Heart failure treatment and drug screening with preserved ejection fraction

Abstract

The invention relates to the field of disease treatment, and particularly provides application of a reagent capable of inhibiting or knocking out Jun gene expression in treatment of ejection fraction preserved heart failure (HFpEF) and a method for screening drugs.

Description

[0001] This application is based on an application with a CN application number of 202410101243.8 and a filing date of January 24, 2024, and claims its priority. The disclosure of this CN application is hereby incorporated herein by reference in its entirety. Technical Field

[0002] The present invention relates to the field of disease treatment, and specifically provides the use of reagents capable of inhibiting or knocking out the expression of the Jun gene in the treatment of heart failure with preserved ejection fraction (HFpEF) and a method for screening drugs. Background Art

[0003] Cardiovascular diseases represent one of the difficult problems in medical challenges. Heart failure is not only the main cause of death in patients with cardiovascular diseases but also a major problem faced clinically, including heart failure with systolic dysfunction and heart failure with diastolic dysfunction. Among them, with the development of medicine, heart failure with diastolic dysfunction has been more widely defined as heart failure with preserved ejection fraction. Heart failure with preserved ejection fraction (HFpEF) is the main cause of morbidity and mortality in the entire industrialized world, and its prevalence is increasing at an alarming rate. HFpEF currently accounts for 50% of all HF. Patients with this comprehensive disease will present typical symptoms of heart failure, including exertional intolerance, dyspnea, accumulation of extravascular fluid in the lungs, subcutaneous tissue, and abdominal cavity, and intermittent cardiovascular decompensation that often leads to hospitalization due to emergency diuresis. The definition of HFpEF excludes diseases such as cardiac amyloidosis, hereditary hypertrophic cardiomyopathy, valvular diseases, and other diseases with clear etiologies. HFpEF more refers to patients whose pathophysiology involves a multi-organ syndrome, which is the result of the joint action of the heart, lungs, kidneys, bones, immune system, inflammation, metabolism, and other components. Importantly, HFpEF is a syndrome with high morbidity and high mortality. According to statistics, the mortality rate due to HF worldwide is 35%, and the proportion of HFpEF is greater than 50%.

[0004] So far, the basic research on HFpEF is almost blank, and there are few effective drug therapies proven to be able to change the disease progression and prognosis of HFpEF patients, thus creating a huge unmet clinical need. Summary of the Invention

[0005] The inventors of the present application have for the first time discovered that Jun is an important regulatory factor in the occurrence and development of HFpEF. Thus, the following inventions are provided.

[0006] Inhibiting or knocking out the expression of Jun gene

[0007] In one aspect, the present invention provides the use of a reagent capable of inhibiting or knocking out Jun gene expression in the preparation of a medicament for preventing and / or treating heart failure with preserved ejection fraction (HFpEF). Also provided is a method for preventing and / or treating heart failure with preserved ejection fraction (HFpEF), the method comprising administering to a subject in need thereof (such as a human) an effective amount of a reagent capable of inhibiting or knocking out Jun gene expression. In certain embodiments, the treatment at least includes improving cardiac diastolic function, such as reducing diastolic function parameters E / E’ and / or E / A.

[0008] The reagent capable of inhibiting or knocking out Jun gene expression described herein can disrupt Jun gene expression by any mechanism, such as inhibiting Jun expression at the RNA or protein level, such as knocking out the Jun gene, reducing or inhibiting gene transcription, and / or reducing or inhibiting the translation of the mRNA product of the gene.

[0009] In certain embodiments, the determination of the expression level can be carried out at the nucleic acid level or the protein level. Methods for determining expression at the nucleic acid level include, but are not limited to, Northern blotting, PCR, RT-PCR or real-time RT-PCR. Methods for determining expression at the protein level include, but are not limited to, Western blotting or polyacrylamide gel electrophoresis combined with protein staining techniques such as Coomassie Brilliant Blue or silver staining, mass spectrometry, ELISA, etc.

[0010] Gene editing system

[0011] In certain embodiments, the reagent capable of inhibiting or knocking out Jun gene expression is a gene editing system. Those skilled in the art are familiar with using gene editing systems to knockdown or knockout target genes (such as Jun).

[0012] In certain embodiments, the gene editing system can be any site-specific (sequence-specific) genome editing system known at present. In certain embodiments, the genome editing system includes at least one site-specific nuclease, such as an RNA-guided nuclease (such as a Cas nuclease), a zinc finger nuclease, a megabase meganuclease, a TALE-nuclease, a recombinase, a transposase, and any combination thereof. In certain embodiments, the site-specific endonuclease targets the Jun gene, induces DNA breaks at the target site, and completes the modification through, for example, homologous recombination (HR) or non-homologous end joining (NHEJ) to cause disruption of the Jun gene.

[0013] In certain embodiments, the gene editing system is selected from CRISPR / Cas, TALEN, ZFN, transposon technology, PASTE technology, PE technology, base editors, and any combination thereof.

[0014] In certain embodiments, the gene editing system comprises an RNA-guided endonuclease and a guide RNA (gRNA), and the gRNA comprises a guide sequence that is complementary to a target sequence in a target locus. In certain embodiments, the gene editing system is present on one or more vectors.

[0015] In certain embodiments, the gene editing system is a CRISPR / Cas system, which comprises a Cas effector protein (including but not limited to Cas9, Cas12a (Cpf1), Cas12b (C2c1), Cas13a (C2c2), C2c3, Cas13b) and a corresponding guide RNA (gRNA). The CRISPR / Cas system recruits the Cas enzyme protein to the target locus through the guide RNA (gRNA) to complete the modification, and the gRNA comprises a guide sequence that is complementary to a target sequence in the target locus. In certain embodiments, the gRNA can be a chimeric guide RNA or a single guide RNA (sgRNA). In certain embodiments, the gRNA comprises a guide sequence and a tracr pairing sequence (or direct repeat). In certain embodiments, the gRNA comprises a guide sequence, a tracr pairing sequence (or direct repeat) and a tracr sequence. In certain embodiments, the CRISPR-Cas system does not comprise and / or is not dependent on the presence of a tracr sequence (e.g., if the Cas protein is Cas12a).

[0016] RNA interfering agent

[0017] In certain embodiments, the reagent capable of inhibiting or knocking out Jun gene expression comprises an RNA interfering agent.

[0018] As used herein, the expression "RNA interfering agent" refers to any agent that inhibits the expression of a target gene through the RNA interference (RNAi) mechanism. "RNA interference (RNAi)" is an evolutionarily conserved process in which the expression or introduction of RNA with a sequence identical or highly similar to that of the target gene results in sequence-specific degradation of the messenger RNA (mRNA) transcribed from the target gene or specific post-transcriptional gene silencing (PTGS), thereby inhibiting the expression of the target gene.

[0019] Thus, those skilled in the art will know that a target sequence can be selected according to the sequence of the Jun-encoding gene or the mRNA transcribed therefrom to design a small interfering RNA (siRNA) or a small RNA (microRNA, miRNA) molecule. The siRNA or miRNA molecule can interfere with the transcription, translation or post-transcriptional and post-translational modifications of the gene, thereby affecting the expression of the protein.

[0020] In this article, the siRNA refers to Small interfering RNA, which is a small RNA molecule composed of approximately 21 - 25 nucleotides and is processed by Dicer (an enzyme specific for double-stranded RNA in the RNAaseⅢ family). siRNA is the main member of siRISC and triggers the silencing of the target mRNA complementary to it.

[0021] In this article, the microRNA (miRNA) refers to a class of naturally occurring non-coding RNA molecules with a length of approximately 21 - 25 nucleotides. Based on sequence complementarity with the target mRNA, they can cause degradation of the target mRNA or inhibit its translation through specific base complementary pairing with the target mRNA, thereby regulating the post-transcriptional expression of genes. miRNA can be referred to the miRBase database (http: / / microrna.sanger.ac.uk / ).

[0022] In addition, to prolong the inhibitory effect of siRNA on target gene expression, a pair of specific oligonucleotide sequences can be designed, annealed and cloned into a vector. The transcription product of this recombinant vector is the short hairpin RNA (shRNA), which can self-fold and pair into a stem-loop structure with a stem length of 19 - 21 bases. The 19 - 21 bases are derived from a specific sequence of the target gene mRNA. The precursor of this stem-loop structure is quickly cleaved in the cell to form functional siRNA. shRNA typically contains an "antisense" sequence (or "guide" sequence) that can specifically bind to the target sequence to form the "stem" structure and a "sense" sequence (or "passenger" sequence) that is reverse and complementary or partially complementary to the "antisense" sequence, as well as a "loop" sequence. The siRNA formed by cleavage of the shRNA expressed by this vector has the characteristics of stable expression level and long duration, thus causing long-term inhibition of the target gene expression.

[0023] In certain embodiments, the RNA interfering agent is selected from small interfering RNA (siRNA), short hairpin RNA (shRNA), or microRNA (miRNA).

[0024] In certain embodiments, the RNA interfering agent is used or administered in the form of an expression vector (e.g., an expression vector containing the coding sequence of the RNA interfering agent).

[0025] In certain embodiments, the RNA interfering agent is shRNA.

[0026] In certain embodiments, the shRNA comprises a first region complementary to a target sequence in the Jun gene or its mRNA, a second region that is reverse and complementary to the first region, and a loop region.

[0027] In certain embodiments, the shRNA comprises the nucleotide sequence shown in SEQ ID NO:19. For example, the first region of the shRNA comprises or consists of the nucleotide sequence shown in SEQ ID NO:19.

[0028] In certain embodiments, the shRNA comprises or consists of the nucleotide sequence shown in SEQ ID NO:18.

[0029] In another aspect, the present application also provides an shRNA or its coding sequence, or a vector comprising the shRNA or its coding sequence. In certain embodiments, the shRNA comprises the nucleotide sequence shown in SEQ ID NO:19. In certain embodiments, the shRNA comprises or consists of the nucleotide sequence shown in SEQ ID NO:18.

[0030] Antisense oligonucleotide

[0031] In certain embodiments, the reagent comprises an antisense oligonucleotide.

[0032] As used herein, the expression "antisense oligonucleotide" refers to a molecule that is complementary to a sense nucleic acid, such as complementary to the coding strand of the Jun gene or to the mRNA sequence of the Jun gene. Thus, the antisense oligonucleotide can form hydrogen bonds (i.e., anneal thereto) with the sense nucleic acid. The antisense oligonucleotide can be complementary to the entire coding strand of the nucleic acid sequence encoding Jun, or only to a portion thereof, such as all or part of the protein-coding region (or open reading frame). The antisense oligonucleotide can also be antisense to all or part of the non-coding region of the coding strand of the nucleic acid sequence encoding Jun. The length of the antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30 or more nucleotides.

[0033] The above antisense oligonucleotides can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, they can be chemically synthesized using naturally occurring nucleotides or various modified nucleotides that are designed to increase the biological stability of the molecule or the physical stability of the duplex formed between the antisense and sense nucleic acids, such as phosphorothioate derivatives and acridine-substituted nucleotides. Alternatively, the above antisense oligonucleotides can be produced biologically using an expression vector that contains the target nucleic acid cloned therein, and the RNA transcribed from the inserted nucleic acid will have an antisense orientation to the target nucleic acid.

[0034] After obtaining the RNA interfering agent or antisense oligonucleotide, the inhibitory activity of the RNA interfering agent or antisense oligonucleotide on the mRNA or protein expression level of Jun can be further determined by the method described above.

[0035] Administration

[0036] The reagents described herein can be administered in the form of a pharmaceutical composition in combination with a pharmaceutically acceptable carrier and / or excipient. "Pharmaceutically acceptable carrier and / or excipient" refers to a carrier and / or excipient that is pharmacologically and / or physiologically compatible with the subject and the active ingredient, which are well known in the art and include, but are not limited to: pH regulators, surfactants, adjuvants, ionic strength enhancers, diluents, reagents for maintaining osmotic pressure, reagents for delaying absorption, and preservatives.

[0037] The reagents described herein can be administered by any suitable method known in the art. Preferred routes of administration include intravenous, intraperitoneal, intramuscular, subcutaneous, spinal or other parenteral routes of administration. Parenteral administration refers to a mode of administration that is usually by injection rather than enteral and topical administration, including but not limited to intravenous, intraperitoneal, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intratracheal, subcutaneous, subepidermal, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion. Alternatively, it can be administered via non-parenteral routes, such as local, epidermal or mucosal administration routes, such as intranasal, oral, vaginal, rectal, sublingual or topical.

[0038] In certain embodiments, the reagents described herein are administered to a specific organ or tissue or cell of a subject (e.g., heart, myocardial tissue, cardiomyocytes). For example, in certain embodiments, the reagents described herein are administered in situ (e.g., in situ injection into the heart, in situ injection into myocardial tissue) to the subject.

[0039] In certain embodiments, the reagents described herein are administered in an organ- or tissue- or cell-specific (e.g., heart-specific, myocardial tissue-specific, cardiomyocyte-specific) manner. For example, in certain embodiments, the reagents described herein are endowed with the ability to target (e.g., the ability to target the heart, myocardial tissue or cardiomyocytes), e.g., are endowed with the ability to accumulate and / or exert activity at the target site of the subject (e.g., the heart, myocardial tissue or cardiomyocytes).

[0040] The reagents described herein can be formulated into dosage forms compatible with their intended routes of administration. A preferred dosage form is an injectable. Such injectables can be sterile injectable solutions. For example, a sterile injectable solution can be prepared by incorporating the requisite dose of the reagents described herein in a suitable solvent, and optionally, simultaneously incorporating other desired ingredients (including but not limited to, pH adjusters, surfactants, adjuvants, ionic strength enhancers, isotonic agents, preservatives, diluents, or any combination thereof), followed by filtration sterilization. Additionally, the sterile injectable solution can be prepared as a sterile lyophilized powder (e.g., by vacuum drying or freeze drying) for ease of storage and use.

[0041] The reagents described herein can be formulated in unit dosage forms for ease of administration. A unit dosage form refers to physically discrete units suitable as a single dose for a subject to be treated; each unit contains a predetermined quantity of the active ingredient calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.

[0042] The reagents described herein are administered to a subject in need thereof. In certain embodiments, the subject is a mammal. In certain embodiments, the subject is a human.

[0043] Drug screening

[0044] In another aspect, the present invention provides a method for screening drugs for the prevention and / or treatment of heart failure with preserved ejection fraction (HFpEF), the method comprising the step of screening for Jun inhibitors. The screening step is carried out in vitro.

[0045] In certain embodiments, the Jun inhibitor is capable of inhibiting or downregulating the expression of the Jun gene, or inhibiting or blocking the activity of the Jun protein.

[0046] In certain embodiments, the Jun inhibitor is selected from the reagents described herein that are capable of inhibiting or knocking out the expression of the Jun gene.

[0047] In certain embodiments, the Jun inhibitor is selected from affinity molecules that specifically bind to the Jun protein, thereby inhibiting or blocking the activity of the Jun protein. In certain embodiments, the affinity molecule is selected from small molecule compounds.

[0048] In certain embodiments, the step of screening for Jun inhibitors comprises: detecting whether a test reagent can inhibit Jun gene expression or Jun protein activity; selecting the test reagent capable of inhibiting Jun gene expression or Jun protein activity as a candidate drug.

[0049] In certain embodiments, the inhibition of Jun gene expression includes inhibition at the protein level and / or the mRNA level.

[0050] In certain embodiments, the step of screening for Jun inhibitors comprises: (1) contacting a test agent with cells capable of expressing the Jun gene; (2) measuring the expression level of the Jun gene or the activity of the Jun protein; (3) comparing the measurement result of step (2) with the measurement result in the absence of the test agent; (4) selecting a test agent having the ability to inhibit the gene expression or protein activity as a candidate drug. In certain embodiments, the expression level includes the protein level and / or the mRNA level.

[0051] Term definition

[0052] In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. To better understand the present invention, the definitions and explanations of related terms are provided below.

[0053] As used herein, the term "heart failure with preserved ejection fraction (HFpEF)" refers to a class of clinical syndromes in which, in the case of normal or mildly reduced ventricular systolic function, impaired ventricular diastolic function and reduced compliance result in reduced ventricular filling and elevated filling pressure, thereby leading to pulmonary and systemic congestion. HFpEF typically refers to heart failure with diastolic dysfunction. In certain embodiments, the clinical diagnostic criteria for HFpEF mainly include: (1) the presence of symptoms and / or signs of heart failure; (2) cardiac imaging examination (mainly referring to TTE examination) indicating that the LVEF ≥ 50%; (3) the presence of objective evidence of cardiac structural and / or functional abnormalities consistent with left ventricular diastolic dysfunction and / or elevated left ventricular filling pressure, wherein the structural and / or functional abnormality indicators of left ventricular diastolic dysfunction and / or elevated ventricular filling pressure mainly include: (a) the mean E / e' ratio > 15; (b) the left atrial volume index > 40 ml / m 2 (atrial fibrillation).

[0054] As used herein, the term "Jun" refers to the Jun proto-oncogene, AP-1 transcription factor subunit, also known as AP1, AP-1, cJUN or c-Jun. Jun can be of human origin or a homologous gene from other species (e.g., non-human mammals, fish, reptiles or birds, such as rodents like mice, rats, hamsters, guinea pigs, rabbits, dogs, cats, horses, cows, sheep, pigs, goats, primates, etc.). The sequences of Jun are well-known to those skilled in the art and can be found in various public databases. An exemplary gene sequence of human Jun can be found in GenBank: NM_002228.4, and an exemplary protein sequence can be found in NCBI: NP_002219.1; an exemplary gene sequence of mouse Jun can be found in Ensembl: ENSMUSG00000052684, NCBI Gene ID: 16476, and an exemplary protein sequence can be found in UniProtKB: P05627, NCBI: NP_034721.1.

[0055] As used herein, the term "treatment" refers to a method implemented to obtain a beneficial or desired clinical outcome. For the purposes of the present invention, beneficial or desired clinical outcomes include, but are not limited to, alleviating symptoms, reducing the scope of the disease, stabilizing (i.e., not worsening) the state of the disease, delaying or slowing the development of the disease, improving or alleviating the state of the disease, and relieving symptoms (whether in part or in whole), whether detectable or not. In addition, "treatment" can also refer to prolonging the survival period compared to the expected survival period (if not treated).

[0056] As used herein, the term "effective amount" is at least the minimum concentration required to achieve a measurable improvement or prevention of a specific disorder. The effective amount herein can vary depending on factors such as the disease state, age, sex, and weight of the patient, and the ability of the antibody to elicit the desired response in an individual. The effective amount is also the amount at which the therapeutic beneficial effects exceed any toxic or adverse effects of the treatment. For prophylactic use, beneficial or desired outcomes include outcomes such as eliminating or reducing the risk, alleviating the severity, or delaying the onset of the disease, including the biochemical, histological, and / or behavioral symptoms of the disease, its complications, and the intermediate pathological phenotypes presented during disease formation. For therapeutic use, beneficial or desired outcomes include clinical outcomes such as reducing one or more symptoms resulting from the disease, improving the quality of life of subjects suffering from the disease, reducing the dosage of other drugs required to treat the disease, enhancing the effect of another drug (such as via targeting), delaying the progression of the disease, and / or prolonging survival. The effective amount can be administered in one or more administrations.

[0057] Beneficial effects

[0058] The inventors of the present application have for the first time discovered that Jun is an important regulatory factor in the occurrence and development of HFpEF. Inhibiting or knocking out the expression of Jun gene can effectively curb the occurrence and development of HFpEF and improve diastolic function, thus being used for the prevention and treatment of HFpEF, which has important clinical value. In addition, a method for screening drugs for the prevention and / or treatment of HFpEF is also provided.

[0059] The embodiments of the present invention will be described in detail below in conjunction with the drawings and examples. However, those skilled in the art will understand that the following drawings and examples are only used to illustrate the present invention, rather than limiting the scope of the present invention. According to the following detailed description of the drawings and preferred embodiments, various objects and advantageous aspects of the present invention will become apparent to those skilled in the art. Brief description of the drawings

[0060] Figure 1 : Construction of HFpEF model. A: Schematic diagram of the experimental process; B: Detection results of diastolic function (E / A) of mice after 5 weeks of feeding; C: Detection results of diastolic function (E / E’) of mice after 5 weeks of feeding.

[0061] Figure 2 : Relative expression level of myocardial cell Jun after 15 weeks of HFD+L-NAME feeding, indicating high expression of Jun in HFpEF model mice.

[0062] Figure 3 : Myh6-cre ERT2 / Jun-Rosa26 LSL / - Detection of Jun overexpression efficiency in Myh6-cre

[0063] Figure 4 / Jun-Rosa26 ERT2 / Jun-Rosa26 LSL / - : Detection of diastolic function in Myh6-cre

[0064] Figure 5 : Jun flox / flox Schematic diagram of the construction strategy of Jun mice.

[0065] Figure 6 : Jun flox / floxElectrophoresis identification diagram of 5' homologous arm and 3' homologous arm PCR of F1 generation mice. Numbers: F1 generation mouse numbers; WT: wild-type control; M: 1kb DNA ladder.

[0066] Figure 7 : Myh6-cre ERT2 / Jun flox / flox Electrophoresis identification diagram of PCR of mice (2% agarose gel).

[0067] Figure 8 : Knocking out Jun can effectively alleviate the occurrence and development of HFpEF.

[0068] Figure 9 : Schematic diagram of the Jun knockdown plasmid structure.

[0069] Figure 10 : Knocking down Jun can effectively alleviate the occurrence and development of HFpEF.

[0070] Sequence information

[0071] The description of the sequences involved in this application is provided in the following table.

[0072] Table 1: Sequence information

[0073]

[0074]

[0075]

[0076]

[0077] Examples

[0078] The present invention will now be described with reference to the following examples which are intended to illustrate the invention (but not to limit the invention).

[0079] Those skilled in the art will appreciate that the examples describe the invention by way of illustration and are not intended to limit the scope claimed in this application. The experimental methods in the examples are all conventional methods unless otherwise specified. For those conditions not specified in the examples, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used without indicating the manufacturer are all conventional products that can be obtained commercially.

[0080] Experimental materials and methods

[0081] Animals: C57BL / 6N wild-type mice were purchased from Vital River Laboratories in Beijing; Myh6-cre ERT2The mice were purchased from Shanghai Model Organisms Center, Inc. The full name of the strain is C57BL / 6Smoc-Myf6 em1(CreERT2-pA)Smoc (Model Organisms, NM-KI-200125); Jun-Rosa26 LSL / LSL The mice were purchased from Shanghai Model Organisms Center, Inc. They are Rosa26 site-specific knock-in heterozygous mice with conditional overexpression of the CAG-LSL-Jun-IRES-EGFP-WPRE-pA gene obtained by using CRISPR / Cas9 technology; Jun flox / flox The mice were purchased from Shanghai Model Organisms Center, Inc. They are Jun gene floxed heterozygous mice with conditional knockout obtained by using CRISPR / Cas9 technology.

[0082] The reagents are shown in the following table:

[0083] Table 2: Reagent Information

[0084]

[0085] Animal experiment guidelines

[0086] In this example, all animal studies were conducted under the guidance of the Experimental Animal Center of the Animal Health and Use Committee of Fuwai Hospital, Chinese National Center for Cardiovascular Diseases. All mice were propagated and raised in the same environment, and the mice were randomly grouped during the experiment. Echocardiogram analysis was performed by independent researchers who were unaware of the research objectives.

[0087] Conventional ultrasound detection

[0088] After five weeks of feeding all mice under different conditions, routine ultrasound examinations were started, performed every two weeks until the end of the 15-week examination. Specifically, transthoracic echocardiography was performed using a VisualSonics Vevo 2100 system equipped with an MS400 transducer (Visual Sonics). Left ventricular ejection fraction (LVEF) and other systolic function indices were obtained from short-axis M-mode scans at the mid-ventricular level, as indicated by the presence of the papillary muscles, in conscious, gently restrained mice. Apical four-chamber views were obtained in anesthetized mice for diastolic function measurements using pulsed-wave and tissue Doppler imaging at the mitral valve level. Anesthesia was induced with 2.5% isoflurane and confirmed by lack of response to firm pressure on one of the hind paws. During echocardiography acquisition (under temperature-controlled conditions), isoflurane was reduced to 1.0 - 1.5% and adjusted to maintain the heart rate within the range of 500 beats per minute. Parameters collected included: heart rate, left ventricular end-diastolic diameter, left ventricular end-systolic diameter, end-diastolic interventricular septal wall thickness, left ventricular end-diastolic posterior wall, left ventricular fractional shortening, LVEF, peak Doppler flow velocity in early diastole across the mitral valve, peak Doppler flow velocity in late diastole across the mitral valve, isovolumic relaxation time, early diastolic and early filling deceleration times, tissue Doppler peak velocity of myocardial relaxation at the mitral annulus. At the end of the procedure, all mice recovered from anesthesia without any abnormalities. All parameters were measured at least 3 times and the mean values were given. The ultrasound examination included systolic function and diastolic function examinations.

[0089] Example 1: Expression of Jun is correlated with HFpEF

[0090] 1.1 Induction of heart failure with preserved ejection fraction model

[0091] Male C57BL / 6N wild-type mice aged 8 to 10 weeks were divided into two groups, namely the normal group (normal diet and water) and the model group (high-fat diet combined with administration of N-nitro-L-arginine methyl ester). Among them, the model group was modeled in the manner recorded in the following literature: Gabriele G. Schiattarella et al., Nitrosative stress drives heart failure with preserved ejection fraction, https: / / doi.org / 10.1038 / s41586-019-1100-z. Specifically, a high-fat diet (HFD) (60% kcal from fat (lard)) and N-nitro-L-arginine methyl ester (abbreviated as L-NAME, 0.5 g / L in drinking water) were used to induce heart failure with preserved ejection fraction, obtaining an HFpEF animal model.

[0092] The systolic function parameter LVEF of the mice was not changed when detected at the fifth week of model induction, while the diastolic function parameter (E / E’) was significantly increased at the fifth week of model induction, indicating that a heart failure model with preserved ejection fraction as described in the aforementioned literature was successfully obtained. Meanwhile, there was no significant difference in the diastolic function parameter (E / E’) between the model control group and the model treatment group at the fifth week. Subsequent drug administration was carried out under the condition of the same baseline, such as Figure 1 shown.

[0093] 1.2 Correlation between Jun expression and HFpEF

[0094] When the model was induced to 15 weeks, cardiomyocytes of normal mice and the HFpEF animal model of mice were extracted and separated by perfusion method, and quantitative RCR detection was carried out. The specific operation is as follows:

[0095] 1.2.1. Isolation of adult mouse cardiomyocytes:

[0096] To isolate cardiomyocytes from the hearts of adult mice, we used the classical perfusion method to isolate cardiomyocytes. Specifically, 100 μl of sodium heparin (1000 units in 50 ml) was injected into the mice 20 minutes before euthanasia to prevent blood clotting in the heart during the operation and increase the difficulty of digestion. After that, the mice were anesthetized and euthanized, and the hearts were removed and transferred to calcium-free solution for washing. Then, digestion was carried out using the Langendorff method. The heart was perfused with calcium-free solution using the Langendorff apparatus for 5 minutes, and then digested with digestive enzyme solution (0.7 mg / ml type II collagenase and 0.7 mg / ml bovine serum albumin in calcium-free solution) for about 30 minutes. The heart was continuously touched at about 20 minutes. When the heart became soft and slippery, it indicated that the digestion was basically completed. Then, the tissue from the ventricle was collected, cut into pieces, and gently pipetted to dissociate into single cells. After standing and sedimentation, the supernatant was taken to remove undigested and adherent tissues. The cells were centrifuged at 100 g at 4 °C for 2 minutes to obtain cardiomyocyte pellets. Most of the supernatant was non-cardiomyocytes. The cardiomyocytes were resuspended in calcium-free solution containing 10% FBS for subsequent experiments. The non-cardiomyocytes could be resuspended with medium or PBS for subsequent experiments. If purer cardiomyocytes and non-cardiomyocytes were to be obtained, the cell suspension could be centrifuged (100 g, 2 minutes at room temperature) three times to separate cardiomyocytes from non-cardiomyocytes. The cardiomyocytes were collected for further experiments.

[0097] 1.2.2. Quantitative PCR detection:

[0098] Total RNA was extracted from cells using the GeneJet RNA Purification Kit (Thermo Scientific, K0732), and 0.1 μg of total RNA was reverse transcribed using the iScript™ cDNA Synthesis Kit (Bio-Rad, 1708890) to generate cDNA. qPCR was performed using the iTaq Universal SYBR Green supermix (1725121, Bio-Rad) on an ABI Vii7 real-time system (Life Technologies, Q6) (primer F is SEQ ID NO:1; primer R is SEQ ID NO:2), with b-Actin used for normalization of quantitative analysis. As Figure 2 shown, compared with normal mice, a significantly higher expression of Jun was observed in the mouse HFpEF animal model. This indicates that there is a correlation between the expression level of Jun in mice and HFpEF, and Jun is highly expressed in HFpEF.

[0099] Example 2: Overexpression of Jun leads to heart failure with preserved ejection fraction

[0100] 2.1 Jun-overexpressing transgenic mice

[0101] The cardiomyocyte-specific cre transgenic mouse Myh6-cre ERT2 was crossed with the Jun-overexpressing mouse Jun-Rosa26 LSL / LSL to obtain the Myh6-cre ERT2 / Jun-Rosa26 LSL / - mouse, that is, a mouse with cardiomyocyte-specific overexpression of Jun induced by tamoxifen. Both the Myh6-cre ERT2 mouse and the Jun-Rosa26 LSL / LSL mouse were constructed by Shanghai Model Organisms Center, Inc.

[0102] The full name of the strain of Myh6-cre ERT2 is C57BL / 6Smoc-Myf6 em1(CreERT2-pA)Smoc . CreERT2-pA was inserted into the start codon of the mouse Myf6 gene. Myf6-CreERT2 was crossed with a mouse strain containing loxP site-flanking sequences, and Cre-mediated recombination induced will result in the deletion of the flanking sequences in the myf6-positive cells (cardiomyocytes) of the offspring.

[0103] The Jun-Rosa26 LSL / LSL mouse was constructed using the CRISPR / Cas9 technology. By means of homologous recombination, the CAG-LSL-Jun-IRES-EGFP-WPRE-pA expression cassette was inserted at the Rosa26 gene locus.

[0104] Myh6-cre ERT2 was crossed with Jun-Rosa26 LSL / LSL to obtain Myh6-cre ERT2 / Jun-Rosa26 LSL / - mice, which are conditional overexpression mouse models. Among them, tamoxifen induces the specific expression of Cre recombinase cre ERT in cardiomyocytes. It recognizes two LoxP in LSL and cleaves the terminator in between, enabling Myh6-positive cells to continuously express Jun.

[0105] 2.2 Detection of expression efficiency

[0106] We found in the study that the mice died about 6 days after tamoxifen induction ( Figure 3 , A). First, we detected the overexpression efficiency of the mice. On the fifth day after tamoxifen administration, cardiomyocytes of the mice were isolated, and RNA was extracted for real-time quantitative polymerase chain reaction (PCR) to detect the expression level of Jun. It was found that the expression level of Jun in cardiomyocytes of Myh6-cre ERT2 / Jun-Rosa26 LSL / - mice was upregulated about tenfold relative to the control group ( Figure 3 , B), which was in line with expectations. Then, at the protein level, we also proved by immunofluorescence staining that Jun was expressed higher in the heart sections of Myh6-cre ERT2 / Jun-Rosa26 LSL / - mice ( Figure 3 , C). In addition, by staining Tag, that is, GFP, in the lung tissue sections and heart sections of Myh6-creERT2 / Jun-Rosa26LSL / - mice, it was indeed found that the expression of GFP was detected only in the heart sections ( Figure 3 , D). From these data, we concluded that Myh6-cre ERT2 / Jun-Rosa26 LSL / could achieve specific overexpression of Jun in cardiomyocytes.

[0107] 2.3 Detection of changes in diastolic function

[0108] After experiments, we proved that there were no significant changes in the systolic function and structural parameters after overexpression of Jun in adult mouse cardiomyocytes, and the death caused by fulminant myocarditis was also excluded. Atrial dilation and congestion occurred, and severe pulmonary congestion appeared. Considering comprehensively, we speculated that the mice developed heart failure with diastolic dysfunction, that is, heart failure with preserved ejection fraction. Therefore, we detected the diastolic function evaluation indexes (E / E’ and E / A) of the mice. As we predicted, Myh6-cre ERT2 / Jun-Rosa26 LSL / - There was no significant change on the third day after tamoxifen induction in mice. However, from the fourth day to the fifth day, the diastolic function of the mouse heart was significantly abnormal, that is, the values of E / A and E / E' increased significantly on the fourth day and worsened on the fifth day ( Figure 4 , A-C). Therefore, we can conclude that after overexpression of Jun in adult mouse cardiomyocytes, acute heart failure with preserved ejection fraction occurred in mice, leading to mouse death.

[0109] Example 3: Jun knockout reverses heart failure with preserved ejection fraction

[0110] 3.1 Overview

[0111] Using the cardiomyocyte-specific cre tool mouse Myh6-cre ERT2 (Southern Model Organisms, NM-KI-200125) and the mouse Jun with the Jun gene modified by flox flox / flox were crossed to obtain Myh6-cre ERT2 / Jun flox / flox mice, and Jun can be specifically knocked out in cardiomyocytes of these mice by tamoxifen induction. Myh6-cre ERT2 / Jun flox / flox mice can be abbreviated as Jun-KO mice in this article.

[0112] The cardiomyocyte-specific cre tool mouse Myh6-cre ERT2 has the full strain name of C57BL / 6Smoc-Myf6 em1 (CreERT2-pA)Smoc , and CreERT2-pA is inserted at the start codon of the mouse Myf6 gene. Myf6 (myogenic factor 6) is a DNA-binding protein involved in muscle development. Myf6-CreERT2 is crossed with a mouse strain with loxp sites inserted on both sides of the target gene (i.e., flox mouse), and Cre-mediated recombination induced will result in the deletion of the gene fragment between Loxp in myf6-positive cells of the offspring.

[0113] Schematic diagram of the construction strategy of the mouse Jun with the Jun gene modified by flox is as flox / flox shown in Figure 5As shown in the figure, using the principle of homologous recombination, the Jun gene was floxed by homologous recombination in fertilized eggs. The brief process is as follows: Cas9 mRNA and gRNA were obtained by in vitro transcription; a homologous recombination vector (donor vector) was constructed by In-Fusion cloning, which contains a 3.1 kb 5' homologous arm, a 2.2 kb flox region, and a 3.0 kb 3' homologous arm. Cas9 mRNA, gRNA, and the donor vector were microinjected into the fertilized eggs of C57BL / 6J mice to obtain F0 generation mice. Positive F0 generation mice identified by PCR amplification and sequencing were mated with C57BL / 6J mice to obtain 9 positive F1 generation mice. The F1 generation mice are the mice in which the Jun gene has been floxed, namely Jun flox / flox .

[0114] 3.2 Target and related sequences

[0115] Name of the target gene (Ensembl ID): Jun (ENSMUSG00000052684);

[0116] Ensembl website link of the target gene: http: / / asia.ensembl.org / Mus_musculus / Gene / Summary?db=core;g=ENSMUSG00000052684;r=4:95049034-95052222;t=ENSMUST00000107094;

[0117] Transcript targeted by the scheme (Ensembl ID): Jun-201 (ENSMUST00000107094.1);

[0118] Exon targeted by Flox: exon 1;

[0119] gRNA1 is SEQ ID NO:3;

[0120] gRNA2 is SEQ ID NO:4;

[0121] The 5' homologous arm sequence is SEQ ID NO:5;

[0122] The flox region (loxp-Jun fragment-loxp) sequence is SEQ ID NO:6;

[0123] The 3' homologous arm sequence is SEQ ID NO:7.

[0124] 3.3 Genotype identification

[0125] The primers for 5'-homologous arm PCR identification are: Primer I (Forward) is SEQ ID NO: 8; Primer II (Reverse) is SEQ ID NO: 9.

[0126] The primers for 3'-homologous arm are: Primer III (Forward) is SEQ ID NO: 10; Primer IV (Reverse) is SEQ ID NO: 11.

[0127] The electrophoresis results of 5'- and 3'-homologous arm PCR identification of F1 generation mice are as Figure 6 shown. The positive mice identified by PCR are: No. 12, 13, 14, 15, 17, 18, 19, 21, 22; all were confirmed to be positive by sequencing.

[0128] 3.4 Subsequent breeding

[0129] Using the cardiomyocyte-specific cre tool mouse Myh6-cre ERT2 (Model Organisms, NM-KI-200125) and the mouse Jun with floxed Jun gene flox / flox were crossed to obtain Myh6-cre ERT2 / Jun flox / flox mice (i.e., Jun-KO mice).

[0130] During subsequent mouse mating and breeding, the mouse genotype can be identified by short-fragment PCR. The PCR identification conditions and primers are as follows. Exemplary results are as Figure 7 shown. WT is a 221bp band; heterozygotes are two bands of 221 and 289bp; homozygotes are: a 289bp band.

[0131] Table 3: PCR identification conditions and primers

[0132]

[0133] In addition, Cre activity can be verified at the DNA level. Usually, a small piece of tissue expressing Cre is taken, genomic DNA is extracted, and the floxed region is amplified by PCR. Whether Cre functions is qualitatively judged by the presence or absence of the floxed region. The PCR identification conditions and primers are as follows. There is a 1386bp band for Cre activity; there is a 3638bp band for no Cre activity; the wild type is a 3505bp band.

[0134] Table 4: PCR identification conditions and primers

[0135]

[0136]

[0137] 3.5 Experimental procedure

[0138] After obtaining the animal model, that is, starting from the fifth week of the self-induced HFpEF model, tamoxifen was used for gene knockout in the model treatment group, and no gene knockout was performed in the model control group. Mice with normal diet and drinking water were used as negative controls throughout the induction process.

[0139] 3.6 Experimental results

[0140] The results are as Figure 8 shown. First, the diastolic function of the mice was detected at 5 weeks. The diastolic function parameters E / E’ and E / A were significantly increased, proving that there was a diastolic dysfunction, indicating that the model described in the aforementioned literature was successfully obtained. Further, during the continuous detection from 5 to 15 weeks, the occurrence and development of HFpEF in the model treatment group (with Jun gene knockout using tamoxifen) were well inhibited. Specifically, after Jun was knocked out, the diastolic function of the mice treated with high-fat diet combined with L-NAME (HFD + 0.5 g / L L-NAME) was significantly improved and could continue until the fifteenth week; however, in the model control group mice without Jun knockout, continuous deterioration of diastolic function was observed; at the same time, in the model treatment group, the expression of Jun was downregulated compared with the model control group. This indicates that inhibiting or knocking out Jun expression can play a preventive and therapeutic role in HFpEF in the mouse HFpEF model.

[0141] Example 4: Jun knockdown reverses heart failure with preserved ejection fraction

[0142] 1. Construction of knockdown plasmid

[0143] The pAAV-EnCMV-MCS-U6-shRNA plasmid (Miaoling Bio, P28262) was selected. As Figure 9 shown, the shRNA sequence of JUN was ligated with the plasmid to construct a JUN knockdown plasmid.

[0144] shjun Forward oligo (SEQ ID NO:16):

[0145] GATCCACGCAGCAGTTGCAAACGTTTCTCGAGAAACGTTTGCAACTGCTGCGTTTTTTA

[0146] shjun Reverse oligo (SEQ ID NO:17):

[0147] AGCTTAAAAAACGCAGCAGTTGCAAACGTTTCTCGAGAAACGTTTGCAACTGCTGCGTG

[0148] 2. Virus packaging and titer determination

[0149] 2.1 Culturing of 293T cells

[0150] 1. Subculture of 293T cells

[0151] (1) Prepare complete medium according to the formula shown in Table 5. Preheat the complete medium and PBS (Zhongshan Golden Bridge, ZLI - 9062) in a 37°C water bath;

[0152] Table 5: Formula for preparing complete medium (50 mL)

[0153] Required reagents Required volume DMEM (high glucose) (Gibco, 11965118) 44.5 mL Fetal bovine serum (FBS) (PAN-Biotech, P30-3306) 5 mL Penicillin-streptomycin (P / S) (Gibco, 15140122) 500 μL

[0154] (2) Taking a 10 - cm cell culture dish as an example, when the cells (Chinese Academy of Sciences, GNHu44) are cultured to a cell density of about 70% - 80%, subculture can be carried out. Use a filter pump to aspirate the cell culture medium;

[0155] (3) Add 1 mL of pre - heated PBS, gently tilt the culture dish back and forth at 45° to make the PBS cover all the cells, wash away the dead cells and impurities, and then use a suction pump to aspirate the PBS;

[0156] (4) Add 1 mL of 0.25% trypsin (Gibco, 25200056), gently tilt the culture dish back and forth at 45° to make the trypsin cover all the cells, digest the cells, and immediately use a suction pump to aspirate the trypsin when cell detachment occurs;

[0157] (5) Add 2 mL of pre - heated complete medium for neutralization, gently tilt the culture dish back and forth at 45° to make the medium cover all the cells, and gently pipette to blow down the 293T cells with a pipette gun to form a single - cell suspension;

[0158] (6) Place the 293T cell suspension in a 15 - mL centrifuge tube for centrifugation at 1000 rpm for 3 min at room temperature, and discard the supernatant;

[0159] (7) Add 2 mL of pre - heated complete medium to resuspend the cell pellet. Take one - third of the cells and replate them in a new cell culture dish, add 7 mL of complete medium and shake well, and culture in a cell culture incubator under the conditions of 5% CO2, 95% humidity, and 37°C.

[0160] 2. Cryopreservation of 293T cells

[0161] (1) Preheat the complete medium and PBS in a 37°C water bath;

[0162] (2) Taking a 10 cm cell culture dish as an example, when the cell density reaches about 70% - 80%, subculture can be carried out. Use a suction pump to remove the cell culture medium;

[0163] (3) Add 1 mL of preheated PBS, gently tilt the culture dish back and forth at 45° to allow the PBS to cover all cells, wash away dead cells and impurities, and use a suction pump to remove the PBS;

[0164] (4) Add 1 mL of 0.25% trypsin, gently tilt the culture dish back and forth at 45° to allow the trypsin to cover all cells, digest the cells, and immediately use a suction pump to remove the trypsin when cell detachment occurs;

[0165] (5) Add 2 mL of preheated complete medium for neutralization, gently tilt the culture dish back and forth at 45° to allow the medium to cover all cells, and gently pipette to blow down the 293T cells to form a single-cell suspension;

[0166] (6) Place the 293T cell suspension in a 15 mL centrifuge tube for centrifugation at 1000 rpm for 3 min at room temperature, and discard the supernatant;

[0167] (7) Add 2 mL of cryopreservation solution to resuspend the cell pellet, take 1 mL of the cell suspension and aliquot it into cryotubes, store the cryotubes in a cryobox and slowly cool down to -80°C;

[0168] (8) The next day, transfer the cryotubes to a -196°C liquid nitrogen tank for long-term storage.

[0169] 2.2 AAV packaging

[0170] (1) Seed 293T cells in a 15 cm cell culture dish using 293T cell medium and culture in a cell culture incubator under conditions of 5% CO2, 95% humidity, and 37°C.

[0171] (2) Subculture one day in advance according to a ratio of 2:3;

[0172] (3) Two hours before transfection, change to a medium without antibiotics and with low serum (prepared according to the formula shown in Table 6) at 18 ml / dish, and culture in a cell culture incubator under conditions of 5% CO2, 95% humidity, and 37°C. When the cell density reaches 80% - 90%, adenovirus-associated virus (AAV) packaging can be carried out (when observing the cell density, pay attention to the density difference between the center and the edge for judgment);

[0173] Table 6: Configuration formula of low-serum medium without antibiotics (50 mL)

[0174] Required reagents Required volume DMEM (high glucose) 48.5 mL Fetal bovine serum (FBS) 1 mL Penicillin-streptomycin (P / S) 500 μL

[0175] (4) Prepare the AAV packaging system (prepare and use immediately): The molar ratio of pAAV-ITR, pAAV-2 / 9n (Miaoling Biology, P12267), and pAdDeltaF6 (Miaoling Biology, P10945) is 1:1:1. Calculate the proportion of each plasmid in 80 μg of total plasmid according to the molar ratio, add 3 mL of Opti-MEM (Gibco, 31985070), and let it stand for 5 min after preparing the system and mix well;

[0176] (5) Prepare the transfection reagent with PEI at 3 times the DNA amount. Add 240 μL of PEI (Polysciences, 24765-1) to 3 mL of Opti-MEM, tilt the test tube at 45° and gently invert it back and forth to mix well. Let it stand for 5 min after preparing the system and mix well;

[0177] (6) After mixing for 5 min, add the plasmid mixture to the PEI-liposome mixture, mix well and let it stand for 15 min (Note: Do not pipette or vibrate. Since PEI is a liposome, violent oscillation is likely to cause structural damage. Tilt the test tube at 45° and gently invert it back and forth to mix well), to obtain the plasmid-PEI mixture;

[0178] (7) Aspirate the medium without antibiotics in the 293T cell culture dish, leaving about 14 ml / dish. Slowly add about 6 ml of the plasmid-PEI mixture along the side wall of the cell culture dish, with a total volume of about 20 mL / dish. Gently tilt the culture dish to mix well, and culture it in a cell culture incubator under the conditions of 5% CO2, 95% humidity, and 37°C. Change the medium 24 h after plasmid transfection, use the medium without antibiotics and low serum, 20 mL / 15 cm culture dish, and culture it in a cell culture incubator under the conditions of 5% CO2, 95% humidity, and 37°C;

[0179] (8) Continue to culture for 48 - 72 h after changing the medium. When the CPE effect is observed, collect the 293T cells in time. Gently blow down the cells with a pipette gun, and collect the medium and cell precipitate together in a 50 ml centrifuge tube. Centrifuge at 2000 rpm for 10 min at 4°C. After removing the supernatant, freeze the cell precipitate at -80°C for future lysis to extract AAV.

[0180] 2.3 Extraction of AAV

[0181] (1) Take out the frozen 293T cell precipitate after AAV packaging from the -80°C refrigerator and resuspend it with 9 mL of PBS (autoclaved);

[0182] (2) Add 1 mL of Lysis Buffer (0.5% Sodium deoxycholate + 0.1% SDS + 1% TritonTM X - 100) and PF68 (MP Biomedicals, 092750016) with a final concentration of 0.001%, mix well and incubate in a 37°C water bath for 15 min (Sodium deoxycholate (Sigma - Aldrich, D6750 - 25G); SDS (VWR, 0227 - 1KG); Triton TM X - 100 (Sigma - Aldrich, T8787 - 100ML));

[0183] (3) Use - 196°C liquid nitrogen and a 37°C water bath to repeatedly freeze - thaw and lyse the above cell suspension, repeat the freeze - thaw four times;

[0184] (4) Add Benzonase Nuclease (Novoprotein, M046 - 01B), with a final concentration of 500 U / mL, and add MgCl2 to make the final concentration 2 mM, incubate in a 37°C water bath for 45 min (nucleic acid fragments disappear);

[0185] (5) Add 4 mL of 5 M NaCl and shake for 30 s (to prevent AAV loss);

[0186] (6) Centrifuge the AAV solution at 4000 rpm for 10 min at 4°C. Collect the supernatant into a new centrifuge tube and continue centrifuging at 4000 rpm for 10 min at 4°C. Collect the supernatant into a new centrifuge tube and store it in a 4°C refrigerator for density gradient centrifugation. Centrifuge repeatedly until there is almost no precipitate in the supernatant;

[0187] (7) Density gradient centrifugation in a biosafety cabinet (Thermo): Use a 39 mL ultra - centrifuge tube, and use a 10 mL syringe (1 mL syringe needle) to sequentially add the iodixanol (Sigma, D1556 - 250ML) gradient solution (its formulation is shown in Table 7), 5.4 mL of 60% solution (can be slightly faster), 6.5 mL of 40% solution, 6.5 mL of 25% solution, 8 mL of 15% solution (when adding different concentrations of iodixanol, tilt the centrifuge tube and slowly push it in to avoid layering, especially when adding the 15% layer, because the density difference between 15% and 25% iodixanol is small, the 15% layer is very easy to mix with the 25% layer). Finally, add 12 mL of the virus supernatant, and make up the remaining volume with PBS (bubbles should be prevented during the injection process. For example, when injecting 6.5 mL of solution, 7 mL of solution should be drawn to prevent disturbance and air bubbles remaining in the centrifuge tube, and there should be no liquid at the neck of the ultra - centrifuge tube);

[0188] Table 7: Formulation of iodixanol gradient solution (50 mL)

[0189]

[0190] Among them, 10×Gradient Buffer is prepared according to the formula shown in Table 8.

[0191] Table 8: Preparation formula of 10×Gradient Buffer (100 mL)

[0192] Required reagents Required volume 1M Tris (pH7.6) 10 mL NaCl (5M) 30 mL <![CDATA[MgCl2(1M)]]> 10 mL <![CDATA[ddH2O]]> 50 mL

[0193] (8) Seal the ultracentrifuge tube at high temperature, and centrifuge it using an ultracentrifuge at 300,000 g for 2.5 h at 10 °C;

[0194] (9) Take out the ultracentrifuge tube, fix it on an iron stand, and insert a 10 mL syringe needle obliquely at a 45-degree angle into the upper part of the centrifuge tube for air guiding;

[0195] (10) Use a 1 mL syringe needle to configure a 10 mL syringe, and vertically insert it into the side of the centrifuge tube at the junction of the 40% gradient solution and the 60% gradient solution, draw out the AAV salt solution in the 40% gradient solution, collect it in the centrifuge tube, and store it in a 4 °C refrigerator.

[0196] 2.4 Desalting and purification of AAV

[0197] (1) Add PBS containing 1% PF68 to the ultrafiltration centrifuge tube for column equilibration. After 3 min, centrifuge at 3000 g for 3 min, and discard the waste liquid;

[0198] (2) Add PBS containing 0.1% PF68 to the ultrafiltration centrifuge tube for column equilibration. After 3 min, centrifuge at 3000 g for 3 min, and discard the waste liquid;

[0199] (3) Add PBS containing 0.01% PF68 to the ultrafiltration centrifuge tube for column equilibration. After 3 min, centrifuge at 3000 g for 3 min, and discard the waste liquid;

[0200] (4) Add four times the volume of PBS (autoclaved) to the AAV salt solution containing iodixanol to reduce the solution viscosity. After mixing evenly, add it to the ultrafiltration centrifuge tube for centrifugal desalting at 3000 g for 10 min at 4 °C. Centrifuge multiple times until 1 mL of salt solution remains;

[0201] (5) Continue to add four times the volume of PBS (autoclaved) to the AAV salt solution containing iodixanol for centrifugal desalting at 3000 g for 20 min - 30 min at 4 °C until 250 μL of AAV solution remains (observe the content of the concentrate every 5 min);

[0202] (6) Add 250 μL (100 μL if the virus is scarce) of PBS (autoclaved) containing 0.002% PF68 to rinse the filter membrane of the ultrafiltration centrifuge tube. Aliquot the AAV solution into PCR tubes, 50 μL per tube, and store at -80 °C in the refrigerator.

[0203] 2.5 Titration of AAV

[0204] (1) Remove free DNA molecules from the AAV sample

[0205] Pipette 5 μL of AAV into 45 μL of PBS buffer to dilute the sample 10-fold. Further dilute the sample with PBS buffer by 10 2 -fold, 10 3 -fold, 10 4 -fold, 10 5 -fold to prepare virus dilutions, and prepare the reaction system according to Table 9 below.

[0206] Table 9: Reaction system

[0207]

[0208] Use a PCR thermal cycler to incubate the prepared reaction system at 37 °C for 30 min to degrade free DNA, and then incubate at 95 °C for 5 min to inactivate the DNA enzyme.

[0209] (2) Remove the capsid protein of AAV

[0210] Add 1 μL of proteinase K (Solarbio, P9460) (5 μg / μL) to each of the above reaction systems, incubate at 37 °C for 30 min to fully remove the capsid protein of AAV.

[0211] Add 30 μL of ddH2O to each of the above reaction systems for dilution, and incubate at 95 °C for 5 min to inactivate proteinase K.

[0212] (3) Dilute the AAV titer assay standard

[0213] Gradient dilute the AAV titer assay standard into 10 7 -fold, 10 6 -fold, 10 5 -fold, 10 4 -fold, 10 3 -fold, 10 2 -fold dilution solutions.

[0214] (4) Real-time PCR reaction

[0215] Absorb the AAV nucleic acid sample in the above reaction system and the standard product after gradient dilution, and prepare the reaction system shown in Table 10 for Real-time PCR detection.

[0216] Table 10: Real-time PCR reaction system

[0217] Required reagents Required volume SYBR Green Supermix 5 μL Primer Forward (4 μM) 1 μL Primer Reverse (4 μM) 1 μL cDNA 3 μL

[0218] Use the fluorescence quantitative PCR instrument ABI Quant Studio6 to carry out the reaction according to the procedure shown in Table 11.

[0219] Table 11: PCR reaction procedure

[0220]

[0221] 3. Injection of adeno-associated virus with JUN knockdown

[0222] (1) Inject the purified adeno-associated virus obtained in the above steps into the in-situ heart at a dose of 5×10 11 copies.

[0223] (2) Place the injected mice on a heating pad, wait for them to wake up, and then put them back into the original cage for continued feeding for later detection.

[0224] 4. Experimental results

[0225] The results are as Figure 10 shown. First, the diastolic function of the mice was detected at 8 weeks (0 weeks after knockdown treatment). The diastolic function parameters E / E’ and E / A were significantly increased, proving that there was a diastolic dysfunction, indicating that the model described in the aforementioned literature was successfully obtained. Further, in the continuous detection at 13 weeks (5 weeks after knockdown treatment), the occurrence and development of HFpEF in the model treatment group (using shRNA to knockdown the Jun gene) were well suppressed. Specifically, after Jun was knocked down, the diastolic function of the mice treated with high-fat diet combined with L-NAME treatment (HFD + 0.5 g / L L-NAME) was significantly improved; however, in the model control group of mice in which Jun was not knocked down, a continuous deterioration of diastolic function was observed; this indicates that by inhibiting or knocking down Jun expression, it is possible to prevent and treat HFpEF in the HFpEF mouse model.

[0226] Although the specific embodiments of the present invention have been described in detail, those skilled in the art will understand that: according to all the teachings that have been published, various modifications and changes can be made to the details, and these changes are all within the protection scope of the present invention. The entire scope of the present invention is given by the appended claims and any equivalents thereof.

Claims

1. Use of a reagent capable of suppressing or knocking out Jun gene expression in the preparation of a medicament for preventing and / or treating heart failure with preserved ejection fraction (HFpEF).

2. The use according to claim 1, wherein, The reagent is a gene editing system.

3. The use according to claim 2, wherein, The gene editing system comprises at least one site-specific nuclease.

4. The use according to claim 3, wherein, The site-specific nuclease is selected from RNA-guided nucleases (such as Cas nucleases), zinc finger nucleases, megabase meganucleases, TALE-nucleases, recombinases (such as Cre recombinase), transposases, and any combination thereof.

5. The use according to claim 1, wherein, The reagent is an RNA interfering agent or an antisense oligonucleotide.

6. The use according to claim 5, wherein, The RNA interfering agent is siRNA, shRNA or miRNA.

7. Use according to any one of claims 1-6, wherein, The reagent knocks out the Jun gene, reduces or suppresses the transcription of the Jun gene, and / or reduces or suppresses the translation of the Jun mRNA product.

8. A method for screening a medicament for preventing and / or treating heart failure with preserved ejection fraction (HFpEF), the method comprising the step of screening for a Jun inhibitor.

9. The method according to claim 8, wherein The Jun inhibitor is capable of suppressing or downregulating the expression of the Jun gene, or suppressing or blocking the activity of the Jun protein.

10. The method according to claim 8, wherein, The step of screening for a Jun inhibitor comprises: detecting whether a test reagent can inhibit Jun gene expression or Jun protein activity; selecting a test reagent capable of inhibiting Jun gene expression or Jun protein activity as a candidate drug.

11. The method of claim 9 or 10, wherein, The inhibition of Jun gene expression includes inhibition at the protein level and / or the mRNA level.

Images