SNP for identifying bulbus fritillariae cirrhosae medicinal material base stock seeds and application thereof
Through molecular labeling technology of SNP sites, PCR amplification and pyrosequencing were used to identify the base species of Fritillaria citrus medicinal materials, solving the problem of identifying Fritillaria citrus medicinal materials, achieving efficient and accurate identification of base species, ensuring the quality and efficacy of the medicinal materials.
Patent Information
- Application Number
- CN202510648931.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-05-21
- Filing Date
- 2025-05-20
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2045-05-20
AI Technical Summary
The existing technology is difficult to quickly and accurately identify the basic species of Fritillaria citrus medicinal materials, resulting in the emergence of counterfeit and inferior products on the market, affecting the efficacy and industrialization process.
The molecular marking identification was used for SNP sites (SNP1, SNP2, SNP3, SNP4 and SNP5), and the base species of Fritillaria citrus medicinal materials were determined by PCR amplification and pyrosequencing technology, including Gansu Fritillaria, Fritillaria slut, Fritillaria slut, Fritillaria slut, Fritillaria slut, Fritillaria slut, Fritillaria slut, Fritillaria slut and Fritillaria slut.
The accurate identification of the six basic species of Fritillaria citrus medicinal materials has been achieved, the sensitivity and specificity of identification have been improved, and the quality of the medicinal materials and the reliability of clinical efficacy have been ensured.
Smart Images

Figure CN120350159A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of nucleic acid determination or testing methods in biochemistry, and particularly relates to SNPs for identifying original species of Fritillaria cirrhosa medicinal materials and applications thereof.
[0002] CROSS-REFERENCE TO RELATED APPLICATIONS
[0003] This application claims priority to the Chinese patent application (application number 202410631567.2) filed on May 21, 2024, and the entire contents of that patent application are incorporated herein by reference. Background Art
[0004] Sichuan Fritillaria is the dried bulb of the genus Fritillaria in the Liliaceae family and is one of China's precious medicinal materials. Its source is the dried bulbs of Fritillaria cirrhosa, Fritillaria thunbergii, Fritillaria gansuensis, Fritillaria thunbergii, Fritillaria taibaiensis or Fritillaria wabuensis. According to the differences in medicinal properties, it is divided into "Songbei", "Qingbei", "Lubei" and "cultivated products". Dark purple Fritillaria is the main basal plant of "Songbei"; "Qingbei" mainly comes from Fritillaria cirrhosa, Fritillaria gansuensis and Fritillaria taibaiensis; the main basal plant of "Lubei" is Fritillaria thunbergii; Fritillaria wabuensis is the main source of "cultivated products". Fritillaria cirrhosa has significant medicinal effects, but its price is very expensive. Therefore, there are many counterfeit products with similar characteristics to Fritillaria cirrhosa but inferior price and medicinal effects as Fritillaria cirrhosa in the market. In addition, since the medicinal quality of "Songbei" is worse than "Qingbei", "Lubei" and "cultivated products", it is not uncommon to use "Qingbei" and other inferior Fritillaria cirrhosa to impersonate "Songbei" in the market. Studies have shown that there are also large differences in the effective ingredient content and pharmacological effects of different original Fritillaria cirrhosa. These phenomena will have a serious impact on the clinical efficacy of Fritillaria cirrhosa and the reliability of scientific research, and will also seriously hinder the industrialization process of Fritillaria cirrhosa as a precious Chinese medicinal material. Therefore, it is urgent to develop a method for quickly and accurately identifying the original species of Fritillaria cirrhosa.
[0005] At present, there are studies on the identification of the original plants, pieces of medicine and Chinese patent medicine of the traditional Chinese medicine Fritillaria cirrhosa, including microscopic, physical and chemical, molecular and other methods. However, these studies are mainly carried out on the adulterated species of Fritillaria cirrhosa, and there are few reports on the identification of its original species. A study screened out a short sequence of 100bp by comparing the 12S rRNA of humans and 12 kinds of animals, and successfully completed the identification of human and various animal hair using pyrophosphate sequencing. This method has also been successfully used to detect rice mutants and adulteration detection studies of honeysuckle, oriental water chestnuts, etc. Therefore, a method for quantitative detection of SNP site variations based on pyrophosphate sequencing technology has been developed, which can be used for the effective identification of different original species of Fritillaria cirrhosa. Summary of the invention
[0006] The technical problem to be solved by the present invention is how to use molecular markers to identify and quantitatively detect different original species of Fritillaria cirrhosa and their products.
[0007] To solve the above technical problems, the present invention first provides the use of SNP sites in identifying or assisting in the identification of the original species of Fritillaria cirrhosa D. Don, wherein the SNP sites are 4 SNPs, namely SNP1, SNP2, SNP3 and SNP4, or any 3 SNPs, or any 2 SNPs, or any 1 SNP:
[0008] The SNP1 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 66th nucleotide of SEQ ID No: 1 in the sequence listing, and it is A or G. In SEQ ID No: 1, the letter R represents any one of A or G nucleotides;
[0009] The SNP2 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 58th nucleotide of SEQ ID No: 5 in the sequence listing, and it is A or G. In SEQ ID No: 5, the letter R represents any one of A or G nucleotides;
[0010] The SNP3 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 85th nucleotide of SEQ ID No: 9 in the sequence listing, and it is T or C. In SEQ ID No: 9, the letter Y represents any one of T or C nucleotides;
[0011] The SNP4 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 183rd nucleotide of SEQ ID No: 13 in the sequence listing, and it is T or C. In SEQ ID No: 13, the letter Y represents any one of T or C nucleotides.
[0012] In the above application, the SNP sites may further include SNP5; the SNP5 is an SNP in the genome of the species of the genus Fritillaria in the family Liliaceae, which is the 41st nucleotide of SEQ ID No: 17 in the sequence listing, and it is T or C. In SEQ ID No: 17, the letter Y represents any one of T or C nucleotides.
[0013] The present invention also provides the use of SNP sites in identifying or assisting in the identification of Fritillaria przewalskii Maxim. in the original species of Fritillaria cirrhosa D. Don, wherein the SNP site is SNP1;
[0014] The SNP1 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 66th nucleotide of SEQ ID No: 1 in the sequence listing, and it is A or G. In SEQ ID No: 1, the letter R represents any one of A or G nucleotides.
[0015] In the above application, the SNP locus may further include SNP5; SNP5 is an SNP in the genome of Fritillaria species of the family Liliaceae, which is the 41st nucleotide of SEQ ID No: 17 in the sequence listing, and it is T or C. In SEQ ID No: 17, the letter Y represents any one of T or C nucleotides.
[0016] The present invention also provides the application of the SNP locus in identifying or assisting in identifying Fritillaria cirrhosa D. Don var. cirrhosa and / or Fritillaria delavayi Franch., and the SNP locus is SNP2;
[0017] SNP2 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 58th nucleotide of SEQ ID No: 5 in the sequence listing, and it is A or G. In SEQ ID No: 5, the letter R represents any one of A or G nucleotides.
[0018] In the above application, the SNP locus may further include SNP5; SNP5 is an SNP in the genome of Fritillaria species of the family Liliaceae, which is the 41st nucleotide of SEQ ID No: 17 in the sequence listing, and it is T or C. In SEQ ID No: 17, the letter Y represents any one of T or C nucleotides.
[0019] The present invention also provides the application of the SNP locus in identifying or assisting in identifying Fritillaria cirrhosa D. Don var. unibracteata and / or Fritillaria cirrhosa D. Don var. wabuensis, and the SNP locus is SNP3;
[0020] SNP3 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 85th nucleotide of SEQ ID No: 9 in the sequence listing, and it is T or C. In SEQ ID No: 9, the letter Y represents any one of T or C nucleotides.
[0021] In the above application, the SNP locus may further include SNP5; SNP5 is an SNP in the genome of Fritillaria species of the family Liliaceae, which is the 41st nucleotide of SEQ ID No: 17 in the sequence listing, and it is T or C. In SEQ ID No: 17, the letter Y represents any one of T or C nucleotides.
[0022] The present invention also provides the application of the SNP locus in identifying or assisting in identifying Fritillaria cirrhosa D. Don var. taipaiensis, and the SNP locus is SNP4;
[0023] SNP4 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 183rd nucleotide of SEQ ID No: 13 in the sequence listing, and it is T or C. In SEQ ID No: 13, the letter Y represents any one of T or C nucleotides.
[0024] In the above application, the SNP locus may further include SNP5; SNP5 is an SNP in the genome of the species of the genus Fritillaria in the family Liliaceae, which is the 41st nucleotide of SEQ ID No: 17 in the sequence listing, and it is T or C, and the letter Y in SEQ ID No: 17 represents any one of T or C nucleotides.
[0025] The present invention also provides an application of a substance for detecting polymorphism in identifying or assisting in identifying the original species of Fritillaria cirrhosa D. Don: the polymorphism is a polymorphism combination of one or more SNPs among SNP1, SNP2, SNP3, and SNP4 in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don;
[0026] SNP1 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 66th nucleotide of SEQ ID No: 1 in the sequence listing, and it is A or G, and the letter R in SEQ ID No: 1 represents any one of A or G nucleotides;
[0027] SNP2 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 58th nucleotide of SEQ ID No: 5 in the sequence listing, and it is A or G, and the letter R in SEQ ID No: 5 represents any one of A or G nucleotides;
[0028] SNP3 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 85th nucleotide of SEQ ID No: 9 in the sequence listing, and it is T or C, and the letter Y in SEQ ID No: 9 represents any one of T or C nucleotides;
[0029] SNP4 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 183rd nucleotide of SEQ ID No: 13 in the sequence listing, and it is T or C, and the letter Y in SEQ ID No: 13 represents any one of T or C nucleotides.
[0030] In the above application, the SNP locus may further include SNP5; SNP5 is an SNP in the genome of the species of the genus Fritillaria in the family Liliaceae, which is the 41st nucleotide of SEQ ID No: 17 in the sequence listing, and it is T or C, and the letter Y in SEQ ID No: 17 represents any one of T or C nucleotides.
[0031] To solve the above technical problems, the present invention also provides a product, and the product may be any one of the following G1)-G5):
[0032] G1) The product contains a substance for detecting the polymorphism of one or more SNPs among SNP1, SNP2, SNP3, and SNP4, and the product is a product for identifying or assisting in identifying the original species of Fritillaria cirrhosa D. Don;
[0033] G2) The product contains a substance for detecting the polymorphism of SNP1, and the product is a product for identifying or assisting in the identification of the original species Fritillaria przewalskii Maxim.;
[0034] G3) The product contains a substance for detecting the polymorphism of SNP2, and the product is a product for identifying or assisting in the identification of the original species Fritillaria cirrhosa D. Don and / or Fritillaria delavayi Franch.;
[0035] G4) The product contains a substance for detecting the polymorphism of SNP3, and the product is a product for identifying or assisting in the identification of the original species Fritillaria unibracteata Hsiao et K. C. Hsia and / or Fritillaria wabuensis S. Y. Tang et S. C. Yue;
[0036] G5) The product contains a substance for detecting the polymorphism of SNP4, and the product is a product for identifying or assisting in the identification of the original species Fritillaria taipaiensis P. Y. Li;
[0037] The SNP1 is a SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 66th nucleotide of SEQ ID No:1 in the sequence listing, and it is A or G. In SEQ ID No:1, the letter R represents any one of the nucleotides A or G;
[0038] The SNP2 is a SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 58th nucleotide of SEQ ID No:5 in the sequence listing, and it is A or G. In SEQ ID No:5, the letter R represents any one of the nucleotides A or G;
[0039] The SNP3 is a SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 85th nucleotide of SEQ ID No:9 in the sequence listing, and it is T or C. In SEQ ID No:9, the letter Y represents any one of the nucleotides T or C;
[0040] The SNP4 is a SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 183rd nucleotide of SEQ ID No:13 in the sequence listing, and it is T or C. In SEQ ID No:13, the letter Y represents any one of the nucleotides T or C.
[0041] In the above product, the product may further contain a substance for detecting the polymorphism of SNP5;
[0042] The SNP5 is a SNP in the genome of the genus Fritillaria of the family Liliaceae, which is the 41st nucleotide of SEQ ID No:17 in the sequence listing, and it is T or C. In SEQ ID No:17, the letter Y represents any one of the nucleotides T or C.
[0043] In the above application or the above product, the polymorphism can be determined by at least one of the following methods for the nucleotide types of SNP1, SNP2, SNP3, SNP4 or SNP5 in the genome of the original species of Fritillaria cirrhosa: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single-base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein-DNA binding reaction, and a chip based on fluorescent molecule-DNA binding reaction.
[0044] In the above application or the above product, the substance can be any of the following D1), D2) or D3):
[0045] D1) A pair of PCR primers for amplifying a genomic DNA fragment of the original species of Fritillaria cirrhosa including the SNP site;
[0046] D2) A PCR reagent containing the pair of PCR primers described in D1);
[0047] D3) A kit containing the pair of PCR primers described in D1) or the PCR reagent described in D2).
[0048] The above pair of PCR primers is any one or a combination of multiple of the primer pairs composed of GSF1 and GSR1, the primer pairs composed of JSF1 and JSR1, the primer pairs composed of AHF1 and AHR1, and the primer pairs composed of TBF1 and TBR1:
[0049] The GSF1 is a single-stranded DNA shown in SEQ ID No.2 in the sequence listing;
[0050] The GSR1 is a single-stranded DNA shown in SEQ ID No.3 in the sequence listing;
[0051] The JSF1 is a single-stranded DNA shown in SEQ ID No.6 in the sequence listing;
[0052] The JSR1 is a single-stranded DNA shown in SEQ ID No.7 in the sequence listing;
[0053] The AHF1 is a single-stranded DNA shown in SEQ ID No:10 in the sequence listing;
[0054] The AHR1 is a single-stranded DNA shown in SEQ ID No:11 in the sequence listing;
[0055] The TBF1 is a single-stranded DNA shown in SEQ ID No:14 in the sequence listing;
[0056] The TBR1 is a single-stranded DNA shown in SEQ ID No:15 in the sequence listing.
[0057] The above PCR primers may also contain a primer pair composed of SF1 and SR1:
[0058] The SF1 is a single-stranded DNA shown in SEQ ID No:18 in the sequence listing;
[0059] The SR1 is a single-stranded DNA shown in SEQ ID No:19 in the sequence listing.
[0060] In the above application or the above product, the PCR primers may or may not be labeled with a label. The label refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels such as 32 P; binding moieties such as biotin; haptens such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and individual fluorescent dyes or fluorescent dyes combined with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The label can be a charged moiety (positive or negative charge) or, optionally, can be charge-neutral. The label can include nucleic acid or protein sequences or combinations thereof, as long as the sequence containing the label is detectable. In some embodiments, nucleic acids are directly detected without a label (e.g., directly reading the sequence).
[0061] In the above application or the above product, the product can be a reagent or a kit or a system. The system can include a combined product of a reagent or a kit, an instrument and analysis software, such as a product composed of PCR primers, PARMS master mix reagent, a microplate reader and the online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ), a combined product composed of PCR primers, PARMS master mix reagent, the online software SNP decoder and a real-time fluorescence quantitative PCR instrument.
[0062] In the above application or the above product, the substance may also contain sequencing primers that cooperate with the PCR primers;
[0063] The sequencing primer that cooperates with the primer pair composed of GSF1 and GSR1 is GSS1; the GSS1 is a single-stranded DNA shown in SEQ ID No.4 in the sequence listing;
[0064] The sequencing primer that pairs with the primer pair composed of the aforesaid JSF1 and JSR1 is JSS1; the JSS1 is a single-stranded DNA shown in SEQ ID No.8 in the sequence listing;
[0065] The sequencing primer that pairs with the primer pair composed of the aforesaid AHF1 and AHR1 is AHS1; the AHS1 is a single-stranded DNA shown in SEQ ID No:12 in the sequence listing;
[0066] The sequencing primer that pairs with the primer pair composed of the aforesaid TBF1 and TBR1 is TBS1; the TBS1 is a single-stranded DNA shown in SEQ ID No:16 in the sequence listing;
[0067] The sequencing primer that pairs with the primer pair composed of the aforesaid SF1 and SR1 is SS1; the SS1 is a single-stranded DNA shown in SEQ ID No.20 in the sequence listing.
[0068] The beneficial effects of the present invention are as follows:
[0069] The present invention provides 4 specific SNPs for identifying the original species of Fritillaria cirrhosa D. Don and their applications. These SNP molecular markers have strong sensitivity and specificity. By applying these specific SNP sites, 6 original species of Fritillaria cirrhosa D. Don can be successfully identified. Description of the Drawings
[0070] Figure 1 It is a PCR result diagram of 6 original species of Fritillaria cirrhosa D. Don. Among them, M is the marker, CK is the blank control, 1 is the PCR product at the 273rd position of the CP sequence of Fritillaria przewalskii Maxim. in NC_044636.1, that is, the 66th position of SEQ ID No:1; 2 is the PCR product at the 2511th position of the CP sequence of Fritillaria cirrhosa D. Don in MN480806.1, that is, the 58th position of SEQ ID No:5; 3 is the PCR product at the 2511th position of the CP sequence of Fritillaria delavayi Franch. in MN480806.1, that is, the 58th position of SEQ ID No:5; 4 is the PCR product at the 2590th position of the CP sequence of Fritillaria unibracteata Hsiao et K. C. Hsia in NC_044629.1, that is, the 85th position of SEQ ID No:9; 5 is the PCR product at the 2590th position of the CP sequence of Fritillaria wabuensis S. Y. Tang et S. C. Yue in NC_044629.1, that is, the 85th position of SEQ ID No:9; 6 is the PCR product at the 2905th position of the CP sequence of Fritillaria taipaiensis P. Y. Li in NC_023247.1, that is, the 183rd position of SEQ ID No:13.
[0071] Figure 2 It is the pyrosequencing results of each test sample at different SNP sites in Example 2; among them, Figure 2 A1, A2, and A3 of are the sequencing results at the SNP1 site,Figure 2 B1, B2, and B3 of which are the sequencing results of the SNP2 locus, Figure 2 C1, C2, and C3 of which are the sequencing results of the SNP3 locus, Figure 2 D1, D2, and D3 of which are the sequencing results of the SNP4 locus.
[0072] Figure 3 are the pyrosequencing results of the amplification product of the test sample at the 152nd position of the KT008138.1 CP sequence, i.e., the 41st position of SEQ ID No: 17. Detailed Embodiments
[0073] The present invention will be further described in detail below in conjunction with the detailed embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.
[0074] In the following embodiments, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5'-terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3'-terminal nucleotide of the corresponding DNA / RNA.
[0075] In the following embodiments, unless otherwise specified, the experimental methods are all conventional methods. The materials, reagents, etc. used in the following embodiments can all be obtained from commercial sources unless otherwise specified.
[0076] Example 1 Screening of SNP Loci in the Bulbs of the Original Species of Fritillaria cirrhosa
[0077] First, download the ITS, psbA-trnH, and matK sequences of all species in the genus Fritillaria from the GenBank database in NCBI ( https: / / www.ncbi.nlm.nih.gov / , as of January 20, 2023). A total of 734 ITS sequences of 103 species in the genus Fritillaria, 232 psbA-trnH sequences of 57 species, and 382 matK sequences of 116 species were downloaded.
[0078] Four SNP loci that can separately distinguish the six original species of Fritillaria cirrhosa (Fritillaria przewalskii, Fritillaria cirrhosa var. cirrhosa, Fritillaria delavayi, Fritillaria unibracteata, Fritillaria walujewii, and Fritillaria taipaiensis) from the other species in the genus Fritillaria were screened out and numbered SNP1, SNP2, SNP3, and SNP4 respectively.
[0079] In addition, the applicant also screened one SNP locus that distinguishes Fritillaria cirrhosa from non-Fritillaria cirrhosa and numbered it SNP5.
[0080] The positions and primer information of the five SNPs are specifically shown in Table 1:
[0081] Table 1 SNP1, SNP2, SNP3 and SNP4 and Their Exclusive PCR Primers and Sequencing Primers
[0082]
[0083]
[0084] Note: Biotin in the table indicates that the 5' end of the sequence is labeled with biotin Biotin.
[0085] SNP1 is a specific SNP locus of Fritillaria przewalskii Maxim., which is an SNP in the genome of Fritillaria cirrhosa D. Don. It is the 273rd nucleotide of the NC_044636.1 CP sequence, and its nucleotide is A or G, represented by the letter R, corresponding to the 66th position of SEQ ID No:1 in the sequence listing (SEQ ID No:1 is the nucleotide sequence of the PCR product amplified with GSF1 (SEQ ID No:2) and GSR1 (SEQ ID No:3) as primers). Among them, the nucleotide of SNP1 in Fritillaria przewalskii Maxim. is A, and the nucleotide of SNP1 in Fritillaria cirrhosa D. Don. other than Fritillaria przewalskii Maxim. is G.
[0086] When the Fritillaria cirrhosa D. Don. sample to be tested is subjected to PCR amplification with GSF1 and GSR1 as primers and pyrosequencing with GSS1 (SEQ ID No:4) as primers, the judgment is made according to the following criteria: When the sequencing result shows that SNP1 is only the base A, it can be determined that only Fritillaria przewalskii Maxim. exists in the sample to be tested; when it is only the base G, it can be determined that Fritillaria przewalskii Maxim. does not exist in the sample to be tested, and it is all Fritillaria cirrhosa D. Don. other than Fritillaria przewalskii Maxim.; when there are both the base A and the base G, it can be determined that both Fritillaria przewalskii Maxim. and Fritillaria cirrhosa D. Don. other than Fritillaria przewalskii Maxim. exist in the sample to be tested.
[0087] SEQ ID No:1
[0088] AGGTCTAGAGGGAAATTGTGAGCATTACGTTCATGCATTACTTCCATACCAAGGTTAGCACGATTRATGA TATCAGCCCAAGTGTTAATAACACGACCCTGACTGTCAA
[0089] SNP2 is a specific SNP locus for Fritillaria cirrhosa D. Don var. cirrhosa and Fritillaria delavayi Franch., which is an SNP in the genome of Fritillaria cirrhosa D. Don, and is the 2511th nucleotide of the MN480806.1 CP sequence. Its nucleotide is A or G, represented by the letter R, corresponding to the 58th position of SEQ ID No:5 in the sequence listing (SEQ ID No:5 is the nucleotide sequence of the PCR product amplified with JSF1 (SEQ ID No:6) and JSR1 (SEQ ID No:7) as primers). Among them, the nucleotides of SNP2 in Fritillaria cirrhosa D. Don var. cirrhosa and Fritillaria delavayi Franch. are both A, and the nucleotide of SNP2 in Fritillaria cirrhosa D. Don other than Fritillaria cirrhosa D. Don var. cirrhosa and Fritillaria delavayi Franch. is G.
[0090] When the Fritillaria cirrhosa D. Don test sample is subjected to PCR amplification with JSF1 and JSR1 as primers and pyrosequencing with JSS1 (SEQ ID No:8) as primers, the judgment is made according to the following criteria: When the sequencing result shows that SNP2 is only the base A, it can be determined that only Fritillaria cirrhosa D. Don var. cirrhosa and / or Fritillaria delavayi Franch. exists in the test sample; when it is only the base G, it can be determined that Fritillaria cirrhosa D. Don var. cirrhosa and Fritillaria delavayi Franch. do not exist in the test sample, and it is all Fritillaria cirrhosa D. Don other than Fritillaria cirrhosa D. Don var. cirrhosa and Fritillaria delavayi Franch.; when there are both the base A and the base G, it can be determined that both Fritillaria cirrhosa D. Don var. cirrhosa and / or Fritillaria delavayi Franch. and Fritillaria cirrhosa D. Don other than Fritillaria cirrhosa D. Don var. cirrhosa and Fritillaria delavayi Franch. exist in the test sample.
[0091] SEQ ID No:5
[0092] TGAAGCCAGAATTGCTTTTCCTTGATATCGAACATAATGTATCAAAGGATCCTTGACRGGCCACAGGGTCTTCTGAAAATTATTACAACACACTATTATAATATGTTCCATTTTTCCATAGAAATGTGAACGTTCAAGAAAGGCTCCA
[0093] SNP3 is a specific SNP locus for Fritillaria unibracteata Hsiao et K. C. Hsia and Fritillaria cirrhosa D. Don var. wabuensis (Sun) Hsiao et K. C. Hsia, which is an SNP in the genome of Fritillaria cirrhosa D. Don, and is the 2590th nucleotide of the NC_044629.1 CP sequence. Its nucleotide is T or C, represented by the letter Y, corresponding to the 85th position of SEQ ID No:9 in the sequence listing (SEQ ID No:9 is the nucleotide sequence of the PCR product amplified with AHF1 (SEQ ID No:10) and AHR1 (SEQ ID No:11) as primers). Among them, the nucleotides of SNP3 in Fritillaria unibracteata Hsiao et K. C. Hsia and Fritillaria cirrhosa D. Don var. wabuensis (Sun) Hsiao et K. C. Hsia are both T, and the nucleotide of SNP3 in Fritillaria cirrhosa D. Don other than Fritillaria unibracteata Hsiao et K. C. Hsia and Fritillaria cirrhosa D. Don var. wabuensis (Sun) Hsiao et K. C. Hsia is C.
[0094] When the Fritillaria cirrhosa D. Don test sample is subjected to PCR amplification using AHF1 and AHR1 as primers and pyrosequencing using AHS1 (SEQ ID No: 12) as a primer, the judgment is made according to the following criteria: When the sequencing result shows that SNP3 is only the base T, it can be determined that only Fritillaria unibracteata Hsiao et K. C. Hsia and / or Fritillaria walujewii Regel exist in the test sample; when it is only the base C, it can be determined that Fritillaria unibracteata Hsiao et K. C. Hsia and Fritillaria walujewii Regel do not exist in the test sample, and all are Fritillaria cirrhosa D. Don other than Fritillaria unibracteata Hsiao et K. C. Hsia and Fritillaria walujewii Regel; when there are both the base T and the base C, it can be determined that both Fritillaria unibracteata Hsiao et K. C. Hsia and / or Fritillaria walujewii Regel exist in the test sample, and there are also Fritillaria cirrhosa D. Don other than Fritillaria unibracteata Hsiao et K. C. Hsia and Fritillaria walujewii Regel.
[0095] SEQ ID No:9
[0096] TCCAGAAGATGTTGATCGTAAATAACAGGATTGTTTATGAAAAAAAACTAATAAAAATTCGCATTCAGATACATAAGAATTGTAYAGGAACCAAAATAGTCTTTTATTTTCTTTTGAAAAAACATAAATAGTTTTATTACTCTGAATAGTTTTATTCAGATTCTGATATTTATGTAGAAAGAATCGCAATAAATGTA
[0097] SNP4 is a specific SNP locus of Fritillaria taipaiensis P. Y. Li, which is an SNP in the genome of Fritillaria cirrhosa D. Don, and is the 2905th nucleotide of the NC_023247.1 CP sequence. Its nucleotide is T or C, represented by the letter Y, corresponding to the 183rd position of SEQ ID No: 13 in the sequence listing (SEQ ID No: 13 is the nucleotide sequence of the PCR product amplified using TBF1 (SEQ ID No: 14) and TBR1 (SEQ ID No: 15) as primers). Among them, the nucleotides of SNP4 in Fritillaria taipaiensis P. Y. Li are all T, and the nucleotides of SNP4 in Fritillaria cirrhosa D. Don other than Fritillaria taipaiensis P. Y. Li are C.
[0098] When the Fritillaria cirrhosa D. Don test sample is subjected to PCR amplification using TBF1 and TBR1 as primers and pyrosequencing using TBS1 (SEQ ID No: 16) as a primer, the judgment is made according to the following criteria: When the sequencing result shows that SNP4 is only the base T, it can be determined that only Fritillaria taipaiensis P. Y. Li exists in the test sample; when it is only the base C, it can be determined that Fritillaria taipaiensis P. Y. Li does not exist in the test sample, and all are Fritillaria cirrhosa D. Don other than Fritillaria taipaiensis P. Y. Li; when there are both the base T and the base C, it can be determined that both Fritillaria taipaiensis P. Y. Li exists in the test sample, and there are also Fritillaria cirrhosa D. Don other than Fritillaria taipaiensis P. Y. Li.
[0099] SEQ ID No:13
[0100] ATATCTTGAATCCAGCATTGAAGGATTTGAACCAAAATTTCAAAATGGATAGGATGGGGTATTAGTATATCTGAAACATTATTTAAATGAGATAATTTGTCCTCTAAAAAAGGAAATATTGAATGAATAGATCCTAAATTCTGAGATTTTGGTATTTCTTTTCTTCGGAGGAAGATACTAATYGTAGCGAGAATGGAATTTCCACAATGACTGAAAAACCCTTTG
[0101] SNP5 is a specific SNP locus of Fritillaria cirrhosa, which is an SNP in the genome of species in the genus Fritillaria of the family Liliaceae. It is the 152nd nucleotide of the KT008138.1 CP sequence, and its nucleotide is T or C, represented by the letter Y, corresponding to the 41st position of SEQ ID No: 17 in the sequence listing (SEQ ID No: 17 is the nucleotide sequence of the PCR product amplified with SF1 (SEQ ID No: 18) and SR1 (SEQ ID No: 19) as primers). Among them, the nucleotide of SNP5 in Fritillaria cirrhosa is all T, and the nucleotide of SNP5 in other species of the genus Fritillaria of the family Liliaceae other than Fritillaria cirrhosa is C.
[0102] When the sample to be tested is subjected to PCR amplification with SF1 and SR1 as primers and pyrosequencing with SS1 (SEQ ID No: 20) as primers, the judgment is made according to the following criteria: when the sequencing result shows that SNP5 is only the base T, it can be determined that only Fritillaria cirrhosa exists in the sample to be tested; when it is only the base C, it can be determined that Fritillaria cirrhosa does not exist in the sample to be tested, and it is all species of the genus Fritillaria of the family Liliaceae other than Fritillaria cirrhosa; when there are both the base T and the base C, it can be determined that both Fritillaria cirrhosa and species of the genus Fritillaria of the family Liliaceae other than Fritillaria cirrhosa exist in the sample to be tested.
[0103] SEQ ID No:17
[0104] ATGGGCACGACGAGTGGTGGACGGAGCACCAGCAGGATGTYGTGGCCCCCTGTCGCCTTAAGGGGCTCAA GAGACCCGGACC
[0105] Example 2 Identification of the Bulbs of the Original Species of Fritillaria cirrhosa Based on SNP Loci
[0106] The method for quickly identifying the bulbs of the original species of Fritillaria cirrhosa in this example specifically includes the following steps:
[0107] (1) Collect 3 portions of the bulbs of Fritillaria przewalskii, Fritillaria cirrhosa, Fritillaria delavayi, Fritillaria unibracteata, Fritillaria wabuensis, and Fritillaria taipaiensis from Haidong in Qinghai, Ganzi in Sichuan, Aba in Sichuan, Tianshui in Gansu, Shangri-La in Yunnan, and Baoji in Shaanxi, respectively, to obtain a total of 108 samples to be tested. After the samples to be tested are sliced and dried, they are pulverized, passed through a 100-mesh sieve, and the powder is sealed in a self-sealing bag for later use.
[0108] (2) Take 200 mg of the bulb powder samples of each original species, extract the total DNA using the (Tiangen) High Efficiency Plant Genome DNA Extraction Kit, and after detecting the DNA concentration and purity with a NanoDrop 2000 micro-spectrophotometer, store it at 4°C.
[0109] (3) Using the genomic DNA of the samples to be tested as a template, perform PCR amplification products with the corresponding PCR amplification primers. First, detect SNP5 to determine whether the samples to be tested are Fritillaria cirrhosa, and select the samples to be tested of Fritillaria cirrhosa to detect SNP1, SNP2, SNP3, and SNP4 to determine the specific original species;
[0110] PCR reaction system (25 μL): 12.5 μL of 2×Taq Maste Mix, 1 μL of each forward and reverse primer (10 μmol / L), 100 ng of DNA template, and make up with sterilized deionized water.
[0111] The PCR reaction procedures for each SNP locus are shown in Table 2. Use 1% agarose gel electrophoresis to detect the quality of the amplified PCR products, verify whether the target bands are clear and single, and add a blank sample as a control during this test process (see Figure 1 ).
[0112] Table 2 PCR reaction procedures for each SNP locus
[0113]
[0114]
[0115] Use the 5 sets of primers for the 5 SNPs in Table 1 to perform pyrosequencing on the amplification products of the above samples to be tested, and detect the polymorphisms of SNP5, SNP1, SNP2, SNP3, and SNP4, respectively.
[0116] The results are as Figure 2 shown:
[0117] PCR products amplified from various samples to be tested using primer pairs (SF1 / SR1) targeting sequences including SNP5 (position 152 of the KT008138.1CP sequence, i.e., position 41 of SEQ ID No: 17) were pyrosequenced with sequencing primer SS1. Samples to be tested that are expected to show only base T at the SNP5 (position 152 of the KT008138.1CP sequence, i.e., position 41 of SEQ ID No: 17) locus are Fritillaria cirrhosa D. Don (see Figure 3 ).
[0118] PCR products amplified from various Fritillaria cirrhosa D. Don samples to be tested using primer pairs (GSF1 / GSR1) targeting sequences including SNP1 (position 273 of the NC_044636.1CP sequence, i.e., position 66 of SEQ ID No: 1) were pyrosequenced with sequencing primer GSS1. The original species that is expected to show only base A at the SNP1 (position 273 of the NC_044636.1CP sequence, i.e., position 66 of SEQ ID No: 1) locus is Fritillaria przewalskii Maxim. ([[]] Figure 2 A1 of Figure 2 and A2 of
[0119] ). Figure 2 B1 of Figure 2 and B2 of
[0120] PCR products amplified from various Fritillaria cirrhosa D. Don samples to be tested using primer pairs (JSF1 / JSR1) targeting sequences including SNP2 (position 2511 of the MN480806.1CP sequence, i.e., position 58 of SEQ ID No: 5) were pyrosequenced with sequencing primer JSS1. The original species that is expected to show only base A at the SNP2 (position 2511 of the MN480806.1CP sequence, i.e., position 58 of SEQ ID No: 5) locus is Fritillaria cirrhosa D. Don var. cirrhosa Franch., Fritillaria delavayi Franch. or both ([[]] Figure 2 C1 of Figure 2 and C2 of
[0121] PCR products amplified from various Fritillaria cirrhosa samples to be tested using primer pairs (TBF1 / TBR1) targeting sequences including SNP4 (position 2905 of the NC_023247.1CP sequence, i.e., position 183 of SEQ ID No: 13) were pyrosequenced with sequencing primer TBS1. It is expected that the original species with only base T shown at the SNP4 (position 2905 of the NC_023247.1CP sequence, i.e., position 183 of SEQ ID No: 13) locus is Fritillaria taipaiensis Figure 2 of D1 and Figure 2 of D2).
[0122] After detection, it was found that the SNP5 genotypes of all samples to be tested were A, indicating that all samples to be tested were Fritillaria cirrhosa samples to be tested; the SNP1 genotypes of Fritillaria cirrhosa samples to be tested were all A (position 273 of the NC_044636.1CP sequence, i.e., position 66 of SEQ ID No: 1), indicating that the tested samples were the corresponding original species Fritillaria przewalskii Figure 2 of A3); the SNP2 genotypes of Fritillaria cirrhosa samples to be tested were all A (position 2511 of the MN480806.1CP sequence, i.e., position 58 of SEQ ID No: 5), indicating that the tested samples were the corresponding original species Fritillaria cirrhosa, Fritillaria delavayi or both Figure 2 of B3); the SNP3 genotypes of Fritillaria cirrhosa samples to be tested were all T (position 2590 of the NC_044629.1CP sequence, i.e., position 85 of SEQ ID No: 9), indicating that the tested samples were the corresponding original species Fritillaria unibracteata, Fritillaria wabuensis or both Figure 2 of C3); the SNP4 genotypes of Fritillaria cirrhosa samples to be tested were all T (position 2905 of the NC_023247.1CP sequence, i.e., position 183 of SEQ ID No: 13), indicating that the tested samples were the corresponding original species Fritillaria taipaiensis Figure 2 of D3).
[0123] It can be seen that the identification results of specific SNP loci of each sample to be tested by pyrosequencer are consistent with the actual situation, indicating that the method described in the present invention is effective and accurate.
[0124] Example 3 Identification of original species decoctions of Fritillaria cirrhosa
[0125] Five decoctions of each of Fritillaria przewalskii, Fritillaria cirrhosa, Fritillaria delavayi, Fritillaria unibracteata, Fritillaria wabuensis and Fritillaria taipaiensis were collected from Bozhou in Anhui, Aba in Sichuan, Chengdu in Sichuan, Shijiazhuang in Hebei and Baoding in Hebei, for a total of 30 decoction samples to be tested.
[0126] The same method as in Example 2 was used for identification, except that the above 30 decoctions of original species of Fritillaria cirrhosa collected were used as samples to be tested.
[0127] After DNA extraction, PCR amplification, and pyrosequencing, the results showed that, using the same method as in Example 2, first, SNP5 was used to confirm that all 30 test samples collected were cut pieces of Fritillaria cirrhosa D. Don, and then SNP1 (the 273rd position of the NC_044636.1 CP sequence, i.e., the 66th position of SEQ ID No: 1), SNP2 (the 2511th position of the MN480806.1 CP sequence, i.e., the 58th position of SEQ ID No: 5), SNP3 (the 2590th position of the NC_044629.1 CP sequence, i.e., the 85th position of SEQ ID No: 9), and SNP4 (the 2905th position of the NC_023247.1 CP sequence, i.e., the 183rd position of SEQ ID No: 13) were successfully used to identify and distinguish the cut pieces of Fritillaria cirrhosa D. Don from which original species.
[0128] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application but are made using conventional techniques known in the art, and some basic features can be applied.
Claims
1. Use of SNP loci in the identification or auxiliary identification of the original species of Fritillaria cirrhosa D. Don, characterized in that: The SNP loci are the 4 SNPs of SNP1, SNP2, SNP3 and SNP4, or any 3 SNPs, or any 2 SNPs, or any 1 SNP: The SNP1 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa, which is the 66th nucleotide of SEQ ID No:1 in the sequence listing. It is A or G, and the letter R in SEQ ID No:1 represents any one of the nucleotides A or G; The SNP2 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa, which is the 58th nucleotide of SEQ ID No:5 in the sequence listing. It is A or G, and the letter R in SEQ ID No.5 represents any one of the nucleotides A or G; The SNP3 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa, which is the 85th nucleotide of SEQ ID No:9 in the sequence listing. It is T or C, and the letter Y in SEQ ID No.9 represents any one of the nucleotides T or C; The SNP4 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa, which is the 183rd nucleotide of SEQ IDNo:13 in the sequence listing. It is T or C, and the letter Y in SEQ ID No:13 represents any one of the nucleotides T or C.
2. Use of SNP loci in identifying or assisting in the identification of the original species of Fritillaria przewalskii Maxim., characterized in that: The SNP locus is SNP1; The SNP1 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa, which is the 66th nucleotide of SEQ ID No:1 in the sequence listing. It is A or G, and the letter R in SEQ ID No:1 represents any one of the nucleotides A or G.
3. Use of SNP sites in identifying or assisting in the identification of the original species Fritillaria cirrhosa and / or Fritillaria delavayi of Fritillaria cirrhosae, characterized in that: The SNP locus is SNP2; The SNP2 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa, which is the 58th nucleotide of SEQ ID No:5 in the sequence listing. It is A or G, and the letter R in SEQ ID No:5 represents any one of the nucleotides A or G.
4. Application of SNP loci in identifying or assisting in identifying the original species Fritillaria unibracteata Hsiao et K. C. Hsia and / or Fritillaria unibracteata Hsiao et K. C. Hsia var. wabuensis (Sun) Hsiao et K. C. Hsia, characterized in that: The SNP locus is SNP3; The SNP3 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa, which is the 85th nucleotide of SEQ ID No:9 in the sequence listing. It is T or C, and the letter Y in SEQ ID No:9 represents any one of the nucleotides T or C.
5. Application of SNP locus in identifying or assisting in identifying Fritillaria taipaiensis P. Y. Li, the original species of Fritillaria cirrhosa D. Don, characterized in that: The SNP locus is SNP4; The SNP4 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa, which is the 183rd nucleotide of SEQ IDNo:13 in the sequence listing. It is T or C, and the letter Y in SEQ ID No:13 represents any one of the nucleotides T or C.
6. The application according to any one of claims 1-5, characterized in that: The SNP locus also includes SNP5; the SNP5 is an SNP in the genome of the species of Fritillaria in Liliaceae, which is the 41st nucleotide of SEQ ID No:17 in the sequence listing. It is T or C, and the letter Y in SEQ ID No:17 represents any one of the nucleotides T or C.
7. Use of a substance for detecting polymorphism in identifying or assisting in identifying the original species of Fritillaria cirrhosa D. Don, characterized in that: The polymorphism is a polymorphic combination of one or two or three or four SNPs among SNP1, SNP2, SNP3, and SNP4 in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa; The SNP1 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 66th nucleotide of SEQ ID No:1 in the sequence listing, and it is A or G. In SEQ ID No:1, the letter R represents either A or G; The SNP2 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 58th nucleotide of SEQ ID No:5 in the sequence listing, and it is A or G. In SEQ ID No:5, the letter R represents either A or G; The SNP3 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 85th nucleotide of SEQ ID No:9 in the sequence listing, and it is T or C. In SEQ ID No:9, the letter Y represents either T or C; The SNP4 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 183rd nucleotide of SEQ ID No:13 in the sequence listing, and it is T or C. In SEQ ID No:13, the letter Y represents either T or C.
8. The application according to any one of claims 7, characterized in that: The polymorphism further includes the polymorphism of SNP5; the SNP5 is an SNP in the genome of the species of Fritillaria in Liliaceae, which is the 41st nucleotide of SEQ ID No:17 in the sequence listing, and it is T or C. In SEQ ID No:17, the letter Y represents either T or C.
9. Product, characterized in that: The product can be any one of the following G1)-G5): G1) The product contains substances for detecting two, three or four SNP polymorphisms among SNP1, SNP2, SNP3 and SNP4, and the product is a product for identifying or assisting in identifying the original species of Fritillaria cirrhosa D. Don; G2) The product contains substances for detecting the SNP1 polymorphism, and the product is a product for identifying or assisting in identifying the original species of Fritillaria przewalskii Maxim.; G3) The product contains substances for detecting the SNP2 polymorphism, and the product is a product for identifying or assisting in identifying the original species of Fritillaria cirrhosa D. Don var. cirrhosa and / or Fritillaria delavayi Franch.; G4) The product contains substances for detecting the SNP3 polymorphism, and the product is a product for identifying or assisting in identifying the original species of Fritillaria unibracteata Hsiao et K. C. Hsia and / or Fritillaria unibracteata Hsiao et K. C. Hsia var. wabuensis (S. Y. Tang et S. C. Yue) Hsiao et K. C. Hsia; G5) The product contains substances for detecting the SNP4 polymorphism, and the product is a product for identifying or assisting in identifying the original species of Fritillaria taipaiensis P. Y. Li; The SNP1 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 66th nucleotide of SEQ ID No:1 in the sequence listing, and it is A or G. In SEQ ID No:1, the letter R represents either A or G; The SNP2 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 58th nucleotide of SEQ ID No:5 in the sequence listing, and it is A or G. In SEQ ID No:5, the letter R represents either A or G; The SNP3 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 85th nucleotide of SEQ ID No: 9 in the sequence listing. It is T or C, and the letter Y in SEQ ID No: 9 represents either T or C. The SNP4 is an SNP in the chloroplast genome of the bulb of the original species of Fritillaria cirrhosa D. Don, which is the 183rd nucleotide of SEQ ID No: 13 in the sequence listing. It is T or C, and the letter Y in SEQ ID No: 13 represents either T or C.
10. The product according to claim 9, characterized in that: The product further contains a substance for detecting the polymorphism of SNP5. The SNP5 is an SNP in the genome of the species of the genus Fritillaria in the family Liliaceae, which is the 41st nucleotide of SEQ ID No: 17 in the sequence listing. It is T or C, and the letter Y in SEQ ID No: 17 represents either T or C.
Citation Information
Patent Citations
Indel marker primer of fritillaria taipaiensis and application of Indel marker primer
CN112359135A
Method for identifying Fritillaria cirrhosa, Fritillaria cirrhosa and Fritillaria pallidiflora
CN114457188A