Brassica napus salt tolerance related KASP molecular marker and application

Abstract

The invention belongs to the technical field of molecular marker development and molecular marker assisted breeding, and particularly relates to a brassica napus salt tolerance related KASP molecular marker and application thereof. The invention discloses novel salt-tolerant allelic mutation of major QTL (quantitative trait loci) of A06 chromosome and C08 chromosome of brassica napus. A molecular marker is obtained through whole genome association analysis. According to the brassica napus salt tolerance related KASP molecular marker disclosed by the invention, the amplification effect of marking SNPA06.1, SNPA06.2 and SNPC08 is optimal, and the SNP variation of salt-tolerant germplasm and sensitive germplasm can be obviously distinguished.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker development and molecular marker-assisted breeding technology. Specifically, it designs an allelic mutation of the A06 chromosome major QTL site and the C08 chromosome major QTL site for salt tolerance in Brassica napus, and involves the development of molecular markers for this type of allelic variation SNP and molecular marker-assisted breeding technology. Background Technology

[0002] With the cumulative effects of climate change, intensive irrigation, and irrational land use, global salinization is becoming increasingly severe. Studies show that excessive soil salinity not only limits plant growth and development but also poses a serious threat to ecosystem stability and global food security (Munns & Tester, 2008; Flowers & Colmer, 2015). Therefore, improving crop salt tolerance has become one of the strategic tasks of modern agricultural scientific research.

[0003] Among the major oilseed crops, rapeseed (Brassica napus) has attracted much attention due to its abundant germplasm resources, high oil content, outstanding nutritional value, and strong adaptability to adversity (Ashraf & McNeilly, 2004). Furthermore, rapeseed has unique advantages in improving soil structure and promoting ecological restoration, making it an important crop for the sustainable use of saline-alkali land. However, different rapeseed germplasms show significant differences in their resistance to salt stress during germination and early development stages, which are also critical periods when rapeseed is most vulnerable to osmotic stress and ion toxicity (Yang & Guo, 2018). Therefore, accurate identification of salt tolerance phenotypes in rapeseed germplasm resources is the first step in promoting salt-tolerant breeding and has a significant impact on rapeseed cultivation.

[0004] In recent years, driven by the rapid development of high-throughput sequencing technology and the integration of genomics methods, genome-wide association analysis (GWAS) has become an important method for elucidating complex quantitative traits in plants. It can be used to reveal the genetic basis of salt tolerance traits in rapeseed during germination and seedling stages (Wan et al. 2017; Zhang et al. 2022; Shi et al. 2024).

[0005] In rapeseed, identifying and validating major QTL sites controlling salt tolerance not only helps to deeply understand its physiological and molecular regulatory mechanisms (Deinlein et al. 2014), but also provides an operational technical path for breeding practices. Molecular markers developed based on the identified salt tolerance QTL sites can be used for marker-assisted selection (MAS), which can significantly improve the breeding efficiency of salt-tolerant varieties (Zhang et al. 2022). This will not only help improve the comprehensive utilization of saline-alkali land resources, but also solidify the foundation of my country's edible vegetable oil supply.

[0006] Against this backdrop, this study aims to locate key QTL loci in rapeseed that influence salt tolerance, develop high-reliability molecular markers based on these key loci, and ultimately provide crucial support for the cloning of related genes and marker-assisted breeding. This research will provide new genetic resources and technological support for the breeding of salt-tolerant rapeseed varieties, promoting the sustainable development of agriculture in saline-alkali lands.

[0007] The information disclosed in this background section is intended only to enhance the understanding of the overall background of the invention and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0008] The first objective of this invention is to provide a salt tolerance-related SNP locus in Brassica napus, the QTL locus of which is located on chromosomes A06 and C08 of Brassica napus. It has a high contribution rate to the salt tolerance of Brassica napus and plays a key role in the regulation of salt tolerance of Brassica napus. It can be used for map-based cloning and molecular marker-assisted breeding and is suitable for large-scale promotion and application.

[0009] The second objective of this invention is to provide a KASP molecular marker related to salt tolerance in Brassica napus and to further disclose its applications.

[0010] To achieve the above objectives, the present invention provides a salt tolerance-related SNP site in Brassica napus, wherein the SNP site includes at least one of the following nucleotide mutation sites:

[0011] (1) Located at 11716386 bp on chromosome A06 of the Brassica napus; the SNP site polymorphism is T / C;

[0012] (2) Located at 38540648 bp on chromosome A06 of the Brassica napus; the SNP site polymorphism is C / T;

[0013] (3) Located at 52689628bp on chromosome C08 of the Brassica napus; the SNP site polymorphism is T / C.

[0014] The present invention also provides a KASP molecular marker related to salt tolerance in Brassica napus, wherein the KASP molecular marker is linked to the nucleotide mutation site described in claim 1;

[0015] The KASP molecular markers include at least one of SNP_A06.1, SNP_A06.2, or SNP_C08; wherein,

[0016] The nucleotide sequence of the molecular marker SNP_A06.1 is shown below (SEQ ID No. 1):

[0017] 5'-CGTCCGCGAGATATGAATGATCTGTGAGCTGTGAAAACTATCATTCAAAATCTTGAGATCTTCCAAGTAAGCTTCAAAAGCTGGTCATTCCTCTGGTTC[T / C]GAAACTATCTTCACCAATTGGGAACAATCCGTTGCAAATGTGACCTGAAATTGACGTAAGTTTTGCATACATTCCATAGTCCAAAGTAGTGCTTTCATCT-3'; wherein, the 100th base from the 5' end of the nucleotide sequence is the SNP site;

[0018] The nucleotide sequence of the molecular marker SNP_A06.2 is shown below (SEQ ID No. 2):

[0019] 5'-CAATCTGATAGAGGAAACAAGAAACTAGTAATAGCTAATTGGGTTGTGGGGCTACTTGGTTCTGTTGAGGGACAAATAGGTCGTGAAGAATCCTATTGTTTATTGA[C / T]TTCAGAGTCTGTGTTGCTTCGTTATATTCTTTATCAAAGAGAGACTTCCGCAAACCAAAAATGTTACACTCTATCGCTTCCCTCCTGATCTCATTAG-3'; wherein, the nucleotide sequence at position 107 from the 5' end is the SNP site;

[0020] The nucleotide sequence of the molecular marker SNP_C08 is as follows (SEQ ID No. 3):

[0021] 5'-GATTCAGTGAGGATGAGGTCAGCTTCGCATCTAAATATTGTGGCTTTGCTTTCCTTTGCTACTGTACAAGGATTAGTTTTTTTTTTTTTTTT[T / C]CCCCTAGAGCTCTGTATGGTCTTTGGCTAGATTAGGAAGAAGAGAAAACATGTGAATCTTCTTTAT-3'; wherein, the 91st base from the 5' end of the nucleotide sequence is the SNP site.

[0022] The present invention also provides a set of KASP primers for detecting the KASP molecular marker:

[0023] The primer set for the molecular marker SNP_A06.1 includes two specific primers, Primer_AlleleFAM-1 and Primer_AlleleHex-2, and one universal primer, Primer_Common-3; wherein,

[0024] Primer_AlleleFAM-1: 5'-AGCTGGTCATTCCTCTGGTTCT-3';

[0025] Primer_AlleleHex-2:5'-GCTGGTCATTCCTCTGGTTCC-3';

[0026] Primer_Common-3: 5'-GATTGTTCCCAATTGGTGAAGATA-3';

[0027] The primer set for the molecular marker SNP_A06.2 includes two specific primers, Primer_AlleleFAM-4 and Primer_AlleleHex-5, and one universal primer, Primer_Common-6; wherein,

[0028] Primer_AlleleFAM-4:5'-TAACGAAGCAACACAGACTCTGAAG-3';

[0029] Primer_AlleleHex-5:5'-TAACGAAGCAACACAGACTCTGAAA-3';

[0030] Primer_Common-6: 5'-TGAGGGACAAATAGGTCGTGAAG-3';

[0031] The primer set for the molecular marker SNP_C08 includes two specific primers, Primer_AlleleFAM-7 and Primer_AlleleHex-8, and one universal primer, Primer_Common-9; among which,

[0032] Primer_AlleleFAM-7: 5'-AGACCATACAGAGCTCTAGGGGA-3';

[0033] Primer_AlleleHex-8:5'-GACCATACAGAGCTCTAGGGGG-3';

[0034] Primer_Common-9: 5'-ATGAGGTCAGCTTCGCATCTAA-3'.

[0035] This invention also provides an application of the SNP site, the KASP molecular marker, and the KASP primer set in any of the following fields:

[0036] (1) Identify the salt tolerance of Brassica napus;

[0037] (2) Screening salt-tolerant Brassica napus varieties;

[0038] (3) Molecular marker breeding of Brassica napus;

[0039] (4) Improve salt-tolerant germplasm resources of Brassica napus.

[0040] The present invention also provides a method for identifying salt tolerance of Brassica napus, comprising the steps of performing PCR amplification on the genomic DNA of a target biological sample using the KASP primer set, and the steps of judging the sample traits based on the obtained amplification results.

[0041] Specifically, in the method for identifying salt tolerance of Brassica napus, the target biological sample includes the Brassica napus plant or its cells, plant tissues or organs, seeds or progeny.

[0042] Specifically, the method for identifying the salt tolerance of Brassica napus includes the following sample morphology judgment steps:

[0043] The genotype of the target SNP was determined using the aforementioned molecular marker SNP_A06.1 primer set: if only C was detected at the 11716386 bp of chromosome A06, the rapeseed sample was determined to be a salt-tolerant material, and the genotype was defined as HEX; if only T was detected, the rapeseed sample was determined to be a salt-sensitive material, and the genotype was defined as FAM; if both C and T were detected at the detection site, the sample was determined to be heterozygous, and the genotype was defined as FAMHEX.

[0044] or,

[0045] The genotype of the target SNP was determined using the aforementioned molecular marker SNP_A06.2 primer set: if only T was detected at the 38540648 bp of chromosome A06, the rapeseed sample was determined to be a salt-tolerant material, and the genotype was defined as HEX; if only C was detected, the rapeseed sample was determined to be a salt-sensitive material, and the genotype was defined as FAM; if both T and C were detected at the detection site, the sample was determined to be a heterozygote, and the genotype was defined as FAMHEX.

[0046] or,

[0047] The genotype of the target SNP is determined using the aforementioned molecular marker SNP_C08 primer set: if only C is detected at the 52689628 bp position of the C08 chromosome, the rapeseed sample is determined to be a salt-tolerant material, and the genotype is defined as HEX; if only T is detected, the rapeseed sample is determined to be a salt-sensitive material, and the genotype is defined as FAM; if both T and C are detected at the detection site, it is determined to be a heterozygote, and the genotype is defined as FAMHEX.

[0048] The method for identifying salt tolerance of Brassica napus according to the present invention is summarized in Table 1 below.

[0049] Table 1. Molecular markers related to salt tolerance in Brassica napus and criteria for genotyping.

[0050]

[0051] This invention discloses novel salt-tolerance allelic mutations at major QTL loci on chromosomes A06 and C08 of Brassica napus, with the molecular markers obtained through genome-wide association analysis. This invention, by locating major salt-tolerance QTL loci in Brassica napus, further develops three novel, efficient, and practical KASP molecular markers capable of indicating salt tolerance traits in rapeseed based on key SNP mutations at three major QTL loci on chromosomes A06 (2 loci) and C08 (1 locus). The SNP sites controlling the salt tolerance phenotype of Brassica napus seeds in this invention include the following three types: (1) a T or C base located at 11716386 bp on chromosome A06 of Brassica napus, which leads to polymorphism; (2) a C or T base located at 38540648 bp on chromosome A06 of Brassica napus, which leads to polymorphism; and (3) a T or C base located at 52689628 bp on chromosome C08 of Brassica napus, which leads to polymorphism. The salt tolerance-related SNP sites of Brassica napus screened in this invention have good site typing of salt tolerance in Brassica napus and can be used for salt-tolerant germplasm-assisted breeding of Brassica napus.

[0052] The KASP molecular markers related to salt tolerance in Brassica napus described in this invention were developed by designing multiple primer sets using 300bp flanking sequences extracted from identified SNP mutation sites. These primers were obtained through multiple polymorphic screenings and validated in both natural and breeding populations. The markers SNP_A06.1, SNP_A06.2, and SNP_C08 showed the best amplification performance and could clearly distinguish SNP variations between salt-tolerant and sensitive germplasm. The molecular markers provided by this invention require only two steps: PCR and fluorescence detection. They are low-cost, high-throughput, and particularly suitable for the classification, screening, and identification of salt-tolerant genotypes in offspring of breeding populations.

[0053] The salt tolerance-related KASP primer set of Brassica napus described in this invention is designed based on the identified KASP molecular markers. Each of the three KASP markers involves three primers: two specific primers designed for base differences at key sites and one universal primer. The terminal alleles of the two specific primers are linked to specific FAM and HEX fluorescent linkers in the KASP reaction reagent.

[0054] The method for identifying salt tolerance in Brassica napus described in this invention uses the PCR-specific amplification primers to amplify the genomic DNA of biological samples, and employs a molecular marker primer set to determine the genotype of the target SNP. This method can identify and determine the salt tolerance of Brassica napus samples. The method described in this invention can rapidly and accurately detect the genotype of salt-tolerant SNP loci on chromosomes A06 and C08 of Brassica napus, which is of great significance for accelerating the process of molecular breeding for salt tolerance in rapeseed.

[0055] The molecular markers described in this invention can directly target salt-tolerant SNP mutation sites in Brassica napus, enabling specific differentiation and detection of their base types. Furthermore, the application method of these SNP molecular markers is accurate, reliable, and easy to operate. This method outperforms traditional identification methods in both throughput and accuracy, making it suitable for identifying salt-tolerant genotypes in Brassica napus and for marker-assisted selection breeding. Attached Figure Description

[0056] Figure 1 These are the GWAS mapping results of salt tolerance traits during germination; (A) is the Manhattan plot and QQ plot of relative germination potential under 200 mM NaCl stress; (B) is the Manhattan plot and QQ plot of relative germination rate under 200 mM NaCl stress.

[0057] Figure 2The above are scatter plots of genotyping data from 211 germplasm accessions; (A) is a scatter plot of primer pairs for molecular marker SNP_A06.1 containing genotyping data from 211 germplasm accessions; (B) is a scatter plot of primer pairs for molecular marker SNP_A06.2 containing genotyping data from 211 germplasm accessions; (C) is a scatter plot of primer pairs for molecular marker SNP_C08 containing genotyping data from 211 germplasm accessions.

[0058] Figure 3 The diagram shows the haplotype analysis of the relative germination rate (RGR) phenotype in 211 germplasm accessions; (A) is the haplotype analysis diagram of molecular marker SNP_A06.1; (B) is the haplotype analysis diagram of molecular marker SNP_A06.2; and (C) is the haplotype analysis diagram of molecular marker SNP_C08. Detailed Implementation

[0059] The specific embodiments of the present invention will now be described in detail with reference to the accompanying drawings, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments.

[0060] Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "comprises" shall be understood to include the stated elements or components without excluding other elements or other components.

[0061] Example 1

[0062] This embodiment identifies a novel allelic mutation that can be used to indicate salt tolerance traits in Brassica napus.

[0063] In this embodiment, 211 rapeseed germplasms were collected in previous studies to construct a GWAS population, and their genomes were resequencing. Germination potential and germination rate were investigated under control and 200 mM NaCl stress conditions, and relative germination potential and relative germination rate were calculated as criteria for assessing the salt tolerance of each rapeseed germplasm during germination. Based on the results of population structure analysis, genome-wide association analysis (GWAS) was performed on salt tolerance phenotypic and genotypic data using FastLMM (Factored Spectrally Transformed Linear Mixed Models) (Python Version) software. A total of 29 significant signal regions were located, including two major-effect loci qSALT.A06.1 and qSALT.C08 (related to relative germination potential). Figure 1 A), and two major-effect sites qSALT.A06.1 and qSALT.A06.2 associated with relative germination rate (A), and two major-effect sites qSALT.A06.1 and qSALT.A06.2 (A). Figure 1 B). Specific sites are attached. Figure 1As shown.

[0064] The results showed that the key SNP mutations in the salt tolerance major QTL sites of Brassica napus were a single nucleotide mutation at 11716386 bp on chromosome A06 of the Brassica napus reference genome, a single nucleotide mutation at 38540648 bp, and a single nucleotide mutation at 52689628 bp on chromosome C08.

[0065] Example 2

[0066] This embodiment develops SNP markers that can be used to detect salt tolerance in Brassica napus.

[0067] Flanking sequences 300 bp from each side of the aforementioned SNP locus were extracted, and multiple primer sets were designed, each consisting of three primers. After multiple polymorphism screenings and testing in a GWAS population, the markers SNP_A06.1, SNP_A06.2, and SNP_C08 showed the best detection performance, clearly distinguishing between salt-tolerant and sensitive germplasm.

[0068] The nucleotide sequence of the molecular marker SNP_A06.1 is shown below (SEQ ID No. 1):

[0069] 5'-CGTCCGCGAGATATGAATGATCTGTGAGCTGTGAAAACTATCATTCAAAATCTTGAGATCTTCCAAGTAAGCTTCAAAAGCTGGTCATTCCTCTGGTTC[T / C]GAAACTATCTTCACCAATTGGGAACAATCCGTTGCAAATGTGACCTGAAATTGACGTAAGTTTTGCATACATTCCATAGTCCAAAGTAGTGCTTTCATCT-3'; wherein, the 100th base from the 5' end of the nucleotide sequence is the SNP site.

[0070] The nucleotide sequence of the molecular marker SNP_A06.2 is shown below (SEQ ID No. 2):

[0071] 5'-CAATCTGATAGAGGAAACAAGAAACTAGTAATAGCTAATTGGGTTGTGGGGCTACTTGGTTCTGTTGAGGGACAAATAGGTCGTGAAGAATCCTATTGTTTATTGA[C / T]TTCAGAGTCTGTGTTGCTTCGTTATATTCTTTATCAAAGAGAGACTTCCGCAAACCAAAAATGTTACACTCTATCGCTTCCCTCCTGATCTCATTAG-3'; wherein, the nucleotide sequence is defined as the SNP site at the 107th base from the 5' end.

[0072] The nucleotide sequence of the molecular marker SNP_C08 is as follows (SEQ ID No. 3):

[0073] 5'-GATTCAGTGAGGATGAGGTCAGCTTCGCATCTAAATATTGTGGCTTTGCTTTCCTTTGCTACTGTACAAGGATTAGTTTTTTTTTTTTTTTT[T / C]CCCCTAGAGCTCTGTATGGTCTTTGGCTAGATTAGGAAGAAGAGAAAACATGTGAATCTTCTTTAT-3'; wherein, the 91st base from the 5' end of the nucleotide sequence is the SNP site.

[0074] In this embodiment, three corresponding KASP marker primer sets were designed for the aforementioned KASP molecular markers. Each set includes two pairs of specific primers designed for base differences at key sites and one universal primer.

[0075] The two specific primers for the molecular marker SNP_A06.1 have allelic variant bases T / C at the 3' end and are connected to FAM and HEX fluorescent linkers at the 5' end;

[0076] The two specific primers for the molecular marker SNP_A06.2 have allelic variant bases G / A at their 3' ends and are connected to FAM and HEX fluorescent linkers at their 5' ends;

[0077] The two specific primers for the molecular marker SNP_C08 have allelic variant bases A / G at their 3' ends and are connected to FAM and HEX fluorescent linkers at their 5' ends.

[0078] Based on the nucleotide sequence characteristics of the KASP markers described above, this embodiment further provides associated amplification primers, specifically including the following specific primer combinations:

[0079] The primers for the molecular marker SNP_A06.1 include two specific primers, Primer_AlleleFAM-1 (Allele X primer) and Primer_AlleleHex-2 (Allele Y primer), and one universal primer, Primer_Common-3; wherein:

[0080] Primer_AlleleFAM-1: 5'-AGCTGGTCATTCCTCTGGTTCT-3' (SEQ ID No. 4);

[0081] Primer_AlleleHex-2: 5'-GCTGGTCATTCCTCTGGTTCC-3' (SEQ ID No. 5);

[0082] Primer_Common-3: 5'-GATTGTTCCCAATTGGTGAAGATA-3' (SEQ ID No. 6);

[0083] The primers for the molecular marker SNP_A06.2 include two specific primers, Primer_AlleleFAM-4 (Allele X primer) and Primer_AlleleHex-5 (Allele Y primer), and one universal primer, Primer_Common-6; wherein:

[0084] Primer_AlleleFAM-4: 5'-TAACGAAGCAACACAGACTCTGAAG-3' (SEQ ID No. 7);

[0085] Primer_AlleleHex-5: 5'-TAACGAAGCAACACAGACTCTGAAA-3' (SEQ ID No. 8);

[0086] Primer_Common-6: 5'-TGAGGGACAAATAGGTCGTGAAG-3' (SEQ ID No. 9);

[0087] The primers for the molecular marker SNP_C08 include two specific primers, Primer_AlleleFAM-7 (AlleleX primers) and Primer_AlleleHex-8 (Allele Y primers), and one universal primer, Primer_Common-9; wherein:

[0088] Primer_AlleleFAM-7: 5'-AGACCATACAGAGCTCTAGGGGA-3' (SEQ ID No. 10);

[0089] Primer_AlleleHex-8: 5'-GACCATACAGAGCTCTAGGGGG-3' (SEQ ID No. 11);

[0090] Primer_Common-9: 5'-ATGAGGTCAGCTTCGCATCTAA-3' (SEQ ID No. 12).

[0091] Example 3

[0092] Based on the aforementioned results, this embodiment further develops a system that can be used to detect the establishment of the salt-tolerant SNP marker system and its application in salt-tolerant improvement-assisted breeding of Brassica napus.

[0093] The GWAS natural populations of 211 Brassica napus accessions and 29 other Brassica napus germplasm accessions were selected. Genotyping was performed using the three SNP markers mentioned above, and the converted fluorescence signals were analyzed to obtain clear and intuitive genotyping maps. Genotyping results were output based on the different colors, completing the screening and validation of the above materials. The specific operation steps are as follows:

[0094] (1) Place the germinated seeds into a deep-well plate (96 wells, 1.2 ml), add 100 µL of 0.3 M sodium hydroxide, and grind the sample at 50 Hz (using a plant tissue homogenizer (Shanghai Jingxin)) for 2 min until the sample is completely ground. After grinding, centrifuge at 3000 rpm for 1 min, boil in a water bath for 2 min, then add 200 µL of 0.2 M Tris-HCl (pH 6.8-7.0) and mix well, then boil in a water bath for 2 min again. After the water bath, centrifuge at 3000 rpm for 1 min, take the supernatant, dilute it 20 times, and freeze at -20℃ as a template for subsequent PCR amplification;

[0095] (2) Using the DNA extracted in step (1) above as a template, PCR amplification was performed using the salt-tolerant SNP marker developed in Example 2 for detecting rapeseed salt tolerance, and the amplification product was obtained.

[0096] In this embodiment, the PCR amplification reaction system is shown in Table 2 below, and the PCR reaction conditions are shown in Table 3 below.

[0097] Table 2 PCR amplification reaction system

[0098]

[0099] Table 3 PCR amplification reaction conditions

[0100]

[0101] After PCR, the fluorescence signal was read using a TECAN Infinite M1000 microplate reader, and then the converted fluorescence signal was analyzed using the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) to obtain a clear and intuitive genotyping map. The genotype results were output according to different colors, and the results were tested in different materials.

[0102] Example 4

[0103] (1) GWAS natural population marker detection of KASP markers

[0104] This embodiment is based on the method developed in the aforementioned embodiment 3, and performs genotyping on a GWAS population containing 211 germplasms.

[0105] Salt tolerance was analyzed in a GWAS population containing 211 accessions, and the results are shown in Table 4 below.

[0106] Table 4 Distribution of salt tolerance-related traits in GWAS populations

[0107]

[0108] It can be seen that the distribution of relative germination potential and relative germination rate is similar: the vast majority of germplasm (about 55%-73%) is concentrated in the low value range of 0-20%, while the proportion of germplasm in the high value range of 80-100% is extremely low (1.4%-11.4%), indicating that the extreme salt tolerance phenotype is very rare in the population.

[0109] As attached Figure 2 The results show that, using the screened molecular marker SNP_A06.1 ( Figure 2 A), SNP_A06.2 ( Figure 2 B) and SNP_C08 ( Figure 2 C) It can be used to accurately detect these new salt-tolerant allelic variants and has good genotyping effects in GWAS populations.

[0110] As attached Figure 3 The results show that, under the relative germination rate (RGR) index, germplasm with a relative germination rate ≥40% is salt-tolerant, while that with a relative germination rate <40% is sensitive. Therefore, the HEX genotype in SNP_A06.1 accounts for 77.27% of the salt-tolerant germplasm population, while the FAM genotype accounts for 75.13% of the sensitive germplasm population. Figure 3A). Those possessing the HEX genotype in SNP_A06.2 account for up to 76.00% of the salt-tolerant germplasm population; those possessing the FAM genotype account for up to 75.98% of the sensitive germplasm population. Figure 3 B). Those possessing the HEX genotype in SNP_C08 account for up to 62.50% of the salt-tolerant germplasm population; those possessing the FAM genotype account for up to 74.46% of the sensitive germplasm population. Figure 3 C). The different haplotypes identified by these three markers all showed highly significant differences in relative germination rates. Figure 3 AC).

[0111] (2) KASP marker detection in 29 Brassica napus germplasm accessions

[0112] This embodiment is based on the method developed in the aforementioned embodiment 3, and performs genotyping on 29 randomly selected rapeseed germplasm samples.

[0113] Phenotypic analysis was performed on 29 randomly selected rapeseed germplasms, and the results are shown in Table 5 below.

[0114] Table 5. Distribution of salt tolerance-related traits in 29 Brassica napus germplasms.

[0115]

[0116] As shown in Table 5, the distribution of salt tolerance of various substances is obviously skewed: in terms of relative germination potential, the low value range of 0-20% accounts for 62.1% of the materials, while the high value range of 80-100% accounts for 0 parts; in terms of relative germination rate, the 0-20% range accounts for 31.03% (9 parts), and the high value range of 80-100% accounts for 13.79% (4 parts).

[0117] This invention utilizes molecular markers SNP_A06.1, SNP_A06.2, and SNP_C08 to accurately detect these novel salt-tolerant allelic variants, and achieves good genotyping results in populations.

[0118] Under the relative germination rate (RGR) index, germplasm with a relative germination rate ≥40% is considered salt-tolerant, while that with a relative germination rate <40% is considered sensitive. Therefore, the HEX genotype in SNP_A06.1 accounts for up to 80.00% of salt-tolerant germplasm, while the FAM genotype accounts for up to 63.16% of sensitive germplasm. In SNP_A06.2, the HEX genotype accounts for up to 52.94% of salt-tolerant germplasm, while the FAM genotype accounts for up to 50.00% of sensitive germplasm. In SNP_C08, the HEX genotype accounts for up to 46.15% of salt-tolerant germplasm, while the FAM genotype accounts for up to 43.75% of sensitive germplasm.

[0119] In summary, the markers SNP_A06.1, SNP_A06.2, and SNP_C08 screened in this invention can be used for salt-tolerant germplasm-assisted breeding of Brassica napus.

[0120] The foregoing description of specific exemplary embodiments of the invention is for illustrative and explanatory purposes. These descriptions are not intended to limit the invention to the precise forms disclosed, and it will be apparent that many changes and variations can be made in accordance with the foregoing teachings. The exemplary embodiments were chosen and described in order to explain the specific principles of the invention and its practical application, thereby enabling those skilled in the art to implement and utilize various different exemplary embodiments of the invention, as well as various different choices and variations. The scope of the invention is intended to be defined by the claims and their equivalents.

Claims

1. A Brassica napus salt tolerance related SNP locus, characterized in that, The SNP site comprises at least one nucleotide mutation site as follows: (1) located at 11716386 bp of the A06 chromosome of Brassica napus; the SNP site polymorphism is T / C; (2) located at 38540648 bp of the A06 chromosome of Brassica napus; the SNP site polymorphism is C / T; (3) located at 52689628 bp of the C08 chromosome of Brassica napus; the SNP site polymorphism is T / C.

2. A Brassica napus salt tolerance related KASP molecular marker characterized in that, The KASP molecular marker is linked to the nucleotide mutation site in claim 1; The KASP molecular marker comprises at least one of SNP_A06.1, SNP_A06.2 or SNP_C08; wherein, The nucleotide sequence of the molecular marker SNP_A06.1 is as follows: 5'-CGTCCGCGAGATATGAATGATCTGTGAGCTGTGAAAACTATCATTCAAAATCTTGAGATCTTCCAAGTAAGCTTCAAAAGCTGGTCATTCCTCTGGTTC[T / C]GAAACTATCTTCACCAATTGGGAACAATCCGTTGCAAATGTGACCTGAAATTGACGTAAGTTTTGCATACATTCCATAGTCCAAAGTAGTGCTTTCATCT-3'; wherein, the 100th base from the 5' end of the nucleotide sequence is the SNP site; The nucleotide sequence of the molecular marker SNP_A06.2 is as follows: 5'-CAATCTGATAGAGGAAACAAGAAACTAGTAATAGCTAATTGGGTTGTGGGGCTACTTGGTTCTGTTGAGGGACAAATAGGTCGTGAAGAATCCTATTGTTTATTGA[C / T]TTCAGAGTCTGTGTTGCTTCGTTATATTCTTTATCAAAGAGAGACTTCCGCAAACCAAAAATGTTACACTCTATCGCTTCCCTCCTGATCTCATTAG-3'; wherein, the 107th base from the 5' end of the nucleotide sequence is the SNP site; The nucleotide sequence of the molecular marker SNP_C08 is as follows: 5'-GATTCAGTGAGGATGAGGTCAGCTTCGCATCTAAATATTGTGGCTTTGCTTTCCTTTGCTACTGTACAAGGATTAGTTTTTTTTTTTTTT[T / C]CCCCTAGAGCTCTGTATGGTCTTTGGCTAGATTAGGAAGAAGAGAAAACATGTGAATCTTCTTTAT-3'; wherein, the 91th base from the 5' end of the nucleotide sequence is the SNP site.

3. A KASP primer set for detecting the KASP molecular marker of claim 2, wherein: the primer set of the molecular marker SNP_A06.1 comprises two specific primers Primer_AlleleFAM-1 and Primer_AlleleHex-2, and one common primer Primer_Common-3; wherein, Primer_AlleleFAM-1: 5'-AGCTGGTCATTCCTCTGGTTCT-3'; Primer_AlleleHex-2: 5'-GCTGGTCATTCCTCTGGTTCC-3'; Primer_Common-3: 5'-GATTGTTCCCAATTGGTGAAGATA-3'; the primer set of the molecular marker SNP_A06.2 comprises two specific primers Primer_AlleleFAM-4 and Primer_AlleleHex-5, and one common primer Primer_Common-6; wherein, Primer_AlleleFAM-4: 5'-TAACGAAGCAACACAGACTCTGAAG-3'; Primer_AlleleHex-5: 5'-TAACGAAGCAACACAGACTCTGAAA-3'; Primer_Common-6: 5'-TGAGGGACAAATAGGTCGTGAAG-3'; the primer set of the molecular marker SNP_C08 comprises two specific primers Primer_AlleleFAM-7 and Primer_AlleleHex-8, and one common primer Primer_Common-9; wherein, Primer_AlleleFAM-7: 5'-AGACCATACAGAGCTCTAGGGGA-3'; Primer_AlleleHex-8: 5'-GACCATACAGAGCTCTAGGGGG-3'; Primer_Common-9: 5'-ATGAGGTCAGCTTCGCATCTAA-3'.

4. Use of the SNP site of claim 1, the KASP molecular marker of claim 2, or the KASP primer set of claim 3 in any one of the following fields: (1) identifying salt tolerance of Brassica napus; (2) screening salt-tolerant Brassica napus varieties; (3) Brassica napus molecular marker breeding; (4) improving salt-tolerant germplasm resources of Brassica napus. The method comprises the steps of: performing PCR amplification on the genomic DNA of the target biological sample using the KASP primer set of claim 3, and determining the trait of the sample based on the obtained amplification results. The target biological sample comprises the Brassica napus plant or cells, plant tissues or organs, seeds, or offspring thereof. The sample trait determination step comprises: ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ 5. A method for identifying salt tolerance in Brassica napus, characterized in that, ​ 6. The method for identifying salt tolerance of Brassica napus according to claim 5, wherein, ​ 7. The method for identifying salt tolerance in Brassica napus according to claim 5 or 6, characterized in that, ​ The genotype of the target SNP was determined using the aforementioned molecular marker SNP_A06.1 primer set: if only C was detected at the 11716386 bp of chromosome A06, the rapeseed sample was determined to be a salt-tolerant material, and the genotype was defined as HEX; if only T was detected, the rapeseed sample was determined to be a salt-sensitive material, and the genotype was defined as FAM; if both C and T were detected at the detection site, the sample was determined to be heterozygous, and the genotype was defined as FAMHEX. or, The genotype of the target SNP was determined using the aforementioned molecular marker SNP_A06.2 primer set: if only T was detected at the 38540648 bp of chromosome A06, the rapeseed sample was determined to be a salt-tolerant material, and the genotype was defined as HEX; if only C was detected, the rapeseed sample was determined to be a salt-sensitive material, and the genotype was defined as FAM; if both T and C were detected at the detection site, the sample was determined to be a heterozygote, and the genotype was defined as FAMHEX. or, The genotype of the target SNP is determined using the aforementioned molecular marker SNP_C08 primer set: if only C is detected at the 52689628 bp position of the C08 chromosome, the rapeseed sample is determined to be a salt-tolerant material, and the genotype is defined as HEX; if only T is detected, the rapeseed sample is determined to be a salt-sensitive material, and the genotype is defined as FAM; if both T and C are detected at the detection site, it is determined to be a heterozygote, and the genotype is defined as FAMHEX.

Images