Development and application of molecular marker of rape waterlogging tolerance related gene BnaERF3

Abstract

The invention discloses development and application of a molecular marker of a rape stain tolerance related gene BnaERF3, and belongs to the technical field of molecular biology. According to the invention, the BnaA06. ERF3 gene is screened on the basis of whole genome associated molecules, and is used as a key gene in QTL (qWL.A06) to participate in regulation and control of the waterlogging tolerance of the rape. A molecular marker related to the waterlogging tolerance of the brassica napus is developed aiming at the BnaA06. ERF3 gene, and tests show that the waterlogging tolerance of the brassica napus can be detected by utilizing the molecular marker, so that varieties containing waterlogging tolerance genes are subjected to auxiliary selection and breeding, and the waterlogging tolerance breeding process of the brassica napus is accelerated.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and particularly to the development and application of a molecular marker of a rapeseed waterlogging tolerance-related gene BnaERF3. Background Art

[0002] Brassica napus L. is an important oil crop, accounting for 55% of the total domestic oil crops. It has functions such as oil, vegetable, flower, honey, fertilizer, and feed. The annual planting area is more than 7 million hectares, and its oil production accounts for more than 50% of the domestic oil crop production.

[0003] Waterlogging stress seriously harms the growth, development and yield formation of Brassica napus L., and its mechanism involves multi-dimensional physiological damage. First, hypoxia in the roots inhibits aerobic respiration and activates anaerobic metabolism, resulting in the accumulation of ethanol, which aggravates cytotoxicity, leading to mitochondrial disintegration and a decline in root vitality. Second, the photosynthetic system in the leaves is damaged, the chlorophyll content decreases, the net photosynthetic rate and stomatal conductance decrease significantly, and the phenomenon of photoinhibition is aggravated. In addition, the burst of reactive oxygen species triggers membrane lipid peroxidation, aggravating the damage of the membrane system. Eventually, the number of effective pods per plant of rapeseed decreases, and the 1000-seed weight decreases, resulting in a significant reduction in yield. Therefore, breeding waterlogging-tolerant rapeseed varieties is of great significance for ensuring the safety of edible oil supply.

[0004] As an important means of detecting genetic diversity, molecular marker technology is not restricted by tissue and organ specificity, environmental conditions and gene expression status. With the advantages of rich polymorphism and strong genetic stability, it has wide application value in plant genetic improvement research. At present, this technology has been widely used. In soybeans, researchers have located some new soybean mosaic virus resistance genes through markers and discovered a batch of molecular markers that are closely linked or co-segregated with soybean mosaic virus resistance genes and can be used for assisted breeding. The breakthrough of molecular marker-assisted selection technology provides an efficient technical means for the breeding of rice restorer lines. In rice, through allele sequence alignment analysis, for the sequence polymorphism at specific loci of the Rf6 gene, a functional marker YRf6 was designed. Its amplification product shows a 763 bp characteristic fragment in the restorer material, while a 439 bp fragment is produced in the non-restorer material, realizing the accurate screening of restorer line materials. In addition, research based on the screening results of 72 different genotypes of rice parents shows that the SSR markers RM10313 and RM6100 are closely linked to the restorer genes Rf3 and Rf4 respectively, confirming that this marker combination can be used as an effective molecular detection system for the identification of Rf3 / Rf4 genes in restorer lines. Therefore, screening molecular markers closely linked to the target trait and then carrying out molecular marker-assisted selection breeding is an effective means to accelerate the application of gene functions. At present, there is no report on the development of molecular markers related to rapeseed waterlogging tolerance for the BnaA06.ERF3 gene. Summary of the Invention

[0005] The object of the present invention is to provide the development and application of a molecular marker of the rapeseed waterlogging tolerance-related gene BnaERF3, so as to solve the problems existing in the above-mentioned prior art. Through genome-wide association analysis, the candidate gene BnaA06.ERF3 is screened. For this gene, molecular markers related to the waterlogging tolerance of Brassica napus are developed. The developed molecular markers can be used to detect the level of waterlogging tolerance of Brassica napus, so as to assist in the selection and breeding of varieties containing waterlogging tolerance genes and accelerate the process of waterlogging tolerance breeding of Brassica napus.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a molecular marker related to the waterlogging tolerance of Brassica napus. The molecular marker includes molecular marker I and molecular marker II. The nucleotide sequence of molecular marker I is as shown in SEQ ID NO.1, and the nucleotide sequence of molecular marker II is as shown in SEQ ID NO.2. Among them, molecular marker I is related to the low waterlogging tolerance of Brassica napus, and molecular marker II is related to the high waterlogging tolerance of Brassica napus.

[0008] The present invention also provides a primer pair for amplifying the above-mentioned molecular marker. The nucleotide sequence of the primer pair is as shown in SEQ ID NO.3-4.

[0009] The present invention also provides a kit, which includes the above-mentioned primer pair.

[0010] The present invention also provides the application of the above-mentioned molecular marker or the above-mentioned primer pair or the above-mentioned kit in the identification of the waterlogging tolerance of Brassica napus.

[0011] The present invention also provides the application of the above-mentioned molecular marker or the above-mentioned primer pair or the above-mentioned kit in the auxiliary breeding of waterlogging-tolerant Brassica napus.

[0012] The present invention also provides the application of the above-mentioned molecular marker or the above-mentioned primer pair or the above-mentioned kit in screening high-waterlogging-tolerant Brassica napus varieties.

[0013] The present invention also provides a method for identifying the waterlogging tolerance of Brassica napus, including using the genomic DNA of the Brassica napus to be tested as a template, amplifying the above-mentioned molecular marker with a primer pair, and identifying the waterlogging tolerance of Brassica napus according to the electrophoretic band position of the amplified molecular marker. Among them, the nucleotide sequence of the primer pair is as shown in SEQ ID NO.3-4.

[0014] Preferably, the identification method is as follows: if only a 174-bp molecular marker electrophoresis band can be amplified using the primer pair, the tested Brassica napus is identified as a low waterlogging-tolerant rapeseed variety; if only a 133-bp molecular marker electrophoresis band can be amplified using the primer pair, the tested Brassica napus is identified as a high waterlogging-tolerant rapeseed variety.

[0015] Preferably, the reaction system for amplification includes: 5 μL of 2×Taq Plus Master Mix, 2 μL of DNA template, 0.25 μL of upstream primer, 0.25 μL of downstream primer, and 2.5 μL of ultrapure water.

[0016] Preferably, the reaction program for amplification is: pre-denaturation at 94°C for 3 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 20 s, a total of 34 cycles; extension at 72°C for 5 min, 1 cycle; and finally stored at 4°C.

[0017] The present invention discloses the following technical effects:

[0018] (1) Through genome-wide association analysis, the present invention locates and screens the candidate gene BnaA06.ERF3 related to waterlogging tolerance in Brassica napus. The gene BnaA06.ERF3 has a great influence on the waterlogging tolerance of Brassica napus and plays a key regulatory role in improving the waterlogging tolerance ability of Brassica napus. It can be used for the construction of regulatory networks and molecular marker-assisted breeding, and is suitable for large-scale popularization and application.

[0019] (2) Based on the BnaA06.ERF3 gene, the present invention conducts haplotype analysis and designs corresponding molecular markers. Through experiments, it is found that the molecular markers can detect the high and low waterlogging tolerance of Brassica napus, and can assist in the selection and breeding of high waterlogging-tolerant varieties, accelerating the process of high waterlogging-tolerant breeding of Brassica napus.

[0020] (3) Applying the molecular markers designed for the BnaA06.ERF3 gene in the present invention to the identification of waterlogging-tolerant varieties of Brassica napus has the advantages of accurate results, simplicity, speed, low cost, and being unaffected by the environment. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0022] Figure 1Schematic diagram of the distribution of waterlogging tolerance coefficients for the number of siliques on the main inflorescence of a Brassica napus association population;

[0023] Figure 2 Manhattan plot for genome-wide association study;

[0024] Figure 3 Analysis results of waterlogging tolerance coefficients for the number of siliques on the main inflorescence of two haplotypes, HapA and HapB;

[0025] Figure 4 Gel electrophoresis detection results of amplified molecular markers for different Brassica napus germplasms; 1 - 8 are Brassica napus germplasms with low waterlogging tolerance, and 9 - 16 are Brassica napus germplasms with high waterlogging tolerance. Detailed implementation mode

[0026] Now, various exemplary implementation modes of the present invention will be described in detail. This detailed description should not be considered as a limitation to the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0027] It should be understood that the terms used in the present invention are only for describing specific implementation modes and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0028] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0029] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation modes of the present invention specification, which are obvious to those skilled in the art. Other implementation modes obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are only exemplary.

[0030] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0031] In this invention, 505 Brassica napus association populations were selected. Through analysis, a major QTL (qWL.A06) for waterlogging tolerance was found on linkage group A06. The BnaA06.ERF3 gene, as a key gene in this QTL, is involved in regulating the waterlogging tolerance of Brassica napus. This indicates that the BnaA06.ERF3 gene has important application potential in the field of Brassica napus breeding and is of great significance for cultivating waterlogging-tolerant Brassica napus varieties. Therefore, this invention developed molecular markers related to the waterlogging tolerance of Brassica napus for the BnaA06.ERF3 gene and verified the correlation between the molecular markers and the waterlogging tolerance of Brassica napus. The above scheme will be further illustrated by specific examples below.

[0032] Example 1: Development of molecular markers related to the waterlogging tolerance of rapeseed

[0033] I. Cultivation of the association population and determination of SMI-WTC (waterlogging tolerance coefficient of the number of siliques on the main inflorescence)

[0034] In the 2017 - 2018 growing season, 505 Brassica napus were planted on the phenotypic platform of Huazhong Agricultural University. Each material was planted in 8 pots, and 6 pots with relatively consistent growth were selected and randomly divided into a control group and a waterlogging treatment group with 8 days of flooding. At the maturity stage, the number of siliques on the main inflorescence of each individual plant was investigated, and the waterlogging tolerance coefficient was calculated using the following formula:

[0035] Waterlogging tolerance coefficient = Number of siliques on the main inflorescence in the treatment group / Number of siliques on the main inflorescence in the control group.

[0036] The results are as Figure 1 shown, which shows the distribution of the waterlogging tolerance coefficient of the number of siliques on the main inflorescence of 505 Brassica napus association populations.

[0037] II. Analysis of genomic resequencing data

[0038] The rapeseed reference genome B. napus v4.1 was downloaded from the BnIR database (https: / / yanglab.hzau.edu.cn / ). The reads were aligned to the reference genome using the "mem -M -k 32 -t 4" code in the BWA software, and the duplicate results were removed using the SAM tool. The genomic analysis toolkit (GATK v3.6) was used to identify the sequence variations in the association population. SNPs with a mapping quality less than 20 or a sequencing depth less than 50 were filtered out. Finally, 11,700,689 SNPs were identified.

[0039] III. Genome-wide association analysis

[0040] (1)In the genome-wide association study, the linear mixed model provided by the FaST-LMM software package was used. With 11,700,689 SNP markers and combined with the phenotypic values (i.e., the waterlogging tolerance coefficient of the number of siliques on the main inflorescence), QTL loci related to waterlogging tolerance were identified across the whole genome (the results are as Figure 2 shown).

[0041] (2)A major QTL locus (qWL.A06) for the waterlogging tolerance coefficient of the number of siliques on the main inflorescence was identified on chromosome A06 of Brassica napus. An approximately 100 kb region around the lead SNP was defined as the QTL interval.

[0042] (3)Combined with the existing transcriptome data of waterlogging extreme materials in the laboratory, it was found that the BnaA06.ERF3 gene responds to waterlogging and other genes in the ERF family have been reported to regulate plant waterlogging stress. Therefore, this gene was selected as the key candidate gene in this QTL interval for subsequent functional verification.

[0043] IV. Haplotype identification and molecular marker development of the candidate gene BnaA06.ERF3

[0044] (1)The promoter, 3'-UTR, and coding region sequences of BnaA06.ERF3 were analyzed in the association population, and 2 haplotypes (HapA and HapB) were identified. The waterlogging tolerance coefficient of the average number of siliques on the main inflorescence of the HapA haplotype was 45.3% ± 2.7%, and that of the HapB haplotype was 52.2% ± 2.2%. The phenotypic differences in the waterlogging tolerance coefficients of the number of siliques on the main inflorescence between the two haplotypes were significant (as Figure 3 shown).

[0045] (2)Based on the sequences of the two haplotypes of the BnaA06.ERF3 gene, molecular markers related to rapeseed waterlogging tolerance were developed. The nucleotide sequences of the molecular markers are as shown in SEQ ID NO.1-2 below:

[0046] HapA (SEQ ID NO.1):

[0047] GACGGATCCCTAGGAGAATC GCAGAGGTTTTGCCGGTTCGTGAGTCGACAGTGGTCGCTTTACTAGAGGACGGTGGAACAGTCGGAAACTGCAAGTCCACTATTGAAACCTCTAGGGTTTGTATCGATGAGGTGGGAAGTGTTCGTTTTGTCGG CGGATCTGGCTACTGAGATG。

[0048] HapB (SEQ ID NO.2):

[0049] GACGGATCCCTAGGAGAATCGCAGAGGTCTTGCTGGTTAGTGAGTCGACATTGGTCGCTTTACTAGAGGACGGTGGAGCAGTCGGAAACTGCAAAAGGTGTTCGTTTTGTCGG CGGATCTGGCTACTGAGATG。

[0050] Note: In the above sequence, the underlined part is the molecular marker primer designed and developed.

[0051] The amplification molecular marker primer pairs 2670-L and 2670-R are as follows:

[0052] 2670-L (SEQ ID NO.3): 5’-GACGGATCCCTAGGAGAATC-3’;

[0053] 2670-R (SEQ ID NO.4): 5’-CATCTCAGTAGCCAGATCCG-3’.

[0054] Example 2: Identifying the genotypes of Brassica napus plants using molecular markers

[0055] Using the molecular markers in Example 1 to identify the genotypes of the Brassica napus plants to be tested. Among them, the Brassica napus plants to be tested are haplotype materials with extremely waterlogging-tolerant phenotypes screened from 505 Brassica napus plants in Example 1. Among them, the materials numbered 1-8 are Brassica napus materials with low waterlogging tolerance, and the materials numbered 9-16 are Brassica napus materials with high waterlogging tolerance.

[0056] The identification process is as follows:

[0057] (1) Extracting the DNA of rapeseed leaves by the CTAB method

[0058] a. Take 1 cm of young leaves from each plant 2 Put them into a 2 mL centrifuge tube, add steel beads, add 250 μL of 2% CTAB, grind on a grinding machine for 5 min, and then add 500 μL of CTAB to the centrifuge tube;

[0059] b. Incubate in a water bath at 65 °C for 60 min, shaking once every 15 min;

[0060] c. Cool the homogenate after water bath to room temperature, and add a solution of chloroform and isoamyl alcohol mixed in a volume ratio of 24:1 to the centrifuge tube, gently invert and mix for 15 min, and then centrifuge at 12000 rpm for 10 min;

[0061] d. Place the centrifuged centrifuge tubes in order on the operation board, aspirate the supernatant to a new 1.5 mL centrifuge tube, and the aspiration volume is 500 μL;

[0062] e. Add 50 μL of potassium acetate (KAc) solution to the supernatant, then add 500 μL of ice-cold ethanol. Cover the centrifuge tube and gently shake it several times to thoroughly mix the ice-cold ethanol with the supernatant. Then place it in a -20°C refrigerator and let it stand for 20 - 30 min to precipitate genomic DNA;

[0063] f. Centrifuge the centrifuge tube after standing at 12000 rpm for 6 min. Pour off the supernatant, add 500 μL of 75% ethanol, let it stand for another 5 min, pour off the supernatant, and repeat once. The precipitate is genomic DNA;

[0064] g. Place the centrifuge tube containing DNA in a fume hood to dry, and thus obtain the genomic DNA of each plant;

[0065] h. Add 200 μL of ddH2O to the dried centrifuge tube containing DNA to dissolve the DNA, and store it at -20°C after dissolution.

[0066] (2) PCR amplification of molecular markers

[0067] Using the genomic DNA of the rapeseed plants to be tested extracted by the CTAB method in the above steps as a template, perform PCR amplification with the primer pairs of the molecular markers designed in Example 1 (as shown in SEQ ID NO.3 - 4). The PCR amplification is a 10 μL reaction system, and each reaction system specifically includes: 5 μL of 2×Taq Plus Master Mix (Vazyme), 2 μL of DNA template, 0.25 μL of 2670-L (10 μM), 0.25 μL of 2670-R (10 μM), and 2.5 μL of ultrapure water.

[0068] The PCR reaction program is: pre-denaturation at 94°C for 3 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 20 s, a total of 34 cycles; extension at 72°C for 5 min, 1 cycle; and finally store at 4°C.

[0069] (3) Analysis of amplification products and electrophoresis

[0070] Electrophorese the amplification products of all rapeseed plants to be tested on a 1.5% agarose gel. After staining with the nucleic acid dye ethidium bromide and imaging under ultraviolet light, obtain the genotype information of the samples to be tested. The results are as Figure 4As shown. For all DNA templates of low waterlogging-tolerant Brassica napus germplasms (waterlogging tolerance coefficient 28.48% ± 4.85%), a band of approximately 174 bp (numbered 1 - 8) can be amplified using primers SEQ ID NO.3 - 4; for DNA templates of high waterlogging-tolerant Brassica napus germplasms (waterlogging tolerance coefficient 80.35% ± 2.68%), a band of approximately 133 bp (numbered 9 - 16) can be amplified using primers SEQ ID NO.3 - 4, indicating that the molecular markers developed by the present invention can effectively distinguish between low waterlogging-tolerant and high waterlogging-tolerant Brassica napus germplasms.

[0071] The embodiments described above are only for describing the preferred mode of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker related to waterlogging tolerance of Brassica napus, characterized in that, The molecular markers include molecular marker I and molecular marker II. The nucleotide sequence of molecular marker I is shown as SEQ ID NO.1, and the nucleotide sequence of molecular marker II is shown as SEQ ID NO.

2. Among them, molecular marker I is related to low waterlogging tolerance of Brassica napus, and molecular marker II is related to high waterlogging tolerance of Brassica napus.

2. A primer pair for amplifying the molecular marker according to claim 1, characterized in that, The nucleotide sequence of the primer pair is shown as SEQ ID NO.3-4.

3. A kit, characterized in that, It includes the primer pair described in claim 2.

4. Use of the molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in the identification of waterlogging tolerance of Brassica napus.

5. Use of the molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in the assisted breeding of waterlogging-tolerant Brassica napus.

6. Use of the molecular marker according to claim 1, the primer pair according to claim 2, or the kit according to claim 3 in the screening of Brassica napus varieties with high waterlogging tolerance.

7. A method for identifying the waterlogging tolerance of Brassica napus, characterized in that, It includes the steps of using the genomic DNA of the Brassica napus to be tested as a template, amplifying the molecular marker described in claim 1 with the primer pair, and identifying the waterlogging tolerance of Brassica napus according to the electrophoretic band position of the amplified molecular marker, wherein the nucleotide sequence of the primer pair is shown as SEQ ID NO.3-4.

8. The method according to claim 7, wherein The method of identification is as follows: if only one electrophoretic band of the molecular marker with a size of 174 bp can be amplified with the primer pair, the Brassica napus to be tested is identified as a variety with low waterlogging tolerance; if only one electrophoretic band of the molecular marker with a size of 133 bp can be amplified with the primer pair, the Brassica napus to be tested is identified as a variety with high waterlogging tolerance.

9. The method according to claim 7, wherein The reaction system for amplification includes: 5 μL of 2×Taq Plus Master Mix, 2 μL of DNA template, 0.25 μL of upstream primer, 0.25 μL of downstream primer, and 2.5 μL of ultrapure water.

10. The method according to claim 7, characterized in that, The reaction program for amplification is: pre-denaturation at 94°C for 3 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 20 s, a total of 34 cycles; extension at 72°C for 5 min, 1 cycle; and finally stored at 4°C.

Images