °C for 15 min, and denaturation is performed using 80 mM KOH at room temperature for 10 min.

[0023] In a preferred embodiment of the present invention, in step (4), the pre-amplification is performed using cDNA PCR Mix for 6 rounds of PCR cycles, the purification and quantification are performed using 0.8× magnetic beads purification and qPCR system, the second amplification is performed based on the qPCR ct value plus 2 rounds, and the quality control is performed using the Qubit dsDNA HS kit for quantification and the Agilent High Sensitivity D5000 Assay fragment analysis.

[0024] In a preferred embodiment of the present invention, in step (5), double-stranded cyclization is performed by adding T5 Exo and Exo I to 2×CE Mix at 50℃ for 5 min and 75℃ for 10 min, and then reacting at 37℃ for 1 h. Single-stranded cyclization is performed by adding T5 Exo, Exo I and NaCl to Splint-oligo and T4 DNA ligase at room temperature for 16 h, and then reacting at 37℃ for 1 h.

[0025] In a preferred embodiment of the present invention, in step (6), after the first round of 10 PCR cycles using TCR primer mix 1, the second round of amplification is performed by adding 3 cycles based on the qPCR ct value. After the first round of 10 PCR cycles using BCR primer mix 1, the second round of amplification is performed by adding 3 cycles based on the qPCR ct value.

[0026] More preferably, the TCR primer mix 1 includes the primer sequences shown in SEQ ID NO. 198 to 200, and the TCR primer mix 2 includes the primer sequences shown in SEQ ID NO. 198 and SEQ ID NO. 201 to 202; the BCR primer mix 1 includes the sequences shown in SEQ ID NO. 198, 203 to 213, and the BCR primer mix 2 includes the sequences shown in SEQ ID NO. 198, 214 to 224.

[0027] In a preferred embodiment of the present invention, in step (7), fragmentation, end repair and A addition are performed using Frag / AT Buffer and Frag / AT Enzyme Mix at 30 °C for 3 min and 65 °C for 30 min, respectively, and PCR amplification is performed using SI-P5 xx primers as shown in SEQ ID NO. 225 to 232 and SI-P7 xx primers as shown in SEQ ID NO. 233 to 236.

[0028] In a preferred embodiment of the invention, it is applicable to mice.

[0029] The beneficial effects of this invention are:

[0030] 1. This invention solves the core problems of high-resolution in-situ capture, targeted enrichment and low-cost analysis, and realizes spatial immune repertoire analysis with high sensitivity, easy operation, high success rate and low cost.

[0031] 2. This invention utilizes a spatial multi-omics platform for in-situ capture on a solid-phase chip, integrating transcriptomics and immune repertoire analysis simultaneously, achieving a spatial resolution of 2 μm. This enables precise analysis of the in-situ distribution patterns of immune receptors in the tissue microenvironment. Compared to the 10 μm resolution of Slide-TCR-seq and the 55 μm resolution of Spatial VDJ, this significantly improves spatial accuracy, avoids clonal contamination caused by multi-cell coverage, and holds promise for achieving single-cell-level immune repertoire analysis, thereby more accurately revealing the spatial heterogeneity and interactions of T / B cells.

[0032] 3. This invention employs a circularization enrichment strategy (Gibson double-strand circularization or Splint single-strand circularization) combined with high-throughput next-generation sequencing (NGS) to achieve efficient targeted capture of TCR / BCR genes with a sequencing depth of less than 50M reads and a simplified VDJ direct alignment process. This overcomes the limitations of existing technologies that require high-depth sequencing due to low TCR transcript abundance, improving sensitivity, simplifying data, and increasing analysis efficiency. Compared to Spatial VDJ, which relies on expensive third-generation sequencing, this invention is based on Illumina next-generation sequencing, reducing costs by approximately 50% and making the technology easier to deploy in laboratories.

[0033] 4. This invention optimizes the experimental process. Through integrated chip design and shear-resistant fluid control, it avoids the tearing or deformation problems caused by multiple adhesions and tissue flow in Slide-TCR-seq. Simultaneously, the microchannel structure optimization solves the risk of blockage, significantly improving the experimental success rate (>90%). The operation requires only a single-step cyclization reaction to enrich the 5' VDJ gene, simplifying the process and reducing the time by more than 30%, making it suitable for high-throughput sample processing. Attached Figure Description

[0034] Figure 1 This is a schematic diagram of a 50×50 50 μm mask designed for Embodiment 1 of the present invention.

[0035] Figure 2 The experimental process and results are shown in the figure for Embodiment 1 of the present invention. Detailed Implementation

[0036] The technical solution of the present invention will be further explained and described below with reference to specific embodiments and accompanying drawings.

[0037] Example 1

[0038] I. STB Chip Fabrication

[0039] (1) Glass slide modification

[0040] Select glass slides with no scratches on the surface and ultrasonically clean them three times with ultrapure water, 5 minutes each time. After cleaning, immerse the slides in freshly prepared piranha solution (a mixture of concentrated H2SO4 and 30% H2O2 at a volume ratio of 2:1) for 1.5 hours to activate the surface. Then, ultrasonically clean them 3-4 times with deionized water to remove residual solution.

[0041] The cleaned glass slides were placed in a mixed solution of γ-aminopropyltriethoxysilane (GOPTs) and anhydrous ethanol (volume ratio 1:19) and incubated at room temperature in the dark for 5 h to perform silanization treatment. After incubation, the slides were washed three times with anhydrous ethanol and cured at 110 °C in the dark for 1 h.

[0042] Prepare a 0.3% methanol solution of fifth-generation polyamide-amine dendritic polymer (G5 PAMAM), immerse the silanized glass slide in it, and react at room temperature in the dark for at least 15 hours. After the reaction, ultrasonically clean the slide three times with methanol, then clean it with deionized water and dry it to obtain the modified glass slide, which can be stored at 4 °C for later use.

[0043] (2) Construction of spatial barcode capture array

[0044] The orthogonally arranged microfluidic chip contains two sets of microchannels, one horizontal (X-axis) and one vertical (Y-axis), with a channel width and length of 50 μm. Using microfluidic technology, X-chain and Y-chain DNA barcode solutions are introduced onto the surface of the modified slide obtained in step (1) to form precise cross-coordinate points (XiYj combinations), specifically including:

[0045] Microfluidic chip template fabrication:

[0046] 1) Use computer-aided design software AutoCAD to complete the chip structure design (e.g. Figure 1 The photomask shown was manufactured by Shenzhen Qingyi Optoelectronics Co., Ltd.

[0047] 2) Silicon wafer pretreatment: Place the silicon wafer in a 135℃ oven and dry for 1 hour to remove surface moisture. After removing it, blow the surface with high-purity nitrogen.

[0048] 3) Surface treatment: The silicon wafer surface is cleaned for 5 minutes using a plasma cleaner to effectively remove organic contaminants and improve surface energy;

[0049] 4) Photoresist coating: SU-8 3050 photoresist is uniformly coated using a precision spin coater at a speed of 2650 rpm (acceleration of 300 rpm / s, duration of 50 s);

[0050] 5) Pre-baking process: A gradient heating method is adopted, first treating at 65 ℃ for 5 min, and then raising to 105 ℃ for 15 min;

[0051] 6) Ultraviolet exposure: Expose at a power density of 9.2 J / s for 10 s on a lithography machine to achieve precise transfer of the mask pattern;

[0052] 7) Post-baking process: Repeat the heating procedure in step (5) to complete the photoresist crosslinking reaction;

[0053] 8) Development process: Immerse the silicon wafer in a special developer for 5 minutes to remove the photoresist in the unexposed areas, dry it with nitrogen, and then cure it in a 135 ℃ oven for 2 hours.

[0054] 9) Surface modification: Spin-coating chlorosilane hydrophobically makes the template surface hydrophobic, and the microchannel height is confirmed to be 50 μm by step film thickness gauge.

[0055] PDMS chip molding process:

[0056] (1) Fix the prepared SU-8 template in a 10 cm culture dish;

[0057] (2) The PDMS prepolymer and curing agent are precisely mixed at a mass ratio of 10:1 and then subjected to vacuum degassing for 30 min;

[0058] (3) Pour the mixture onto the template surface, controlling the thickness to about 0.8 cm, and then degas it again under vacuum for 10 min;

[0059] (4) Curing treatment: Heat curing at 120 ℃ for 40 min, then naturally cooling to room temperature;

[0060] (5) Precision cutting: Use a scalpel to precisely cut along the edge of the designed pattern to obtain a PDMS device with a specific microstructure.

[0061] Microfluidic orthogonal coding method:

[0062] (1) Assemble the X-axis and Y-axis microfluidic coding devices onto the glass slide substrate in a preset order;

[0063] (2) Using a negative pressure driven method, a constant negative pressure of -0.8 kPa is applied through a vacuum pump system to sequentially draw the X-chain and Y-chain DNA barcode solutions into the microfluidic channel;

[0064] (3) By sequentially performing X and Y microfluidic orthogonal coding, a precisely positioned DNA barcode combination (XiYj) is formed at the intersection of the XY microfluidic device, thereby realizing the spatial coding function.

[0065] X-coding: Several X-strand DNA molecules with 5' amino groups modified were mixed with PB buffer and disuccinimide (DSS) solution. A transverse PDMS template was attached to a PAMAM-modified glass slide and placed in a mold. The X-strand mixture was introduced through microchannels, and DSS covalently linked the X-strands to the amino groups on the slide surface. After reacting at room temperature in the dark for 1 h, the liquid in the channels was evacuated, and the slide was washed with 0.1×SSC. The mold was removed, and the slide was washed sequentially with 2×SSC, 0.1% SDS, and deionized water.

[0066] Blocking: Prepare a blocking solution (1.6 g succinic anhydride, 10 mL DMF, 100 μL triethylamine), immerse the X-coded slide in it, and react at room temperature in the dark for 45 min. Rinse with deionized water and dry, then store at 4 ℃.

[0067] Y-coding: A mixture of Y-strand DNA (pre-annealed with the XY linker in 1× Ligase buffer, purchased from Vazyme, catalog number C301-01) and T4 DNA ligase was prepared to obtain a Y-strand mixed solution. A longitudinal PDMS template was attached to a sealed glass slide and placed in a mold. The Y-strand mixed solution was introduced through a microchannel and reacted at 37 °C for 40 min. After the reaction, the liquid was aspirated, and the slide was washed with 0.1× SSC. The mold was removed, and the slide was washed with 2× SSC, 0.1% SDS, and deionized water.

[0068] (3) Connection of capture sequence with reverse Read 1

[0069] Place the glass slide constructed by the spatial barcode capture array in step (2) into the single-hole clip, insert the rubber pad, and install the clip.

[0070] A long STB chain (STB-Chip, pre-annealed with STBlinker in 1× Ligase buffer, purchased from Vazyme, catalog number C301-01) containing a poly T capture strand with reverse Read 1 was mixed with 8 μL of T4 DNA ligase to obtain a mixed STB chain solution. This solution was added to the wells of the cartridge reaction and incubated at 37 °C for 45 min. After the reaction, the liquid was aspirated and washed with 0.1× SSC.

[0071] At this point, the STB chip fabrication is complete, with a capture sequence array bearing a unique spatial barcode formed on its surface, in which the Y-strand DNA is linked to a capture sequence with a reverse Read 1.

[0072] The X-strand DNA in this embodiment is shown in Table 1 below:

[0073] Table 1

[0074] ID Sequence (5’→3’) Sequence number SC-X1 ctacacgacgctcttccgatctataatgtcaggccagagcattcg SEQ ID NO.01 SC-X2 ctacacgacgctcttccgatctatgcctaaaggccagagcattcg SEQ ID NO.02 SC-X3 ctacacgacgctcttccgatctagtggtcaaggccagagcattcg SEQ ID NO.03 SC-X4 ctacacgacgctcttccgatctaccactgtaggccagagcattcg SEQ ID NO.04 SC-X5 ctacacgacgctcttccgatctacattggcaggccagagcattcg SEQ ID NO.05 SC-X6 ctacacgacgctcttccgatctccacttacaggccagagcattcg SEQ ID NO.06 SC-X7 ctacacgacgctcttccgatctcatcaagtaggccagagcattcg SEQ ID NO.07 SC-X8 ctacacgacgctcttccgatctacaagctaaggccagagcattcg SEQ ID NO.08 SC-X9 ctacacgacgctcttccgatctagtacaagaggccagagcattcg SEQ ID NO.09 SC-X10 ctacacgacgctcttccgatctaacaaccaaggccagagcattcg SEQ ID NO.10 SC-X11 ctacacgacgctcttccgatctaaccgagaaggccagagcattcg SEQ ID NO.11 SC-X12 ctacacgacgctcttccgatctaacgcttaaggccagagcattcg SEQ ID NO.12 SC-X13 ctacacgacgctcttccgatctgaatgcagaggccagagcattcg SEQ ID NO.13 SC-X14 ctacacgacgctcttccgatctaaggtacaaggccagagcattcg SEQ ID NO.14 SC-X15 ctacacgacgctcttccgatctacacagaaaggccagagcattcg SEQ ID NO.15 SC-X16 ctacacgacgctcttccgatctacagcagaaggccagagcattcg SEQ ID NO.16 SC-X17 ctacacgacgctcttccgatctacctccaaaggccagagcattcg SEQ ID NO.17 SC-X18 ctacacgacgctcttccgatctacgtatcaaggccagagcattcg SEQ ID NO.18 SC-X19 ctacacgacgctcttccgatctactatgcaaggccagagcattcg SEQ ID NO.19 SC-X20 ctacacgacgctcttccgatctagagtcaaaggccagagcattcg SEQ ID NO.20 SC-X21 ctacacgacgctcttccgatctaacgtgataggccagagcattcg SEQ ID NO.21 SC-X22 ctacacgacgctcttccgatctagcaggaaaggccagagcattcg SEQ ID NO.22 SC-X23 ctacacgacgctcttccgatctagtcactaaggccagagcattcg SEQ ID NO.23 SC-X24 ctacacgacgctcttccgatctatcctgtaaggccagagcattcg SEQ ID NO.24 SC-X25 ctacacgacgctcttccgatctgccaagacaggccagagcattcg SEQ ID NO.25 SC-X26 ctacacgacgctcttccgatctcaaccacaaggccagagcattcg SEQ ID NO.26 SC-X27 ctacacgacgctcttccgatctgactagtaaggccagagcattcg SEQ ID NO.27 SC-X28 ctacacgacgctcttccgatctcaatggaaaggccagagcattcg SEQ ID NO.28 SC-X29 ctacacgacgctcttccgatctcacttcgaaggccagagcattcg SEQ ID NO.29 SC-X30 ctacacgacgctcttccgatctcagcgttaaggccagagcattcg SEQ ID NO.30 SC-X31 ctacacgacgctcttccgatctcataccaaaggccagagcattcg SEQ ID NO.31 SC-X32 ctacacgacgctcttccgatctccagttcaaggccagagcattcg SEQ ID NO.32 SC-X33 ctacacgacgctcttccgatctccgaagtaaggccagagcattcg SEQ ID NO.33 SC-X34 ctacacgacgctcttccgatctcgaacttaaggccagagcattcg SEQ ID NO.34 SC-X35 ctacacgacgctcttccgatctcgcatacaaggccagagcattcg SEQ ID NO.35 SC-X36 ctacacgacgctcttccgatctctcaatgaaggccagagcattcg SEQ ID NO.36 SC-X37 ctacacgacgctcttccgatctctggcataaggccagagcattcg SEQ ID NO.37 SC-X38 ctacacgacgctcttccgatctgaatctgaaggccagagcattcg SEQ ID NO.38 SC-X39 ctacacgacgctcttccgatctcaagactaaggccagagcattcg SEQ ID NO.39 SC-X40 ctacacgacgctcttccgatctgagctgaaaggccagagcattcg SEQ ID NO.40 SC-X41 ctacacgacgctcttccgatctgatagacaaggccagagcattcg SEQ ID NO.41 SC-X42 ctacacgacgctcttccgatctgccacataaggccagagcattcg SEQ ID NO.42 SC-X43 ctacacgacgctcttccgatctgcgagtaaaggccagagcattcg SEQ ID NO.43 SC-X44 ctacacgacgctcttccgatctgctaacgaaggccagagcattcg SEQ ID NO.44 SC-X45 ctacacgacgctcttccgatctggagaacaaggccagagcattcg SEQ ID NO.45 SC-X46 ctacacgacgctcttccgatctgtacgcaaaggccagagcattcg SEQ ID NO.46 SC-X47 ctacacgacgctcttccgatctgtcgtagaaggccagagcattcg SEQ ID NO.47 SC-X48 ctacacgacgctcttccgatctgtctgtcaaggccagagcattcg SEQ ID NO.48 SC-X49 ctacacgacgctcttccgatctgtgttctaaggccagagcattcg SEQ ID NO.49 SC-X50 ctacacgacgctcttccgatcttaggatgaaggccagagcattcg SEQ ID NO.50 SC-X51 ctacacgacgctcttccgatctattgaggaaggccagagcattcg SEQ ID NO.51 SC-X52 ctacacgacgctcttccgatctcgctgatcaggccagagcattcg SEQ ID NO.52 SC-X53 ctacacgacgctcttccgatctctgtagccaggccagagcattcg SEQ ID NO.53 SC-X54 ctacacgacgctcttccgatctacgctcgaaggccagagcattcg SEQ ID NO.54 SC-X55 ctacacgacgctcttccgatctccgtgagaaggccagagcattcg SEQ ID NO.55 SC-X56 ctacacgacgctcttccgatctcctcctgaaggccagagcattcg SEQ ID NO.56 SC-X57 ctacacgacgctcttccgatctcgactggaaggccagagcattcg SEQ ID NO.57 SC-X58 ctacacgacgctcttccgatctctgagccaaggccagagcattcg SEQ ID NO.58 SC-X59 ctacacgacgctcttccgatctgctcggtaaggccagagcattcg SEQ ID NO.59 SC-X60 ctacacgacgctcttccgatctggtgcgaaaggccagagcattcg SEQ ID NO.60 SC-X61 ctacacgacgctcttccgatcttatcagcaaggccagagcattcg SEQ ID NO.61 SC-X62 ctacacgacgctcttccgatcttccgtctaaggccagagcattcg SEQ ID NO.62 SC-X63 ctacacgacgctcttccgatcttcttcacaaggccagagcattcg SEQ ID NO.63 SC-X64 ctacacgacgctcttccgatcttgaagagaaggccagagcattcg SEQ ID NO.64 SC-X65 ctacacgacgctcttccgatcttggaacaaaggccagagcattcg SEQ ID NO.65 SC-X66 ctacacgacgctcttccgatcttggcttcaaggccagagcattcg SEQ ID NO.66 SC-X67 ctacacgacgctcttccgatcttggtggtaaggccagagcattcg SEQ ID NO.67 SC-X68 ctacacgacgctcttccgatctttcacgcaaggccagagcattcg SEQ ID NO.68 SC-X69 ctacacgacgctcttccgatctaactcaccaggccagagcattcg SEQ ID NO.69 SC-X70 ctacacgacgctcttccgatctaagagatcaggccagagcattcg SEQ ID NO.70 SC-X71 ctacacgacgctcttccgatctaaggacacaggccagagcattcg SEQ ID NO.71 SC-X72 ctacacgacgctcttccgatctaatccgtcaggccagagcattcg SEQ ID NO.72 SC-X73 ctacacgacgctcttccgatctaatgttgcaggccagagcattcg SEQ ID NO.73 SC-X74 ctacacgacgctcttccgatctacacgaccaggccagagcattcg SEQ ID NO.74 SC-X75 ctacacgacgctcttccgatctacagattcaggccagagcattcg SEQ ID NO.75 SC-X76 ctacacgacgctcttccgatctagatgtacaggccagagcattcg SEQ ID NO.76 SC-X77 ctacacgacgctcttccgatctagcacctcaggccagagcattcg SEQ ID NO.77 SC-X78 ctacacgacgctcttccgatctagccatgcaggccagagcattcg SEQ ID NO.78 SC-X79 ctacacgacgctcttccgatctaggctaacaggccagagcattcg SEQ ID NO.79 SC-X80 ctacacgacgctcttccgatctatagcgacaggccagagcattcg SEQ ID NO.80 SC-X81 ctacacgacgctcttccgatctatcattccaggccagagcattcg SEQ ID NO.81 SC-X82 ctacacgacgctcttccgatctattggctcaggccagagcattcg SEQ ID NO.82 SC-X83 ctacacgacgctcttccgatctcaaggagcaggccagagcattcg SEQ ID NO.83 SC-X84 ctacacgacgctcttccgatctcaccttacaggccagagcattcg SEQ ID NO.84 SC-X85 ctacacgacgctcttccgatctccatcctcaggccagagcattcg SEQ ID NO.85 SC-X86 ctacacgacgctcttccgatctccgacaacaggccagagcattcg SEQ ID NO.86 SC-X87 ctacacgacgctcttccgatctcctaatccaggccagagcattcg SEQ ID NO.87 SC-X88 ctacacgacgctcttccgatctcctctatcaggccagagcattcg SEQ ID NO.88 SC-X89 ctacacgacgctcttccgatctcgacacacaggccagagcattcg SEQ ID NO.89 SC-X90 ctacacgacgctcttccgatctcggattgcaggccagagcattcg SEQ ID NO.90 SC-X91 ctacacgacgctcttccgatctctaaggtcaggccagagcattcg SEQ ID NO.91 SC-X92 ctacacgacgctcttccgatctgaacaggcaggccagagcattcg SEQ ID NO.92 SC-X93 ctacacgacgctcttccgatctgacagtgcaggccagagcattcg SEQ ID NO.93 SC-X94 ctacacgacgctcttccgatctgagttagcaggccagagcattcg SEQ ID NO.94 SC-X95 ctacacgacgctcttccgatctgatgaatcaggccagagcattcg SEQ ID NO.95 SC-X96 ctacacgacgctcttccgatctaaacatcgaggccagagcattcg SEQ ID NO.96

[0075] The Y-strand DNA in this embodiment is shown in Table 2 below:

[0076] Table 2

[0077] ID Sequence (5'→3') Sequence number SC-Y1 atccacgtgcttgagagatcgcactcgtgtgaagacag SEQ ID NO.97 SC-Y2 atccacgtgcttgagatgcctaactcgtgtgaagacag SEQ ID NO.98 SC-Y3 atccacgtgcttgagagtggtcactcgtgtgaagacag SEQ ID NO.99 SC-Y4 atccacgtgcttgagaccactgtctcgtgtgaagacag SEQ ID NO.100 SC-Y5 atccacgtgcttgagacattggcctcgtgtgaagacag SEQ ID NO.101 SC-Y6 atccacgtgcttgag gctcttcactcgtgtgaagacag SEQ ID NO.102 SC-Y7 atccacgtgcttgagcatcaagtctcgtgtgaagacag SEQ ID NO.103 SC-Y8 atccacgtgcttgag gatgaatcctcgtgtgaagacag SEQ ID NO.104 SC-Y9 atccacgtgcttgagagtacaagctcgtgtgaagacag SEQ ID NO.105 SC-Y10 atccacgtgcttgagaacaaccactcgtgtgaagacag SEQ ID NO.106 SC-Y11 atccacgtgcttgagaaccgagactcgtgtgaagacag SEQ ID NO.107 SC-Y12 atccacgtgcttgagaacgcttactcgtgtgaagacag SEQ ID NO.108 SC-Y13 atccacgtgcttgagaagacggactcgtgtgaagacag SEQ ID NO.109 SC-Y14 atccacgtgcttgagaaggtacactcgtgtgaagacag SEQ ID NO.110 SC-Y15 atccacgtgcttgagacacagaactcgtgtgaagacag SEQ ID NO.111 SC-Y16 atccacgtgcttgagacagcagactcgtgtgaagacag SEQ ID NO.112 SC-Y17 atccacgtgcttgagacctccaactcgtgtgaagacag SEQ ID NO.113 SC-Y18 atccacgtgcttgagacgtatcactcgtgtgaagacag SEQ ID NO.114 SC-Y19 atccacgtgcttgagactatgcactcgtgtgaagacag SEQ ID NO.115 SC-Y20 atccacgtgcttgagagagtcaactcgtgtgaagacag SEQ ID NO.116 SC-Y21 atccacgtgcttgagaacgtgatctcgtgtgaagacag SEQ ID NO.117 SC-Y22 atccacgtgcttgagagcaggaactcgtgtgaagacag SEQ ID NO.118 SC-Y23 atccacgtgcttgagagtcactactcgtgtgaagacag SEQ ID NO.119 SC-Y24 atccacgtgcttgagatcctgtactcgtgtgaagacag SEQ ID NO.120 SC-Y25 atccacgtgcttgag gccaagacctcgtgtgaagacag SEQ ID NO.121 SC-Y26 atccacgtgcttgagcaaccacactcgtgtgaagacag SEQ ID NO.122 SC-Y27 atccacgtgcttgag gactagtactcgtgtgaagacag SEQ ID NO.123 SC-Y28 atccacgtgcttgagcaatggaactcgtgtgaagacag SEQ ID NO.124 SC-Y29 atccacgtgcttgagcacttcgactcgtgtgaagacag SEQ ID NO.125 SC-Y30 atccacgtgcttgagcagcgttactcgtgtgaagacag SEQ ID NO.126 SC-Y31 atccacgtgcttgagcataccaactcgtgtgaagacag SEQ ID NO.127 SC-Y32 atccacgtgcttgagccagttcactcgtgtgaagacag SEQ ID NO.128 SC-Y33 atccacgtgcttgagccgaagtactcgtgtgaagacag SEQ ID NO.129 SC-Y34 atccacgtgcttgagcgaacttactcgtgtgaagacag SEQ ID NO.130 SC-Y35 atccacgtgcttgagcgcatacactcgtgtgaagacag SEQ ID NO.131 SC-Y36 atccacgtgcttgagctcaatgactcgtgtgaagacag SEQ ID NO.132 SC-Y37 atccacgtgcttgagctggcatactcgtgtgaagacag SEQ ID NO.133 SC-Y38 atccacgtgcttgag gaatctgactcgtgtgaagacag SEQ ID NO.134 SC-Y39 atccacgtgcttgagcaagactactcgtgtgaagacag SEQ ID NO.135 SC-Y40 atccacgtgcttgag gagctgaactcgtgtgaagacag SEQ ID NO.136 SC-Y41 atccacgtgcttgag gatagacactcgtgtgaagacag SEQ ID NO.137 SC-Y42 atccacgtgcttgag gccacatactcgtgtgaagacag SEQ ID NO.138 SC-Y43 atccacgtgcttgag gcgagtaactcgtgtgaagacag SEQ ID NO.139 SC-Y44 atccacgtgcttgag gctaacgactcgtgtgaagacag SEQ ID NO.140 SC-Y45 atccacgtgcttgag ggagaacactcgtgtgaagacag SEQ ID NO.141 SC-Y46 atccacgtgcttgag gtacgcaactcgtgtgaagacag SEQ ID NO.142 SC-Y47 atccacgtgcttgag gtcgtagactcgtgtgaagacag SEQ ID NO.143 SC-Y48 atccacgtgcttgag gtctgtcactcgtgtgaagacag SEQ ID NO.144 SC-Y49 atccacgtgcttgag gtgttctactcgtgtgaagacag SEQ ID NO.145 SC-Y50 atccacgtgcttgag taggatgactcgtgtgaagacag SEQ ID NO.146 SC-Y51 atccacgtgcttgagaaacatcgctcgtgtgaagacag SEQ ID NO.147 SC-Y52 atccacgtgcttgagattgaggactcgtgtgaagacag SEQ ID NO.148 SC-Y53 atccacgtgcttgagctgtagccctcgtgtgaagacag SEQ ID NO.149 SC-Y54 atccacgtgcttgagacgctcgactcgtgtgaagacag SEQ ID NO.150 SC-Y55 atccacgtgcttgagccgtgagactcgtgtgaagacag SEQ ID NO.151 SC-Y56 atccacgtgcttgagcctcctgactcgtgtgaagacag SEQ ID NO.152 SC-Y57 atccacgtgcttgagcgactggactcgtgtgaagacag SEQ ID NO.153 SC-Y58 atccacgtgcttgagctgagccactcgtgtgaagacag SEQ ID NO.154 SC-Y59 atccacgtgcttgag gctcggtactcgtgtgaagacag SEQ ID NO.155 SC-Y60 atccacgtgcttgag ggtgcgaactcgtgtgaagacag SEQ ID NO.156 SC-Y61 atccacgtgcttgag tatcagcactcgtgtgaagacag SEQ ID NO.157 SC-Y62 atccacgtgcttgag tccgtctactcgtgtgaagacag SEQ ID NO.158 SC-Y63 atccacgtgcttgag tcttcacactcgtgtgaagacag SEQ ID NO.159 SC-Y64 atccacgtgcttgag tgaagagactcgtgtgaagacag SEQ ID NO.160 SC-Y65 atccacgtgcttgag tggaacaactcgtgtgaagacag SEQ ID NO.161 SC-Y66 atccacgtgcttgag tggcttcactcgtgtgaagacag SEQ ID NO.162 SC-Y67 atccacgtgcttgag tggtggtactcgtgtgaagacag SEQ ID NO.163 SC-Y68 atccacgtgcttgag ttcacgcactcgtgtgaagacag SEQ ID NO.164 SC-Y69 atccacgtgcttgagaactcaccctcgtgtgaagacag SEQ ID NO.165 SC-Y70 atccacgtgcttgagaagagatcctcgtgtgaagacag SEQ ID NO.166 SC-Y71 atccacgtgcttgagaaggacacctcgtgtgaagacag SEQ ID NO.167 SC-Y72 atccacgtgcttgagaatccgtcctcgtgtgaagacag SEQ ID NO.168 SC-Y73 atccacgtgcttgagaatgttgcctcgtgtgaagacag SEQ ID NO.169 SC-Y74 atccacgtgcttgagacacgaccctcgtgtgaagacag SEQ ID NO.170 SC-Y75 atccacgtgcttgagacagattcctcgtgtgaagacag SEQ ID NO.171 SC-Y76 atccacgtgcttgagagatgtacctcgtgtgaagacag SEQ ID NO.172 SC-Y77 atccacgtgcttgagagcacctcctcgtgtgaagacag SEQ ID NO.173 SC-Y78 atccacgtgcttgagagccatgcctcgtgtgaagacag SEQ ID NO.174 SC-Y79 atccacgtgcttgagaggctaacctcgtgtgaagacag SEQ ID NO.175 SC-Y80 atccacgtgcttgagatagcgacctcgtgtgaagacag SEQ ID NO.176 SC-Y81 atccacgtgcttgagatcattccctcgtgtgaagacag SEQ ID NO.177 SC-Y82 atccacgtgcttgagattggctcctcgtgtgaagacag SEQ ID NO.178 SC-Y83 atccacgtgcttgagcaaggagcctcgtgtgaagacag SEQ ID NO.179 SC-Y84 atccacgtgcttgagcaccttacctcgtgtgaagacag SEQ ID NO.180 SC-Y85 atccacgtgcttgagccatcctcctcgtgtgaagacag SEQ ID NO.181 SC-Y86 atccacgtgcttgagccgacaacctcgtgtgaagacag SEQ ID NO.182 SC-Y87 atccacgtgcttgagcctaatccctcgtgtgaagacag SEQ ID NO.183 SC-Y88 atccacgtgcttgagcctctatcctcgtgtgaagacag SEQ ID NO.184 SC-Y89 atccacgtgcttgagcgacacacctcgtgtgaagacag SEQ ID NO.185 SC-Y90 atccacgtgcttgagcggattgcctcgtgtgaagacag SEQ ID NO.186 SC-Y91 atccacgtgcttgagctaaggtcctcgtgtgaagacag SEQ ID NO.187 SC-Y92 atccacgtgcttgag gaacaggcctcgtgtgaagacag SEQ ID NO.188 SC-Y93 atccacgtgcttgag gacagtgcctcgtgtgaagacag SEQ ID NO.189 SC-Y94 atccacgtgcttgag gagttagcctcgtgtgaagacag SEQ ID NO.190 SC-Y95 atccacgtgcttgagacaagctactcgtgtgaagacag SEQ ID NO.191 SC-Y96 atccacgtgcttgagcgctgatcctcgtgtgaagacag SEQ ID NO.192

[0078] The nucleotide sequence of the XY linker is ctcaagcacgtggatcgaatgctctggcct (SEQ ID NO.193).

[0079] The nucleotide sequence of the STB linker is gaggacttggctgtcttcac (SEQ ID NO.194).

[0080] The nucleotide sequence of the STB-Chip is ccaagtcctcnnnnnnnnnnnnctgtctcttatacacatctgacgctgccgacgattttttttttttttttttttttttttvn (SEQ ID NO.195). "v" represents dATP, dGTP, or dCTP; "n" represents any one of dATP, dTTP, dGTP, or dCTP. In the Oligo(dT)n vn sequence, "vn" indicates the presence of an anchoring base at the 3' end, which specifically binds to the 5' end of Poly(A) to prevent excessive T bases from being reverse transcribed.

[0081] II. Tissue Sample Preparation

[0082] (1) Tissue sectioning and application

[0083] 1) Mouse spleen and thymus tissue were selected, embedded using OCT, and then cut into 10 μm thick frozen tissue sections using a cryostat. After thawing at room temperature, the tissue sections were applied to the coding area of ​​the STB chip prepared in Example 1 and stored at -80 ℃.

[0084] 2) Add 40 mL of methanol to a 50 mL sterile centrifuge tube and pre-cool at -20 °C for 30 min. Set the PCR instrument to 37 °C and place the adapter in the well for equilibration. Remove the STB chip with the tissue section attached obtained in step 1) from -80 °C and immediately transport it on dry ice. Remove the STB chip with the attached tissue section side facing up and immediately place it on the adapter. Incubate at 37 °C for 1 min. After incubation, immediately immerse the STB chip completely in the pre-cooled methanol, tighten the cap of the sterile centrifuge tube to prevent methanol evaporation, and transport it to a -20 °C freezer on dry ice. Place it on a centrifuge tube rack and incubate for 30 min.

[0085] (2) Tissue staining

[0086] Remove the STB chip from methanol and wipe off any excess liquid on the back with clean paper. Using a pipette, add 200 μL of isopropanol around the tissue sections onto the STB chip, ensuring even coverage. Incubate at room temperature for 1 min. After incubation, aspirate the reagents and wipe off any excess liquid on the back of the STB chip with clean paper. Air dry the STB chip. Using a pipette, add 200 µL of hematoxylin around the tissue sections onto the STB chip, ensuring even coverage. Incubate at room temperature for 7 min. Tilt the STB chip so that the bottom edge touches the clean paper, aspirate the reagents, and discard the chip. Then, completely immerse the STB chip in ultrapure water in a 50 mL sterile centrifuge tube and wash it up and down 15 times (approximately 1 second each time). Wipe off any excess liquid on the back of the STB chip and add 200 µL of Bluing agent to the STB chip. Incubate the STB chip with a blue buffer at room temperature for 2 min. Tilt the STB chip so that the bottom edge contacts a clean paper, remove the reagent, and discard the chip. Then, completely immerse the STB chip in 50 mL of ultrapure water in a sterile centrifuge tube and wash it up and down 15 times (about 1 s each time). Wipe off excess liquid from the back of the STB chip. Add 200 µL of freshly prepared Eosin Mix to the STB chip and incubate at room temperature for 1 min. Tilt the STB chip so that the bottom edge contacts a clean paper, remove the reagent, and discard the chip. Then, completely immerse the STB chip in 50 mL of ultrapure water in a sterile centrifuge tube and wash it up and down 15 times (about 1 s each time). Wipe off excess liquid from the back of the STB chip. Place the STB chip in the sample well of the PCR instrument adapter and incubate at 37 °C for 5 min before performing bright-field imaging.

[0087] (3) Tissue permeability

[0088] 1) Weigh 0.0339 g of pepsin and add it to 339 µL of NF water to prepare 0.1 M permeabilizing enzyme (9900 µL 0.1 M HCl + 100 µL enzyme solution). Add 100 µL of 0.01 M permeabilizing enzyme working solution to the sample wells, attach the STB chip sealing film, and immediately place it on a preheated PCR instrument adapter at 37 ℃. Close the heat cap and time for 20 min.

[0089] 2) Prepare 1.5 mL centrifuge tubes and prepare 330 µL of buffer containing 0.1× RNase Inhibitor SSC: Add 1.65 µL of 20× SSC and 3.3 µL of RNase Inhibitor to 325.05 µL of enzyme-free water. After permeabilization, remove the permeabilizing enzyme, add 100 µL of buffer containing 0.1× RNase Inhibitor SSC, and remove the 0.1× SSC from the reaction wells using a pipette. Repeat the washing process twice, for a total of three washes, retaining the 0.1× SSC from the last wash.

[0090] III. Acquisition of cDNA with spatial barcodes

[0091] (1) mRNA reverse transcription

[0092] 1) Prepare the RT Master Mix as shown in Table 3 below. Remove the last 0.1× SSC from the reaction well using a pipette, then add 80 µL of RT Master Mix to the reaction well and react at 42 °C for 2 h.

[0093] Table 3

[0094] RT Master Mix Final concentration 1× (μL) 2.2× (μL) Nuclease-free Water / 34.00 74.80 5× RT buffer 1× 16.00 35.20 50% PEG 8000 5% 8.00 17.60 dNTP 0.5 mM 4.00 8.80 GTP 1 mM 8.00 17.60 Template Switch Oligo 2.5 mM 2.00 4.40 RT Enzyme D / 4.00 8.80 RNase Inhibitor / 4.00 8.80 Total 80.00 176.00

[0095] 2) Remove the RT Master Mix from the reaction wells using a pipette, wash three times with 100 µL 0.1× SSC, then add 100 µL 80 mM KOH to the reaction wells and incubate at room temperature for 5 min; remove the KOH from the wells; then add 100 µL Buffer EB to the reaction wells, wash three times, and retain the last Buffer EB.

[0096] (2) cDNA double strand synthesis

[0097] Prepare the Second Strand Mix as shown in Table 4 on ice. Remove the last Buffer EB and add 75 µL of Second Strand Mix to the reaction well.

[0098] Table 4

[0099] Second Strand Mix Final concentration 1× (μL) 2.1× (μL) NF water / 40.5 85.05 10X isothermal 1X 7.5 15.75 <![CDATA[MgSO4]]> 6 mM 4.5 9.45 dNTP 1.4 mM 10.5 22.05 Second-stranded synthetic immobilized primers 10 μM 7.5 15.75 BST 2.0 / 4.5 9.45 Total 75 157.5

[0100] Start PCR according to the procedure in Table 5 below:

[0101] Table 5

[0102]

[0103] (3) cDNA denaturation

[0104] 1) Remove the reaction solution from the reaction wells, wash three times with 100 μL Buffer EB, and place the STB chip open to air dry. After the STB chip is completely dry, add 37 μL 80 mM KOH to the reaction wells and incubate at room temperature for 10 min to obtain KOH eluent.

[0105] 2) Prepare a 0.2 mL EP tube for incubation, and add 5 μL of Tris-HCl (1 M, pH 7.0) to the EP tube. Place it on ice or at 4 °C for later use.

[0106] 3) After incubation, take 35 μL of the KOH eluent obtained in step 1) from the reaction well and add it to the Tris-HCl (1 M, pH 7.0) prepared in step 2), and mix thoroughly to obtain the sample.

[0107] IV. cDNA Amplification and Quality Control

[0108] (1) cDNA pre-amplification

[0109] Prepare the cDNA PCR Mix shown in Table 6 on ice, vortex and centrifuge, add it to the above sample and mix by pipetting and aspirating 15 times, then centrifuge briefly.

[0110] Table 6

[0111] cDNA PCR Mix Final concentration 1×(μL) 2.2 × (μL) cDNA Primers mix 0.8 mM 10 22 2× KAPA HIFI 50 110 Total 60 132

[0112] The cDNA Primers mix consists of an 8mM mixture of cDNA Forward Primer and cDNA Reverse Primer, with the specific sequences shown in Table 7 below:

[0113] Table 7

[0114] cDNA Forward Primer ctacacgacgctcttccgatct (SEQ ID NO.196) cDNA Reverse Primer aagcagtggtatcaacgcagag (SEQ ID NO.197)

[0115] Perform PCR according to the procedure in Table 8 below. The resulting product contains a pre-amplified cDNA library.

[0116] Table 8

[0117]

[0118] (2) cDNA purification and quantification

[0119] The pre-amplified cDNA library from step (1) was purified using 0.8× magnetic beads and recovered with 42 μL of enzyme-free water. Then, 1 μL of the purified pre-amplified cDNA library was used to prepare a qPCR system for qPCR quantification. The number of rounds for the second amplification (ct+2 rounds) was determined based on the ct value given by the qPCR.

[0120] The qPCR system used in the above qPCR is shown in Table 9 below:

[0121] Table 9

[0122] qPCR system 1×(μL) Nuclease-free Water 3.7 KAPASYBR FASTqPCR Master Mix 5.0 cDNA Primers mix (shown in Table 7) 0.3 Preamplified cDNA library 1 total 10.0

[0123] (3) Second amplification of cDNA

[0124] The 40 μL pre-amplified cDNA was evenly divided into two 200 μL centrifuge tubes. One tube contained 5 μL of 5' pcDNA Primers mix and 25 μL of 2×PCR Mix, and the other tube contained 5 μL of STB cDNA Primers mix and 25 μL of 2×PCR Mix. PCR was then performed according to the procedure shown in Table 10 below. After the procedure, the cDNA was purified using 0.6× magnetic beads and recovered with 31 μL of enzyme-free water to obtain the secondary amplified cDNA library.

[0125] Table 10

[0126]

[0127] (4) cDNA quality control and quantification

[0128] 1) cDNA quantification: The cDNA library in the second amplification product obtained in step (3) was quantified using the Qubit4.0 and Qubit dsDNA HS kits. Generally, the cDNA concentration is greater than 20 ng / µL.

[0129] 2) cDNA fragment quality control: The materials obtained in step 1) were subjected to fragment quality control using an Agilent High Sensitivity D5000 Assay. The cDNA was diluted to 20 ng / µL. 1 µL of the diluted sample was taken from each sample and placed into an eight-tube centrifuge tube. 10 µL of buffer was added. The operation can be referenced from the 4200 Tape Station instrument. The fragment length was 500-2000 bp, with the main peak concentrated around 1000 bp.

[0130] This yields cDNA with spatial barcodes. This cDNA has two uses: one part is used in the seventh part for library construction to obtain spatial transcriptome library information, and the other part is used for circularization of cDNA in the fifth and sixth parts and enrichment of TCR / BCR.

[0131] V. cDNA circularization

[0132] (1) Double-chain cyclization

[0133] Take the secondary amplified cDNA library (200 ng) obtained from the fourth part above using STB cDNA Primers mix, prepare the circularization system shown in Table 11 below on ice, and then perform PCR reaction at 50℃ for 5 min and 75℃ for 10 min. After the reaction, add 1 µL T5 Exo and 1 µL Exo I, and react at 37°C for 1 h. Purify with 1.5 × beads and elute with 41 µL NFw.

[0134] Table 11

[0135] Double-chain cyclic system 1x (μL) 2×CE Mix 5 cDNA 200 ng Nuclease-free Water To 10 total 10

[0136] (2) Single-chain cyclization

[0137] Take 200 ng of the secondary amplified cDNA library obtained from the fourth part above using 5'P cDNA Primers mix, prepare the circularization system shown in Table 12 below on ice, and then perform PCR reaction at 98℃ for 3 min, immediately placing it on ice; after the reaction, add 0.25 µL 0.1M DTT, 2.5 µL 10mM ATP and 2.5 µL T4 DNA ligase, and react at room temperature for 16 h; after the reaction, add 1 µL T5 Exo, 1 µL Exo I and 1 µL 5M NaCl, and react at 37°C for 1 h; purify with 1.5 × beads and elute with 41 μL NFw.

[0138] Table 12

[0139] Single-chain cyclic system 1x (μL) cDNA 200 ng 1 uM Splint-oligo 1.2 2× buffer 10 50% PEG8000 1 Nuclease-free Water To 20 Total 20

[0140] The formulation for 2× buffer is: 20 mM MgCl2, 100 mM Tris-HCl 7.5;

[0141] VI. cDNA V(D)J Amplification

[0142] (1) TCR amplification in mouse thymus

[0143] 1) First round of TCR amplification

[0144] Collect mouse thymus cDNA after single-stranded and double-stranded circularization (denoted as TS and TD, respectively), and pre-set the PCR amplification program as shown in Table 14. Prepare the TCR first-round amplification reaction system as shown in Table 13 on ice and gently mix with a pipette. Prepare 0.2 mL PCR tubes, add 60 μL of the TCR first-round amplification reaction system to each PCR tube, and then add 40 μL of the corresponding cDNA sample. Mix thoroughly, centrifuge briefly, and transfer to a PCR instrument for TCR first-round amplification.

[0145] Table 13

[0146] TCR first-round amplification reaction system 1×(μL) 2.1 × (μL) 2× KAPA HIFI 50 105 TCR primer mix 1 5 10.5 Nuclease-free Water 5 10.5 Total 60 126

[0147] Table 14

[0148]

[0149] After the first round of TCR amplification, the TCR products of TS and TD were purified and sorted using 0.5 / 0.8 × beads and eluted with 31 μL NFw.

[0150] 2) Q-PCR quantification

[0151] After elution, 1 μL of the TCR first-round amplification product from each of the two samples (LTS and TD) was taken and prepared into qPCR systems as shown in Table 15 below for qPCR quantification. The number of rounds for the second round of amplification (ct+3 rounds) was determined based on the ct value given by qPCR quantification.

[0152] Table 15

[0153] qPCR system 1×(μL) 2.1 × (μL) qPCR mix (2×) 5 10.5 TCR primer mix 2 0.5 1.05 Nuclease-free Water 3.5 7.35 Purified product 1 2.1 Total 10 21

[0154] 3) Second round of TCR amplification

[0155] Set up the TCR second-round amplification program in advance. Prepare the TCR second-round amplification reaction system as shown in Table 16 on ice and gently mix with a pipette. Prepare 0.2 mL PCR tubes, add 70 μL of the TCR second-round amplification reaction system to each PCR tube, and then add 30 μL of the TCR first-round amplification reaction products of TS and TD, respectively. Mix thoroughly, centrifuge briefly, and transfer to a PCR instrument for TCR second-round amplification according to the program shown in Table 17.

[0156] Table 16

[0157] TCR second-round amplification reaction system 1×(μL) 2.1 × (μL) 2× KAPA HIFI 50 105 TCR primer mix 2 5 10.5 Nuclease-free Water 15 31.5 Total 70 147

[0158] Table 17

[0159]

[0160] After the reaction, the product was purified and sorted using 0.5 / 0.8 × beads, eluted with 31 μL NFw, and 1 µL of the product was taken for quantification using Qubit 4.0 and Qubit dsDNA HS kits. Generally, the cDNA concentration is greater than 20 ng / µL.

[0161] The cDNA obtained from the second round of TCR amplification and enrichment can be used for subsequent T cell receptor (TCR) library construction.

[0162] (2) Amplification of BCR in mouse spleen

[0163] 2) BCR first-round amplification

[0164] Mouse spleen cDNA (denoted as SS and SD) after single-stranded and double-stranded circularization were collected respectively, and PCR amplification programs as shown in Table 19 were pre-set. The BCR first-round amplification reaction system shown in Table 18 was prepared on ice and gently mixed by pipetting. 0.2 mL PCR tubes were prepared, and 60 μL of the BCR first-round amplification reaction system was added to each tube, followed by 40 μL of the corresponding cDNA sample. The mixture was thoroughly mixed, briefly centrifuged, and transferred to a PCR instrument for BCR first-round amplification.

[0165] Table 18

[0166] BCR first-round amplification reaction system 1×(μL) 2.1 × (μL) 2× KAPA HIFI 50 105 BCR primer mix 1 4 8.4 Nuclease-free Water 6 12.6 Total 60 126

[0167] Table 19

[0168]

[0169] After the first round of BCR amplification reaction, the products were purified and sorted using 0.5 / 0.8 × beads, and eluted with 31 μL NFw to obtain the first round of TCR amplification reaction products of SS and SD, respectively.

[0170] 2) Q-PCR quantification

[0171] After elution, 1 μL of BCR first-round amplification products from both saturated and SD samples were used to prepare qPCR systems as shown in Table 20 below for qPCR quantification. The number of second-round amplification (ct+3 rounds) was determined based on the ct value given by qPCR quantification.

[0172] Table 20

[0173] qPCR system 1×(μL) 2.1 × (μL) qPCR mix (2×) 5 10.5 BCR primer mix 2 0.5 1.05 Nuclease-free Water 3.5 7.35 Purified product 1 2.1 Total 10 21

[0174] 3) BCR second-round amplification

[0175] Set up the BCR second-round amplification program in advance. Prepare the BCR second-round amplification reaction system as shown in Table 21 on ice and gently mix with a pipette. Prepare 0.2 mL PCR tubes, add 70 μL of the BCR second-round amplification reaction system to each PCR tube, and then add 30 μL of S and SD of the BCR first-round amplification reaction product, respectively. Mix thoroughly, centrifuge briefly, and transfer to a PCR instrument to perform the BCR second-round amplification according to the program shown in Table 22.

[0176] Table 21

[0177] BCR second-round amplification reaction system 1×(μL) 2.1 × (μL) 2× KAPA HIFI 50 105 BCR primer mix 2 4 8.4 Nuclease-free Water 16 33.6 Total 70 147

[0178] Table 22

[0179]

[0180] After the reaction, the product was purified and sorted using 0.5 / 0.8 × beads, eluted with 31 μL NFw, and 1 µL of the product was taken for quantification using Qubit 4.0 and Qubit dsDNA HS kits. Generally, the cDNA concentration is greater than 20 ng / µL.

[0181] The cDNA obtained from the second round of BCR amplification and enrichment can be used for subsequent B cell receptor (BCR) library construction.

[0182] The primer ratios and sequences used in the above amplification reactions are as follows:

[0183] TCR primer mix 1 is shown in Table 23 below:

[0184] Table 23

[0185] Primer name μL N1-F (100 μM) 1 MouTCR-R1-01 (100 μM) 2 MouTCR-R1-02 (100 μM) 2

[0186] TCR primer mix 2 is shown in Table 24 below:

[0187] Table 24

[0188] Primer name μL N1-F (100 μM) 1 MouTCR-R2-01 (100 μM) 2 MouTCR-R2-02 (100 μM) 2

[0189] BCR primer mix 1 is shown in Table 25 below:

[0190] Table 25

[0191] Primer Name μL N1-F (100 μM) 10 MouBCR-R1-01 (100 μM) 3.75 MouBCR-R1-02 (100 μM) 1.75 MouBCR-R1-03 (100 μM) 1 MouBCR-R1-04 (100 μM) 3 MouBCR-R1-05 (100 μM) 2.5 MouBCR-R1-06 (100 μM) 2.5 MouBCR-R1-07 (100 μM) 3 MouBCR-R1-08 (100 μM) 5 MouBCR-R1-09 (100 μM) 1.25 MouBCR-R1-10 (100 μM) 1.25 MouBCR-R1-11 (100 μM) 2.5

[0192] BCR primer mix 2 is shown in Table 26 below:

[0193] Table 26

[0194] Primer Name μL N1-F (100 μM) 10 MouBCR-R2-01 (100 μM) 3.75 MouBCR-R2-02 (100 μM) 1.75 MouBCR-R2-03 (100 μM) 1 MouBCR-R2-04 (100 μM) 3 MouBCR-R2-05 (100 μM) 2.5 MouBCR-R2-06 (100 μM) 2.5 MouBCR-R2-07 (100 μM) 3 MouBCR-R2-08 (100 μM) 5 MouBCR-R2-09 (100 μM) 1.25 MouBCR-R2-10 (100 μM) 1.25 MouBCR-R2-11 (100 μM) 2.5

[0195] The sequence required for enriching V(D)J is shown in Table 27 below: (5'→3'):

[0196] Table 27

[0197] N1-F tcgtcggcagcgtcag (SEQ ID NO.198) MouTCR-R1-01 ctggttgctccaggcaatgg (SEQ ID NO.199) MouTCR-R1-02 tgtaggcctgagggtccgt (SEQ ID NO.200) MouTCR-R2-01 agtcaaagtcggtgaacaggca (SEQ ID NO.201) MouTCR-R2-02 ggccaagcacacgagggta (SEQ ID NO.202) MouBCR-R1-01 tcagcacgggacaaactcttct (SEQ ID NO.203) MouBCR-R1-02 gcaggagacagactcttctcca (SEQ ID NO.204) MouBCR-R1-03 aactggctgctcatggtgt (SEQ ID NO.205) MouBCR-R1-04 tggtgcaagtgtggttgaggt (SEQ ID NO.206) MouBCR-R1-05 tggtcacttggctggtggtg (SEQ ID NO.207) MouBCR-R1-06 cacttggcaggtgaactgttttct (SEQ ID NO.208) MouBCR-R1-07 aaccttcaaggatgctcttggga (SEQ ID NO.209) MouBCR-R1-08 ggacagggatccagagttcca (SEQ ID NO.210) MouBCR-R1-09 aggtgacggtctgacttggc (SEQ ID NO.211) MouBCR-R1-10 gctggacagggctccatagtt (SEQ ID NO.212) MouBCR-R1-11 ggcaccttgtccaatcatgttcc (SEQ ID NO.213) MouBCR-R2-01 tacacaccagtgtggcctt (SEQ ID NO.214) MouBCR-R2-02 caggccactgtcacaccact (SEQ ID NO.215) MouBCR-R2-03 caggccactgtcacaccact (SEQ ID NO.216) MouBCR-R2-04 gaggccagcacagtgacct (SEQ ID NO.217) MouBCR-R2-05 gcagggaagttcacagtgct (SEQ ID NO.218) MouBCR-R2-06 ctgtttgagatcagtttgccatcct (SEQ ID NO.219) MouBCR-R2-07 tgcgaggtggctaggtacttg (SEQ ID NO.220) MouBCR-R2-08 cccttgaccaggcatcc (SEQ ID NO.221) MouBCR-R2-09 aggtcacggaggaaccagttg (SEQ ID NO.222) MouBCR-R2-10 ggcatcccagtgtcaccga (SEQ ID NO.223) MouBCR-R2-11

[0198] VII. Library Construction

[0199] This section uses cDNA from Part 4 and Part 6 to construct libraries. The cDNA from Part 4 is used for constructing a spatial transcriptome library, and the cDNA from Part 6 is used for constructing a spatial immune genome library.

[0200] (1) Fragmentation, end repair & adding "A"

[0201] Take 50 ng of the secondary amplified cDNA library obtained in Part IV and 50 ng of each cDNA sample obtained in Part VI (corresponding to TD, TS, SS and SD) into 200 μL EP tubes according to the cDNA concentration, and make up the volume to 40 μL with enzyme-free water. Prepare the reaction system as shown in Table 28 below on ice, and prepare the PCR instrument according to the procedure shown in Table 29 below. After putting the EP tubes in, skip the first step to start the reaction.

[0202] Table 28

[0203] agaagatccacttcaccttgaac (SEQ ID NO.224) System 1× (μL) 40.00 50 ng cDNA 4.00 Frag / AT Buffer 6.00 Frag / AT Enzyme Mix 50.00

[0204] Table 29

[0205]

[0206] (2) Connector connection

[0207] The tubes containing the samples obtained after fragmentation, end repair, and addition of "A" in step (1) were placed on ice. The reaction system shown in Table 30 was prepared, mixed, and placed in a PCR instrument. The reaction was carried out at 20°C for 15 min. After the reaction, the samples were purified with 0.8× beads and eluted with 15 µL NFw.

[0208] Table 30

[0209] Total Amplification System 1× (μL) 50.00 Product of the previous step 20.00 Ligation Master Mix 5.00 Adapter Oligos 75.00

[0210] (3) PCR amplification

[0211] Select a unique index for each sample and record the index name after the corresponding sample name. Set up the PCR program in advance according to Table 32 below, prepare the reaction system as shown in Table 31 below, mix well, and place it in the PCR instrument. Perform the reaction in the pre-set PCR instrument. After the reaction, purify with 0.6× beads and elute with 20 µL NFw to obtain the corresponding sample library.

[0212] Table 31

[0213] Total PCR System 1× (μL) 15.00 Purified product of adapter ligation 5.00 SI-P5 xx (xx is 05 - 08) 5.00 SI-P7 xx (xx is 01 - 08) 25.00 Amplification Master Mix Total 50.00

[0214] Table 32

[0215]

[0216] Quantification was performed using 1 µL of the corresponding sample library with Qubit 4.0 and Qubit dsDNA HS kits. The library concentration was generally greater than 20 ng / µL.

[0217] The sequence required to construct the library is shown in Table 33 below: (5'→3'):

[0218] Table 33

[0219] SI_P7 01 caagcagaagacggcatacgagataggctccggtgactggagttcagacgtgt (SEQ ID NO.225) SI_P7 02 caagcagaagacggcatacgagatgcagcgtagtgactggagttcagacgtgt (SEQ ID NO.226) SI_P7 03 caagcagaagacggcatacgagatctgcgcatgtgactggagttcagacgtgt (SEQ ID NO.227) SI_P7 04 caagcagaagacggcatacgagatgagcgctagtgactggagttcagacgtgt (SEQ ID NO.228) SI_P7 05 caagcagaagacggcatacgagatcgctcagtgtgactggagttcagacgtgt (SEQ ID NO.229) SI_P7 06 caagcagaagacggcatacgagatgtcttagggtgactggagttcagacgtgt (SEQ ID NO.230) SI_P7 07 caagcagaagacggcatacgagatactgatcggtgactggagttcagacgtgt (SEQ ID NO.231) SI_P7 08 caagcagaagacggcatacgagattagctgcagtgactggagttcagacgtgt (SEQ ID NO.232) SP-P5 05 aatgatacggcgaccaccgagatctacacgtaaggagacactctttccctacacgacgctc (SEQ ID NO.233) SP-P5 06 aatgatacggcgaccaccgagatctacacactgcataacactctttccctacacgacgctc (SEQ ID NO.234) SP-P5 07 aatgatacggcgaccaccgagatctacacaaggagtaacactctttccctacacgacgctc (SEQ ID NO.235) SP-P5 08 aatgatacggcgaccaccgagatctacacctaagcctacactctttccctacacgacgctc (SEQ ID NO.236)

[0220] VIII. Sequencing and Data Analysis

[0221] The obtained samples were subjected to paired-end sequencing using the Illumina NovaSeq platform, with a sequencing depth of approximately 200 million reads per sample. These sequencing reads will be used for subsequent bioinformatics analysis to yield a series of biological results, such as... Figure 2 As shown, to meet the requirements of next-generation sequencing, this embodiment designed a coding capture strand, pre-added a reverse sequencing adapter matching the Illumima sequencing platform for sequencing the circularized library, and designed an experimental flowchart ( Figure 2 A). A coding chip was fabricated using a newly designed capture strand, and its feasibility was verified by next-generation sequencing. Figure 2 B). Next, in this embodiment, different DNA circularization methods were used on frozen samples of mouse spleens using an encoding chip, including single-strand and double-strand circularization methods based on linkage or GibsonAssembly, and BCRs were enriched. Simultaneously, the spatial characterization of the transcriptome and B cell receptors was obtained. Figure 2 C). Simultaneously, this embodiment utilized an encoding chip to detect frozen samples of mouse thymus tissue, obtaining spatial characterizations of the transcriptome and T-cell receptors.

[0222] In specific data processing, regions of interest (ROIs) were identified using DynamicST Assist software (https: / / github.com / DynamicBiosystems / DynamicST-Assist) based on fluorescently labeled tissue nuclei micrographs. A custom script was then used to generate spatial data compatible with the 10× Genomics format, which was directly loaded using the Read10X_Image function in Seurat (v5.0.0). Spatial barcodes were extracted from the FASTQ files of the transcriptome using DynamicST software (https: / / github.com / DynamicBiosystems / DynamicST / releases / tag / v1.0.7) to obtain its spatial distribution information. Spatial barcodes were extracted from the FASTQ files of the immune repertoire using Trust 4 (reference DOI: 10.1126 / science.adf8486) to obtain the spatial distribution information of its TCR / BCR repertoires. This information was then integrated with the fluorescently labeled tissue nuclei micrographs to simultaneously obtain the expression information of both repertoires at the tissue spatial level.

[0223] The above description is merely a preferred embodiment of the present invention, and therefore should not be construed as limiting the scope of the present invention. All equivalent changes and modifications made in accordance with the scope of the patent and the contents of the specification should still fall within the scope of the present invention.

Claims

1. A spatial immuno-met sequencing method based on DNA circularization strategy, characterized in that: Comprise the following steps: (1) STB chip preparation: modify the glass slide, obtain a microfluidic chip, and construct a spatial barcode capture array therein, the microfluidic chip is orthogonally arranged, comprising two groups of microchannels in the horizontal X axis and the vertical Y axis, a plurality of X chain DNAs are connected in the horizontal X axis microchannel group, a plurality of Y chain DNAs are connected in the vertical Y axis microchannel group, and the plurality of Y chain DNAs are connected with a capture sequence with reverse Read 1; (2) Tissue sample preparation: affix the tissue sections of spleen and thymus to the STB chip prepared in step (1), and fix, stain and permeabilize the tissue sections; (3) Obtain cDNA with spatial barcode: sequentially perform mRNA reverse transcription, cDNA double-strand synthesis and cDNA denaturation on the tissue sample prepared in step (2); (4) cDNA amplification and quality control: pre-amplify, purify and quantify the cDNA obtained in step (3), and perform second amplification, quality control and quantification; (5) cDNA circularization: double-strand circularization or single-strand circularization of the cDNA obtained in step (4); (6) cDNA V(D)J amplification: TCR amplification or BCR amplification of the double-strand circularized or single-strand circularized cDNA obtained in step (5) to obtain products corresponding to the above thymus and spleen; (7) Library construction: fragmentize, end-repair, A-tailing, adapter-ligate and PCR-amplify the products obtained in steps (4) and (6) to construct spatial transcriptome library and spatial immune group library, respectively; (8) Sequencing and data analysis: high-throughput sequencing of the library constructed in step (7), and mapping analysis of the spatial distribution of the immune group library according to the spatial barcode.

2. The spatial immunome sequencing method of claim 1, wherein: The step (1) comprises: modifying the glass slide with γ-aminopropyl triethoxysilane and the fifth generation polyamidoamine dendrimer, introducing X chain DNA and Y chain DNA as barcodes in the horizontal X axis and the vertical Y axis microchannels respectively by microfluidic technology, forming a capture sequence array, and connecting a capture sequence with reverse Read 1; wherein the X chain DNA sequence is shown as SEQ ID NO. 01 to 96, the Y chain DNA sequence is shown as SEQ ID NO. 97 to 192, the XY linker sequence is shown as SEQ ID NO. 193, and the capture sequence is annealed from STB linker shown as SEQ ID NO. 194 and STB-Chip shown as SEQ ID NO.

195.

3. The spatial immunome sequencing method of claim 1, wherein: In the step (2), the tissue section is a 10 μm thick frozen tissue section, stained with HE staining solution, and permeabilized with 0.1M permeabilization enzyme working solution at 37℃ for 20 min.

4. The spatial immunome sequencing method of claim 1, wherein: In the step (3), the mRNA reverse transcription is performed using the RT Master Mix at 42℃ for 2 hours, the double-strand synthesis is performed using the Second Strand Mix according to the procedure of 37℃ for 15 min, 45℃ for 15 min, 55℃ for 15 min, and 65℃ for 15 min, and the denaturation is performed using 80 mM KOH at room temperature for 10 min.

5. The spatial immunome sequencing method of claim 1, wherein: In the step (4), the pre-amplification is performed using the cDNA PCR Mix for 6 cycles of PCR, the purification and quantification are performed using 0.8× magnetic bead purification and a qPCR system, the second amplification is performed according to the qPCR ct value for 2 cycles, and the quality control is performed using the Qubit dsDNA HS kit for quantification and the Agilent High Sensitivity D5000 Assay for fragment analysis.

6. The spatial immunome sequencing method of claim 1, wherein: In the step (5), the double-strand circularization is performed using the 2×CE Mix at 50℃ for 5 min and 75℃ for 10 min, followed by adding T5 Exo and Exo I at 37℃ for 1 h, the single-strand circularization is performed using the Splint-oligo and T4 DNA ligase at room temperature for 16 h, followed by adding T5 Exo, Exo I, and NaCl at 37℃ for 1 h.

7. The spatial immunome sequencing method of claim 1, wherein: In the step (6), the TCR amplification is performed using the TCR primer mix 1 for the first round of 10 cycles of PCR, followed by the second round of amplification for 3 cycles according to the qPCR ct value, and the BCR amplification is performed using the BCR primer mix 1 for the first round of 10 cycles of PCR, followed by the second round of amplification for 3 cycles according to the qPCR ct value.

8. The spatial immunome sequencing method of claim 7, wherein: The TCR primer mix 1 comprises the primer sequences shown in SEQ ID NO. 198 to 200, and the TCR primer mix 2 comprises the primer sequences shown in SEQ ID NO. 198 and SEQ ID NO. 201 to 202; the BCR primer mix 1 comprises the sequences shown in SEQ ID NO. 198, 203 to 213, and the BCR primer mix 2 comprises the sequences shown in SEQ ID NO. 198, 214 to 224.

9. The spatial immunome sequencing method of claim 1, wherein: In the step (7), the fragmentation, end repair, and A addition are performed using the Frag / AT Buffer and the Frag / AT Enzyme Mix at 30℃ for 3 min and 65℃ for 30 min, and the PCR amplification is performed using the SI-P5 xx primer shown in SEQ ID NO. 225 to 232 and the SI-P7 xx primer shown in SEQ ID NO. 233 to 236.

10. The spatial immunome sequencing method of any one of claims 1 to 9, wherein: It is suitable for mice.