Polypeptide targeting IL4I1 and IL4I1 polypeptide-protein degradation targeting chimera

Abstract

The invention belongs to the technical field of biomedicine and targeted drug development, and particularly relates to a polypeptide targeting IL4I1 and an IL4I1 polypeptide-protein degradation targeted chimera. The amino acid sequence of the polypeptide targeting IL4I1 is shown as SEQ ID No.1, the polypeptide targeting IL4I1 is a high-affinity binding polypeptide targeting IL4I1 obtained by screening through a phage display technology, and the polypeptide not only has good cell membrane penetrability, but also has excellent targeting property on IL4I1 in cells. Furthermore, an IL4I1 polypeptide-protein degradation targeting chimera constructed by using the IL4I1 targeting polypeptide not only can efficiently degrade highly expressed IL4I1 in tumor cells, but also can induce ferroptosis of gastric cancer cells by degrading intracellular IL4I1 so as to hinder malignant development of gastric cancer. Therefore, the invention can provide a novel solution with accuracy, long-term effect and immune regulation function for the treatment of gastric cancer.

Description

Technical Field

[0001] The present invention belongs to the technical fields of biomedicine and targeted drug development, and particularly relates to a polypeptide targeting IL4I1 and an IL4I1 polypeptide-protein degradation targeted chimera. Background Art

[0002] Gastric cancer is a malignant tumor that seriously threatens human health globally. At present, clinical treatment mainly focuses on surgical resection combined with radiotherapy and chemotherapy. However, the median overall survival of patients is only about 12 months, and it is prone to be accompanied by severe toxic side effects. Although the application of targeted therapies (such as anti-HER2 therapy) and immune checkpoint inhibitors (such as PD-1 / PD-L1 antibodies) brings hope to some patients, problems such as the heterogeneity of the tumor microenvironment, drug resistance, and the lack of precise targets still limit their efficacy. Therefore, it is urgent to develop new treatment strategies targeting the specific molecular mechanisms of gastric cancer.

[0003] In recent years, the biological functions of the immunometabolic regulatory molecule IL4I1 (Interleukin-4-Induced-1) have gradually become a hot topic in tumor treatment inventions. As an L-amino acid oxidase, this protein forms a dual pro-cancer mechanism by catalyzing the metabolism of tryptophan to generate metabolites such as indole pyruvate (I3P) and kynurenine (KynA). On the one hand, IL4I1 activates the aryl hydrocarbon receptor (AHR) signaling pathway, inhibits the activity of CD8 + T cells and induces the differentiation of regulatory T cells (Tregs), driving tumor immune escape; on the other hand, by scavenging reactive oxygen species (ROS) and upregulating the synthesis of glutathione (GSH), it antagonizes ferroptosis, thereby enhancing the survival ability of gastric cancer cells. Database analysis (GEPIA2, TNMplot) further confirmed that IL4I1 is abnormally highly expressed in gastric cancer tissues and is significantly correlated with the shortening of patient survival. Knockdown of IL4I1 in animal models can significantly inhibit tumor growth and induce ferroptosis, highlighting its potential value as a therapeutic target.

[0004] However, the existing intervention means for IL4I1 have obvious limitations. Although small molecule inhibitors can partially block its enzyme activity, it is difficult to cover the non-catalytic functions of IL4I1, and it is prone to cause toxicity due to off-target effects; although monoclonal antibodies have high specificity, they are limited by the ability of macromolecules to penetrate cell membranes and cannot effectively act on intracellular IL4I1, and may induce immunogenic reactions; while natural product inhibitors (such as thymol) face problems such as insufficient activity and metabolic instability. More critically, the above strategies can only transiently inhibit the function of IL4I1 and cannot achieve the complete clearance of the target protein, resulting in a short treatment response and easy development of drug resistance.

[0005] In this context, the breakthrough of targeted protein degradation technology (PROTAC) provides a new idea for the treatment of gastric cancer. This technology constructs a heterobifunctional molecule to co-localize the target protein with the E3 ubiquitin ligase, triggering the specific degradation of the target protein by the ubiquitin-proteasome system. Compared with traditional "occupation-driven" inhibitors, PROTAC operates in an "event-driven" mode, enabling long-term protein clearance with catalytic doses and targeting proteins that are traditionally undruggable.

[0006] However, although PROTAC technology has made progress in multiple targets, the degraders targeting IL4I1 are still blank. Therefore, how to screen a polypeptide targeting IL4I1 and construct a degrader targeting IL4I1 has become the technical problem to be solved by this invention. Summary of the Invention

[0007] To overcome the deficiencies in the prior art, the object of this invention is to provide a polypeptide targeting IL4I1 and an IL4I1 polypeptide-protein degradation targeting chimera. This invention screens a binding polypeptide with high affinity targeting IL4I1 through phage display technology, and at the same time confirms that this polypeptide has good cell membrane permeability and excellent targeting to IL4I1 intracellularly. This invention further constructs a polypeptide-PROTAC molecule based on the polypeptide screened above. This polypeptide-PROTAC bridges the IL4I1 polypeptide ligand and the E3 ligase ligand through a flexible linker to form a stable ternary complex, inducing the ubiquitination degradation of IL4I1, and at the same time can precisely bind to the macromolecular interaction interface of IL4I1, overcoming the dependence of small molecule ligands on superficial binding sites, and significantly improving the targeting efficiency and specificity.

[0008] In the first aspect of this invention, to achieve the above object, there is provided a polypeptide targeting IL4I1, and the amino acid sequence of the polypeptide targeting IL4I1 is shown as SEQ ID No.1.

[0009] The polypeptide targeting IL4I1 provided by this invention is an IL4I1-targeted bioactive peptide (its sequence is specifically DHSDWAYWFSDP, as shown in SEQ ID No.1) obtained by phage display technology, utilizing the advantages of direct unity of genotype and phenotype, rapidity, high efficiency, and high throughput, through multiple rounds of screening and high-throughput sequencing. Further, using this polypeptide targeting IL4I1 to construct a protein degradation targeting chimera can endow it with better cell membrane permeability and stability, and can target IL4I1.

[0010] In the second aspect of this invention, there is provided the use of the above polypeptide targeting IL4I1 in the preparation of anti-tumor drugs.

[0011] As a preferred embodiment, the anti-tumor drug is an anti-gastric cancer drug.

[0012] In a third aspect of the present invention, there is provided an IL4I1 polypeptide-protein degradation targeting chimera, which is mainly constructed from a polypeptide targeting IL4I1, an E3 ubiquitin ligase ligand, a cell-penetrating peptide, and a linker; the amino acid sequence of the polypeptide targeting IL4I1 is as shown in SEQ ID No.1.

[0013] The present invention uses the above-screened polypeptide targeting IL4I1 as a ligand for the target protein of IL4I1, and couples the IL4I1 target protein ligand with an E3 ligase ligand through a linker to synthesize an IL4I1 polypeptide-protein degradation targeting chimera (IL4I1 polypeptide-PROTAC molecule). It is found through screening that the IL4I1 polypeptide-PROTAC can efficiently degrade the IL4I1 protein in gastric cancer cells, and has concentration-dependence and time-dependence. At the same time, this polypeptide-protein hydrolysis targeting chimera can not only efficiently degrade IL4I1, but also induce ferroptosis in gastric cancer cells, thereby inhibiting the progression of gastric cancer, and has broad application prospects in anti-gastric cancer drugs.

[0014] Specifically, the IL4I1 polypeptide-protein degradation targeting chimera provided by the present invention consists of the following four parts: a polypeptide targeting IL4I1 with cell membrane permeability screened by phage display technology as the recognition peptide sequence, and also includes a linker, a cell-penetrating peptide, and an E3 ligase ligand sequence. This polypeptide-PTOTAC molecule bridges the IL4I1 polypeptide ligand and the E3 ligase ligand through a flexible linker chain to form a stable complex, inducing the ubiquitination degradation of IL4I1. Its unique advantages are reflected in three aspects: First, it completely eliminates the enzymatic activity and non-enzymatic-dependent immunosuppressive function of IL4I1, blocking the pro-cancer signal at the source; Second, by restoring the sensitivity to ferroptosis, it enhances the vulnerability of tumor cells to oxidative stress; Third, the chemically modified polypeptide structure has both cell membrane penetration ability, in vivo stability, and IL4I1 targeting property, and can effectively penetrate deep into gastric cancer tissues. This polypeptide-PROTAC can achieve an IL4I1 degradation rate of more than 80% in gastric cancer cell lines such as MKN45 and MKN1, and significantly inhibit tumor growth in the xenograft tumor model, while accompanied by an increase in CD8 + T cell infiltration and an increase in ferroptosis markers, and has the advantages of high efficiency, low toxicity, and high specificity.

[0015] As a preferred embodiment, the E3 ubiquitin ligase ligand is a Cereblon ligand.

[0016] As a preferred embodiment, the Cereblon ligand is pomalidomide-PEG2. Pomalidomide-PEG2, namely pomalidomide-dimeric ethylene glycol, is a synthetic E3 ligase ligand-linker conjugate.

[0017] As a preferred embodiment, the linker is lysine.

[0018] As a preferred embodiment, the amino acid sequence of the cell-penetrating peptide is shown in SEQ ID No.2. The amino acid sequence shown in SEQ ID No.2 is RKKRRQRRR. The use of this cell-penetrating peptide in the present invention is beneficial to improving the efficiency of polypeptide entry into cells.

[0019] In a fourth aspect of the present invention, there is provided the use of the above IL4I1 polypeptide-protein degradation-targeting chimeric molecule, characterized in that it is used in the preparation of anti-tumor drugs.

[0020] The IL4I1 polypeptide-protein degradation-targeting chimeric molecule provided by the present invention can be directly used in the preparation of anti-tumor drugs. In particular, tumors related to IL4I1 targeting are all applicable to the anti-tumor drugs of the present invention. Therefore, the present invention does not particularly limit the types of tumors involved in anti-tumor drugs. As a preferred embodiment, the anti-tumor drug is an anti-gastric cancer drug.

[0021] Furthermore, the anti-tumor drug of the present invention can be used alone or in the form of a pharmaceutical composition together with a pharmaceutically acceptable pharmaceutical carrier or excipient, and the present invention does not limit this.

[0022] The technical solution of the present invention has the following advantages and beneficial effects:

[0023] The present invention first analyzed the IL4I1 expression levels of different gastric cancer patients through the GEPIA2 and TNMplot databases, and found that IL4I1 was highly expressed in gastric cancer patients, and there was no significant difference in the expression levels at each clinical stage. In addition, using the Kaplan-Meier Plotter database, the association between the IL4I1 expression level and the overall survival period of gastric cancer patients was analyzed, and it was found that high expression of IL4I1 shortened the overall survival period of gastric cancer patients and was highly correlated with the poor prognosis of gastric cancer patients. At the same time, the present invention screened the whole gastric cancer cell lines, obtained the cells MKN45 and MKN1 with high IL4I1 expression, and used them as subsequent research models, and successfully constructed an IL4I1 KD cell line using human-derived IL4I1 lentivirus.

[0024] The polypeptide targeting IL4I1 provided by the present invention is a novel bioactive peptide obtained through multiple rounds of screening using phage display technology and high-throughput sequencing. This polypeptide has good cell membrane permeability and can effectively target IL4I1, serving as the basis for subsequent construction of a polypeptide-PROTAC molecule that can target IL4I1 and efficiently degrade IL4I1 through an E3 ligase. The present invention uses phage display technology for polypeptide screening, which can rapidly enrich sequences with high-affinity binding to the IL4I1 target from a vast number of candidate molecules. Even if the active site or epitope structure of the target protein is unknown, it will not affect the present invention's ability to obtain high-affinity ligands through biopanning.

[0025] Based on the IL4I1-targeting polypeptide obtained from the above screening, the present invention constructs a polypeptide-PROTAC molecule. Although PROTAC technology has made progress in multiple targets, the degrader targeting IL4I1 is still blank. The present invention uses the polypeptide ligand of pomalidomide-PEG2 as the E3 ligase ligand in the IL4I1 polypeptide-proteolysis targeting chimera. Finally, the IL4I1 target protein ligand and the E3 ligase ligand are coupled through a lysine (linker), and a cell-penetrating peptide is introduced to successfully construct a polypeptide-proteolysis targeting chimera targeting IL4I1. This polypeptide-proteolysis targeting chimera is composed of natural amino acids, with novel structure, high activity, simple and easy synthesis, and low cost. At the same time, the polypeptide-PROTAC molecule constructed by the present invention, while targeting IL4I1 with high affinity, is assisted by the cell-penetrating peptide to enter tumor cells, and the E3 ligase ligand plays a role, thus precisely binding to the macromolecular interaction interface of IL4I1, overcoming the dependence of small molecule ligands on superficial binding sites, and significantly improving the targeting efficiency and specificity.

[0026] Experiments have confirmed that the IL4I1 polypeptide-proteolysis targeting chimera of the present invention can not only efficiently degrade highly expressed IL4I1 in tumor cells, but also cause an increase in intracellular lipid ROS, and at the same time down-regulate the protein expression of GPX4 and SLC7A11. After using the inhibitor Fer-1, the down-regulation trend was reversed, effectively inducing ferroptosis in gastric cancer cells. This indicates that the targeting chimera can induce ferroptosis in gastric cancer cells by degrading intracellular IL4I1, thereby hindering the malignant development of gastric cancer, and has the advantages of high efficiency, low toxicity, and high specificity.

[0027] Therefore, the present invention can provide effective technical support and treatment strategies for the research and development of novel tumor-targeted drugs, especially gastric cancer drugs, and the treatment of related cancers. At the same time, it provides a novel solution with precision, long-term efficacy, and immune regulation function for gastric cancer treatment, having important translational value. Brief Description of the Drawings

[0028] Figure 1Analysis of the expression of IL4I1 in gastric cancer patients in Experimental Example 1 of the present invention;

[0029] Figure 2 Results of the effect of IL4I1 on the survival of gastric cancer patients in Experimental Example 1 of the present invention;

[0030] Figure 3 Analysis of gastric cancer cell lines with high expression of IL4I1 in Experimental Example 2 of the present invention;

[0031] Figure 4 Results of inducing ferroptosis in gastric cancer cells by knocking down IL4I1 in Experimental Example 2 of the present invention;

[0032] Figure 5 Results of inhibiting the growth of gastric cancer cells by knocking down IL4I1 in Experimental Example 2 of the present invention;

[0033] Figure 6 Results of inducing ferroptosis in gastric cancer cells in vivo by knocking down IL4I1 in Experimental Example 2 of the present invention;

[0034] Figure 7 Blue-white spot results of phage titer determination in Experimental Example 3 of the present invention;

[0035] Figure 8 Agarose gel electrophoresis diagram of PCR amplification of phage DNA fragments in Experimental Example 3 of the present invention;

[0036] Figure 9 Venn diagram of the high-throughput sequencing results of IL4I1 in culture dishes in Experimental Example 3 of the present invention;

[0037] Figure 10 Results of the interaction between IP01 polypeptide and IL4I1 in Experimental Example 4 of the present invention;

[0038] Figure 11 2D diagram of molecular docking between IP01 polypeptide and IL4I1 in Experimental Example 4 of the present invention;

[0039] Figure 12 Result diagram of laser confocal detection of the transmembrane ability of IL4I1 polypeptide in Experimental Example 5 of the present invention;

[0040] Figure 13 Result diagram of flow cytometry detection of the transmembrane ability of IL4I1 polypeptide in Experimental Example 5 of the present invention;

[0041] Figure 14 Result diagram of the targeting of IP01 polypeptide to IL4I1 in Experimental Example 6 of the present invention;

[0042] Figure 15 Schematic diagram of the structure of IL4I1 polypeptide-PROTAC in Experimental Example 7 of the present invention;

[0043] Figure 16 This is the degradation result of IL4I1 polypeptide-PROTAC with different concentrations on IL4I1 concentration dependence in the eighth experimental example of the present invention;

[0044] Figure 17 This is the degradation result of IL4I1 polypeptide-PROTAC with different concentrations on IL4I1 time dependence in the eighth experimental example of the present invention;

[0045] Figure 18 This is the result that IL4I1 polypeptide-PROTAC induces ferroptosis and upregulates intracellular lipid ROS in the ninth experimental example of the present invention. Detailed implementation manners

[0046] The technical solutions of the present invention will be further described below in conjunction with the detailed implementation manners and the drawings, but the present invention is not limited to the scope of the described embodiments. Unless otherwise specified in the following embodiments, the used methods are all conventional methods in the art. Unless otherwise specified, the reagents used in the following embodiments are all conventional reagents in the art and can be obtained from commercial channels.

[0047] Example 1

[0048] This example provides a polypeptide targeting IL4I1, and its amino acid sequence is shown as SEQ ID No.1. The specific amino acid sequence shown as SEQ ID No.1 is: DHSDWAYWFSDP.

[0049] Example 2

[0050] This example provides an IL4I1 polypeptide-protein degradation targeting chimera (abbreviation: IL4I1 polypeptide-PROTAC), which is constructed from a polypeptide targeting IL4I1, an E3 ubiquitin ligase ligand, a cell-penetrating peptide, and a linker. Among them, the amino acid sequence of the polypeptide targeting IL4I1 is shown as SEQ ID No.1. The E3 ubiquitin ligase ligand is a Cereblon ligand. The Cereblon ligand is pomalidomide-PEG2 (purchased from Shanghai Chutai Biotechnology Co., Ltd.). The linker is lysine (K). The amino acid sequence of the cell-penetrating peptide is shown as SEQ ID No.2.

[0051] The specific amino acid sequence of the polypeptide targeting IL4I1 is (as shown in SEQ ID No.1): DHSDWAYWFSDP.

[0052] The specific amino acid sequence of the cell-penetrating peptide is (as shown in SEQ ID No.2): RKKRRQRRR.

[0053] When preparing the above IL4I1 polypeptide-protein degradation targeting chimera, the polypeptide provided in Example 1 was used as the target protein ligand of IL4I1 to design a polypeptide PROTAC targeting IL4I1, and pomalidomide-PEG2 was selected as the E3 ubiquitin ligase ligand. By binding the target protein (polypeptide targeting IL4I1) to one end of the linker and the E3 ubiquitin ligase ligand (Cereblon, CRBN) to the other end, and further modifying the transmembrane peptide, the IL4I1 polypeptide-protein degradation targeting chimera of this example was constructed. Its structure and connection mode are: RKKRRQRRR-K(pomalidomide-PEG2)-DHSDWAYWFSDP. The IL4I1 polypeptide-protein degradation targeting chimera was synthesized by Shanghai Chutai Biotechnology Co., Ltd. according to the above connection mode and structure.

[0054] Experimental Example 1. Analysis based on database shows that high expression of IL4I1 promotes the occurrence and development of gastric cancer

[0055] 1. Expression of IL4I1 in gastric cancer patients

[0056] IL4I1 shows abnormal expression in patients with various cancers. To explore the relationship between IL4I1 and the development of gastric cancer, the present invention analyzed the expression of IL4I1 in tumor tissues of 408 gastric cancer patients and normal gastric tissues of 211 normal people through the GEPIA2 (http: / / gepia2.cancer-pku.cn) database. The results are as Figure 1 shown. The results show that the expression level of IL4I1 in cancer tissues of gastric cancer patients is significantly higher than that in normal tissues ( Figure 1 A). To further analyze the relationship between IL4I1 and the development of gastric cancer, the present invention analyzed the expression of IL4I1 in normal gastric tissues and tumor tissues of gastric cancer patients through the TNMplot (https: / / tnmplot.com) database. The results once again confirmed that IL4I1 is highly expressed in cancer tissues of gastric cancer patients ( Figure 1 B), which fully indicates that the expression level of IL4I1 is closely related to the occurrence and development of gastric cancer.

[0057] In addition, the expression levels of IL4I1 in different clinical stages of gastric cancer are basically the same, without significant differences (F = 2.27), which indicates the stability of IL4I1 in the process of gastric cancer, and its expression level does not fluctuate significantly with the progression of the clinical stage of gastric cancer ( Figure 1 C). Therefore, targeting the degradation of IL4I1 is an effective gastric cancer treatment strategy throughout the whole process of gastric cancer treatment.

[0058] 2. Influence of IL4I1 on the survival period of gastric cancer patients

[0059] To investigate whether the expression level of IL4I1 in gastric cancer tissues is associated with poor prognosis of gastric cancer patients, the present invention utilized the Kaplan-Meier Plotter (http: / / kmplot.com / analysis / ) database to analyze the relationship between the expression level of IL4I1 and the survival of gastric cancer patients. The results are as Figure 2 shown.

[0060] Figure 2 The results showed that the overall survival (OS) of patients with high IL4I1 expression was shorter than that of patients with low IL4I1 expression. The hazard ratio (HR) = 1.23, and p < 0.05, indicating statistical significance. This suggests that the expression level of IL4I1 is closely associated with poor prognosis of gastric cancer patients, and patients with high IL4I1 expression have a higher risk of death, providing strong evidence for IL4I1 as a biomarker for evaluating the prognosis of gastric cancer patients.

[0061] Experimental Example 2. Function of IL4I1 in the development of gastric cancer

[0062] 1. Screening of gastric cancer whole cell lines to identify IL4I1-high expressing cells

[0063] Since the present invention has determined that IL4I1 is highly expressed in gastric cancer through the database, in order to explore the function of IL4I1 at the cellular level and the subsequent evaluation of the activity of IL4I1 PROTAC, the present invention analyzed the protein expression level of IL4I1 in gastric cancer whole cell lines by Western blot. The results are as Figure 3 shown.

[0064] From Figure 3 the Western blot results, it was shown that among 7 gastric cancer cell lines, the expression of IL4I1 was relatively high in MKN45 and MKN1 cells. Therefore, the present invention selected MKN45 cells and MKN1 cells for subsequent experiments.

[0065] 2. Knockdown of IL4I1 induces ferroptosis in gastric cancer cells

[0066] To verify whether knockdown of IL4I1 would induce ferroptosis in gastric cancer cells, the present invention first analyzed the correlation between IL4I1 and GPX4 at the mRNA level through the TNMplot database (https: / / tnmplot.com). The results are as Figure 4 shown in A. The results showed that in 375 gastric cancer patients, IL4I1 and GPX4 were positively correlated in gastric cancer (p = 0.00, R = 0.28) ( Figure 4 A).

[0067] Secondly, the expression levels of the ferroptosis key proteins GPX4 and SLC7A11 in MKN45 IL4I1 KD and MKN1 IL4I1 KD cells were analyzed by Western blot, and the results are as Figure 4 shown in B and 4C. The results showed that in MKN45 and MKN1 cells, after knocking down the IL4I1 protein, the expression levels of GPX4 and SLC7A11 proteins both decreased ( Figure 4 B, 4C).

[0068] Furthermore, after adding the ferroptosis inhibitor Fer-1, the decreased levels of GPX4 and SLC7A11 proteins were both reversed ( Figure 4 D, 4E), indicating that IL4I1 may participate in glutamate release through the transporter SLC7A11, promote the synthesis of GPX4, thereby protecting gastric cancer cells from oxidative stress damage and maintaining the redox balance of gastric cancer cells. Therefore, in gastric cancer cells, knocking down IL4I1 induces ferroptosis in gastric cancer cells.

[0069] 3. Knocking down IL4I1 inhibits the growth of gastric cancer cells

[0070] To verify that IL4I1 can affect the occurrence and development of gastric cancer in vivo, the present invention used the human gastric cancer cell lines MKN45CON and MKN45 IL4I1 KD to construct a subcutaneous tumor-bearing model in NOD-SCID mice to detect the effect of IL4I1 on the proliferation of gastric cancer cells, and the results are as Figure 5 shown.

[0071] Figure 5 The results showed that in NOD-SCID mice, the growth of tumors in the IL4I1 KD group was significantly slower than that in the CON group ( Figure 5 A, 5B, 5C), indicating that knocking down IL4I1 can inhibit the proliferation of gastric cancer. During this process, there was no significant change in the body weight of the mice ( Figure 5 D). At the same time, immunohistochemical results also showed that after knocking down IL4I1, the expression level of Ki67 decreased ( Figure 5 E), indicating that knocking down IL4I1 inhibits the proliferation of gastric cancer.

[0072] 4. Knocking down IL4I1 induces ferroptosis of gastric cancer cells in vivo

[0073] To explore whether ferroptosis can be induced at the animal level after IL4I1 KD, the present invention detected the expression of GPX4 and SLC7A11 in the tumor tissues of NOD-SCID mice by Western blot experiment. The results are as Figure 6 shown.

[0074] Figure 6The results showed that the protein expressions of GPX4 and SLC7A11 in the IL4I1 KD group both decreased ( Figure 6 A), and the immunohistochemical results also showed a decrease in the expressions of GPX4 and SLC7A11 ( Figure 6 B), indicating that IL4I1 can also induce ferroptosis in gastric cancer at the animal level. Therefore, after IL4I1 KD, it can inhibit the proliferation of gastric cancer cells and induce ferroptosis in the cells.

[0075] Experimental Example 3: Screening of polypeptides targeting IL4I1

[0076] Step 1: Panning of phage random dodecapeptide library

[0077] 1. Resuscitation of Escherichia coli ER2738

[0078] (1) Take 5 μL of the Escherichia coli ER2738 strain in the phage display library kit and add it to a 1.5 mL EP tube containing 500 μL of LB liquid medium. Place it in a shaker at 37 °C and shake at 200 rpm for 2 h. The phage display library kit is purchased from New England biolabs.

[0079] (2) Take out the pre-prepared solid medium containing tetracycline resistance, place it in a 37 °C oven for preheating and keep it away from light.

[0080] (3) Use a triangular spreading rod to evenly spread the resuscitated Escherichia coli ER2738 on the preheated plate containing tetracycline resistance, and invert the plate in a 37 °C oven overnight, keeping it away from light.

[0081] 2. First-round panning of the phage display library

[0082] (1) Prepare a 10 μg / mL IL4I1 target protein solution with sterile NaHCO3 solution at pH 8.6 and 0.1 mol / L. Take 200 μL of the target solution and add it to a high-adsorption sterile 96-well ELISA plate. Incubate the ELISA plate in a wet box on a horizontal shaker at 80 rpm overnight at 4 °C. The IL4I target protein is purchased from Proteintech.

[0083] (2) The next day, pick a well-isolated Escherichia coli ER2738 monoclonal colony and inoculate it into a 250 mL conical flask containing 20 mL of LB liquid medium. Place it in a shaker at 37 °C and culture it at 200 rpm. Carefully monitor the OD value of the Escherichia coli ER2738 culture to ensure that it does not grow beyond the early logarithmic phase (OD600: 0.01 - 0.05).

[0084] (3) The enzyme-linked immunosorbent assay (ELISA) plate was taken out the next day, and the protein solution was discarded. The ELISA plate was inverted and tapped repeatedly on a clean sterile paper towel to facilitate the removal of residual protein solution. 250 μL of TBST containing 0.1% Tween-20 was added and the washing was repeated 10 times. Each time, it was quickly tapped on a clean paper towel to prevent the wells from drying out.

[0085] (4) 2 μL of the phage display library was taken and diluted 100-fold with TBST to a final volume of 200 μL. It was added to the empty ELISA plate and incubated at room temperature for 1 h with shaking at 80 rpm on a horizontal shaker.

[0086] (5) The phage library that did not bind to the empty plate was aspirated and added to the wells containing the target protein. The ELISA plate was placed on a horizontal shaker and incubated at 4°C with shaking at 80 rpm for 1 h.

[0087] (6) The unbound phages were poured out, and 200 μL of TBST was added and the washing was repeated 10 times. Each time, it was inverted and tapped on a clean paper towel to avoid cross-contamination.

[0088] (7) 200 μL of Gly-HCl elution buffer with a pH of 2.2 was added to non-specifically disrupt the binding. It was gently shaken for 15 min to elute the phages specifically bound to the IL4I1 protein. The eluted phages were immediately transferred to a new 1.5 mL EP tube and 15 μL of Tris-HCl neutralization buffer with a pH of 9.1 was added.

[0089] (8) The eluate from the above step was added to the ER2738 Escherichia coli culture in step (2) and placed in a shaker at 37°C and continued to be cultured at 200 rpm for 4.5 - 5 hours for amplification.

[0090] (9) All of the amplified eluate was transferred to a sterile centrifuge tube and centrifuged at 12,000 g for 10 min in a low-temperature centrifuge at 4°C. The supernatant was transferred to a new centrifuge tube and centrifuged again.

[0091] (10) 80% of the supernatant was taken and transferred to a new test tube, and 1 / 6 volume of PEG / NaCl solution was added. The phages were allowed to precipitate overnight at 4°C.

[0092] (11) The next day, the phage precipitate was placed in a low-temperature centrifuge at 4°C and centrifuged at 12,000 g for 15 min. The supernatant was poured out and centrifuged for another 5 min. The remaining supernatant was gently aspirated with a pipette, and the white phage precipitate adhered to the side wall of the centrifuge tube.

[0093] (12) Resuspend the phage pellet with 1 mL of TBS, transfer the suspension to a 1.5 mL centrifuge tube, centrifuge at 14,000 rpm for 5 min at 4 °C, transfer the supernatant to a new centrifuge tube, add 1 / 6 volume of PEG / NaCl solution, and incubate on ice for 60 min to reprecipitate the phage.

[0094] (13) Centrifuge at 14,000 rpm for 10 min at 4 °C, discard the supernatant, centrifuge again for 1 min, and aspirate the remaining supernatant with a pipette. Finally, resuspend the pellet with 200 μL of TBS, centrifuge again for 1 min, and transfer the supernatant to a new 1.5 mL EP tube, which is the eluate after the first round of panning amplification.

[0095] 3. Phage Titer Determination

[0096] (1) Pick a well-isolated ER2738 monoclonal strain from the solid medium with tetracycline resistance, inoculate it into 10 mL of liquid medium containing 1‰ tetracycline, and culture at 37 °C and 200 rpm until the OD 600 value reaches 0.5. At this time, Escherichia coli is in the mid-logarithmic growth phase.

[0097] (2) Melt the top agar in a microwave oven, dispense it into 8 sterile 5 mL EP tubes after melting, 3 mL per tube, and let it stand at 45 °C for later use. At the same time, preheat eight IPTG / X-gal plates in an oven at 37 °C for at least 1 h before use.

[0098] (3) Dilute the phage solution with LB medium. The dilution range for the eluted phage solution is 10 1 - 10 4 , and the dilution range for the amplified phage solution is 10 9 - 10 12 .

[0099] (4) Add 200 μL of the ER2738 culture grown to the mid-logarithmic phase to each EP tube with a dilution concentration.

[0100] (5) Add 10 μL of phage solution with different dilution concentrations to each tube, pipette to mix evenly, and incubate at room temperature for 5 min for infection.

[0101] (6) Add the infected ER2738 to the EP tube containing the top agar, quickly blow to mix evenly and pour it quickly onto the 45 °C preheated IPTG / X-gal plate, and quickly tilt and rotate the plate to make it evenly distributed on it.

[0102] (7) After the top agar on the plate solidifies, invert it and incubate it overnight in an oven at 37 °C.

[0103] (8) Count the number of blue plaques on the plate with approximately 100 blue plaques. Phage titer = number of phage blue plaques × dilution factor / 10 (pfu / μL).

[0104] The results of phage titer determination are as Figure 7 shown. Figure 7 From left to right are the schematic diagrams of blue plaques at each concentration when measuring the titer of the phage solution in the dilution range of 10 1 -10 4 dilution.

[0105] 4. Second round of panning of the phage display library

[0106] (1) After obtaining the phage eluate titer after the first round of amplification, re-prepare the immobilized IL4I1 target protein according to the method of the first round, and add the phage eluate with the same order of magnitude as the first round, and repeat the above panning steps, where the concentration of Tween-20 in the TBST used in the washing process is increased to 0.5%.

[0107] (2) Measure and calculate the titers of the second-round eluate and the amplified phage solution on the LB / IPTG / X-gal plate respectively.

[0108] 5. Third round of panning of the phage display library

[0109] (1) Re-immobilize the IL4I1 target protein and add the phage eluate after the second round of amplification with the same order of magnitude as the first round. Repeat the panning steps of the previous two rounds, and still use the TBST solution containing 0.5% Tween-20 during the washing process.

[0110] (2) Measure and calculate the titer of the third-round eluate on the LB / IPTG / X-gal plate. Amplification is not required for this round of panning.

[0111] The panning results of the IL4I1-targeted peptide phage random dodecapeptide library are shown in Table 1.

[0112] Table 1. Results of three rounds of panning of IL4I1-targeted peptide phage

[0113]

[0114] As can be seen from Table 1, after three rounds of panning of the IL4I1-targeted peptide by the phage dodecapeptide library, the bound phages are significantly enriched.

[0115] Step 2. Phage DNA extraction

[0116] (1) Take the phage eluate after the third round of panning and add 200 μL of PEG / NaCl solution. Invert several times up and down and let stand at room temperature for 10 - 20 min.

[0117] (2) Centrifuge at 14,000 rpm for 10 min at 4°C, pour off the supernatant, centrifuge again for 1 min, and carefully aspirate all the remaining supernatant using a pipette.

[0118] (3) Add 100 μL of the prepared sodium iodide buffer, and tap the EP tube vigorously to completely suspend the precipitate in the buffer.

[0119] (4) Add 250 μL of absolute ethanol and incubate at room temperature for 10 min. Short-term incubation at room temperature will preferentially precipitate single-stranded phage DNA, causing most phage proteins to dissolve in the absolute ethanol.

[0120] (5) Centrifuge at 14,000 rpm for 10 min at 4°C, discard the supernatant. Add 0.5 mL of 70% ethanol (stored at -20°C) to wash the precipitate, recentrifuge for 10 min, discard the supernatant, and briefly dry the precipitate under vacuum.

[0121] (6) Resuspend the precipitate with 30 μL of ddH2O to obtain phage DNA, which can be stored at -20°C for a long time.

[0122] Step 3: Phage blue plaque sequencing

[0123] (1) Select 30 well-separated blue plaques from the blue-white plaque plate of the third-round eluate titer determination, transfer them to a 20 mL ER2738 Escherichia coli culture in the early logarithmic phase for amplification, and culture at 37°C and 200 rpm for 4.5 - 5 hours.

[0124] (2) Take 200 μL of each amplified bacterial solution and send it to Tsingke Biotechnology Company for sequencing. The remaining bacterial solution is used to extract phages according to the method in the first-round panning step and stored at -80°C.

[0125] (3) Use DNAMAN software to analyze the sequencing results.

[0126] Step 4: Preparation and sequencing of high-throughput sequencing samples

[0127] In the present invention, the phage DNA extracted from the third-round eluate is subjected to PCR amplification. Forward and reverse primers are designed according to the insertion position of the dodecapeptide in the phage, and the part of the phage DNA containing the dodecapeptide is amplified by setting a suitable PCR program. The results are as Figure 8 shown. Figure 8 Among them, the size of the target fragment of the product is 231 bp, and finally the PCR product is subjected to high-throughput sequencing.

[0128] The PCR amplification conditions and parameters are as follows:

[0129] Forward primer F: AAGCTGTTTAAGAAATTCACCT; Reverse primer R: CAACAAATCGTTTTAGGGTATG; PCR system for each sample (25 μL): 1 μL of each of F and R primers; 12.5 μL of TaKaRa PrimeSTAR HS (Prime) Mix; 1 μL of Total DNA Sample; 9.5 μL of ddH2O. PCR program: Pre-denaturation: 98 °C, 2 min; Denaturation: 98 °C, 10 s; Annealing: 55 °C, 10 s; Extension: 72 °C, 30 s; Final extension: 72 °C, 3 min. Set the denaturation, annealing, and extension steps to automatically cycle 50 times. After the program ends, take out the sample and store it at 4 °C.

[0130] The samples were sent to Beijing Tsingke Biotechnology for high-throughput sequencing, and the Venn diagram of the analysis results is as Figure 9 shown. Figure 9 The results showed that a total of 42,121 decapeptide sequences specifically binding to IL4I1 were obtained. The blue spot sequencing results were intersected with the high-throughput sequencing results, and a total of four overlapping polypeptides were obtained, named IP01, IP02, IP03, and IP04 in sequence, and the sequences are shown in Table 2.

[0131] Table 2. Amino acid sequences of phage decapeptides specifically binding to IL4I1

[0132] Polypeptide Number Polypeptide Sequence High-Throughput Frequency Locus Coeruleus Frequency IP01 DHSDWAYWFSDP 2393 9 IP02 GHDDVLSWDWWL 702 2 IP03 WHNEFEPPSWFW 147 2 IP04 EHFPLYYVRPTN 2 1

[0133] As can be seen from Table 2, IP01 with the sequence DHSDWAYWFSDP appeared the most frequently in the high-throughput sequencing results, a total of 2,393 times, indicating that it has the strongest binding ability and the strongest targeting ability. Therefore, IP01 polypeptide (i.e., the polypeptide targeting IL4I1 in Example 1 of the present invention) was further verified subsequently.

[0134] Experimental Example 4. Evaluation of the binding ability of IL4I1 polypeptide

[0135] 1. Enzyme-linked immunosorbent assay (ELISA)

[0136] The phage ELISA binding assay using directly coated IL4I1 target in the present invention can quickly determine whether the selected phage clones bind to the target. This method cannot determine whether the selected phages bind with high or low affinity, but can be used to qualitatively determine the relative binding affinity of the selected phage clones. In order to verify the relative affinity between the selected IP01 polypeptide and IL4I1 protein, the present invention used the direct ELISA method for detection. To control the influencing factors, the control group was kept consistent with the IP01 polypeptide group in other treatments except without IL4I1 protein. The experimental steps are as follows:

[0137] (1) Re-prepare a 10 μg / mL IL4I1 target protein solution according to the method of the first round of panning by phage display. Take 150 μL of the target solution and add it to 3 wells in a high-adsorption sterile 96-well ELISA plate as the experimental group. At the same time, set up 3 blank control groups and add an equal volume of sterile NaHCO3 solution with a pH of 8.6 and a concentration of 0.1 mol / L. Incubate the ELISA plate overnight in a wet box on a horizontal shaker at 80 rpm at 4 °C.

[0138] (2) The next day, discard the excess target solution in the wells, and pat the ELISA plate face down on a clean paper towel sterilized by ultraviolet light. Wash the ELISA plate 6 times with TBST, and each time pat the plate face down on a clean part of the paper towel. Add 100 μL of TBST solution to each well, and at the same time add 2 μL of the phage stock solution after the selected blue plaque amplification in the third round to each well, and incubate at 4 °C for 2 h.

[0139] (3) After the incubation, wash the plate 6 times with TBST as described above.

[0140] (4) Add 100 μL of M13 antibody diluted with TBS to a final concentration of 0.4 μg / mL to each well and incubate at room temperature for 1 hour.

[0141] (5) Wash the ELISA plate 6 times with TBST solution, add 100 μL of TMB chromogenic solution to each well, and incubate at room temperature in the dark for 30 min.

[0142] (6) Add 50 μL of the termination solution (prepared freshly) and detect the OD value at 450 nm on an ELISA reader.

[0143] (7) Affinity calculation formula: S / P = OD value of the experimental group - OD value of the blank control group, (S is the OD value of the experimental group, P is the OD value of the blank control group). According to the ELISA reader detection results, if the affinity ≥ 2, it indicates that the two have relative affinity. The test results are as Figure 10 shown.

[0144] As Figure 10 can be seen, according to the affinity calculation formula: S / P = OD value of the experimental group - OD value of the blank control group, the affinity of the IP01 polypeptide and the IL4I1 protein > 2, indicating that the IP01 polypeptide can bind to IL4I1.

[0145] 2. MOE molecular docking simulation

[0146] Molecular docking can be used to discover the interactions between receptors and ligands and predict their binding modes and affinities. In this invention, molecular docking simulations were performed on the IL4I1 protein and the targeting peptides screened by phage display to analyze their binding modes. To further understand the interaction mode between the IP01 polypeptide and IL4I1, molecular docking simulations were carried out on IL4I1 (UniProt: Q96RQ9) and the IP01 polypeptide using the MOE software.

[0147] (1) Receptor preparation: Download the crystal structure of the IL4I1 protein from the UniProt database and open it with the MOE software for preprocessing.

[0148] (2) Ligand preparation: Draw the structure of the polypeptide IP01 in Chemdraw 20.0 and export it as an MDL MOLfile (*mol) file.

[0149] (3) Open the ligand file and the receptor protein file with the MOE software, perform docking simulations and analyze the results.

[0150] After calculation, the simulated score S value was -10.9811, which indicates that the polypeptide can form a relatively stable complex with IL4I1. Further observing the two-dimensional interaction diagram, as Figure 11 shown, it was found that the IP01 polypeptide has hydrogen bond interactions with lysine at position 137, glutamate at position 160, arginine at position 261, and glutamate at position 370 of the IL4I1 protein. In addition, the results showed that the N-terminus of the polypeptide is a solvent-exposed region. Therefore, modifications were carried out at this position subsequently.

[0151] Experimental Example Five: Evaluation of the ability of the IL4I1 polypeptide to enter cells

[0152] In this experimental example, the ability of IP01 to enter cells was investigated by laser confocal detection and flow cytometry respectively.

[0153] 1. Laser confocal detection of the ability of the polypeptide to enter cells

[0154] The operation process is as follows: (1) Take a 24-well plate, add 10 μL of culture medium in the middle of the well. Carefully take out a round coverslip with forceps, pass it over the alcohol lamp, and wait for the coverslip to cool naturally before placing it in the 24-well plate. Gently press it with forceps to make it close to the bottom of the 24-well plate, and add 1 mL of cell suspension so that the number of cells per well is about 1.0×10 4cells. (2) After the cells adhered to the wall the next day, add 10 μM of IP01 polypeptide labeled with FITC and incubate for 24 h. After the drug treatment, discard the culture medium, add 1 mL of PBS buffer to each well, and wash 3 times on a shaker at 80 rpm for 5 min each time. (3) Add 4% paraformaldehyde fixative to each well and fix at room temperature for 20 min. After fixation, discard the fixative, add 1 mL of PBS buffer to each well, and wash 5 times on a shaker at 80 rpm for 5 min each time. (4) Cell membrane staining: First, prepare the staining working solution. The DiI staining solution in the DiI cell membrane red fluorescence staining kit: staining enhancer: staining buffer = 1:1:2800. First, mix the DiI dye and the staining enhancer evenly, and then add them to the staining buffer. Add 200 μL of the staining working solution to each well, and incubate at room temperature in the dark on a shaker at 80 rpm for 20 min. After staining, add 1 mL of PBS buffer to each well and wash 5 times for 5 min each time. (5) Nucleus staining: Dilute the DAPI solution with PBS buffer to a final concentration of 1 μg / mL, add 200 μL to each well, and stain at room temperature in the dark for 15 min. After staining, add 1 mL of PBS buffer to each well and wash 5 times for 5 min each time. (6) Sealing the slide: Take a glass slide and label the cell information. Add a drop of anti-fluorescence quenching mounting medium in the middle. Carefully pick up the cell culture slide with forceps and invert the side with cells onto the mounting medium, avoiding the generation of bubbles. Apply a layer of nail polish around the slide to fix it on the glass slide, and pay attention to keep it in the dark throughout the process. (7) After the nail polish has solidified naturally, take pictures with a laser confocal microscope in a timely manner. If you cannot take pictures in a timely manner, the slides can be stored in the dark at 4 °C in the refrigerator for one week. The test results are as Figure 12 shown.

[0155] As Figure 12 can be seen, in two different gastric cancer cell lines, MKN45 ( Figure 12 A) and MKN1 ( Figure 12 B), the IP01 polypeptide has certain cell membrane penetration ability.

[0156] 2. Detection of the ability of the polypeptide to enter cells by flow cytometry

[0157] The operation process is as follows: (1) Take a six-well plate and add 2 mL of cell suspension so that the number of cells in each well is about 2.0×10 5After the cells adhered to the wall the next day, 4 μM and 10 μM of IP01 polypeptide labeled with FITC were added respectively and the cells were treated for 24 h. (2) After the polypeptide treatment, the culture medium was discarded, and the cells were washed once with PBS buffer. 200 μL of trypsin without EDTA was added to each well and placed in an incubator at 37 °C for digestion for 3 min. After digestion, 1 mL of culture medium was added to each well to terminate the digestion. The cell suspension was transferred to a 1.5 mL EP tube, centrifuged at 1000 g for 5 min, the supernatant was discarded, and the cells were washed once with 1 mL of PBS buffer and centrifuged again to discard the supernatant. (3) The precipitate was resuspended with 300 μL of PBS buffer and filtered through a sieve into a flow cytometry tube, and the analysis was performed on a flow cytometer. The results were analyzed using Flowjo. The test results are as Figure 13 shown.

[0158] As Figure 13 can be seen, IP01 polypeptide has strong cell-penetrating ability in different gastric cancer cells and shows concentration dependence. Among them, the cell-penetrating ability in MKN45 cells is the strongest. At a concentration of 10 μM, approximately 81% of the positive cells contain the fluorescence of the polypeptide ( Figure 13 A). The cell-penetrating ability in MKN1 cells is the second strongest. At a concentration of 10 μM, the proportion of positive cells is 76% ( Figure 13 B). This shows that IP01 polypeptide has good membrane permeability at a concentration of 10 μM.

[0159] Experimental Example VI: Detection of IP01 Targeting

[0160] In this experimental example, immunofluorescence assay (IF) and immunoprecipitation assay (IP) were respectively performed to investigate the targeting of IP01.

[0161] (1) Immunofluorescence assay

[0162] The operation process was as follows: (1) A drop of culture medium was added to the center of each well of a 24-well plate. A round coverslip was carefully taken out with forceps sterilized under an ultraviolet lamp, passed over a Bunsen burner, and placed in the 24-well plate. It was gently pressed to tightly adhere to the bottom of the 24-well plate. The number of cells in each well was approximately 2.0×10 5After the cells adhered to the wall, add IP01 polypeptide labeled with FITC and incubate for 24 h. (2) After the polypeptide incubation, discard the culture medium, and wash each well 3 times with PBS buffer. (3) Add 4% paraformaldehyde to each well and fix for 20 min. After fixation, discard the paraformaldehyde, add PBS buffer and wash 3 times, 5 min each time. (4) Add 0.1% Triton X-100 solution to each well and incubate at room temperature for 15 min to permeabilize the cell membrane. After permeabilization, wash with PBS buffer 3 times, 5 min each time. (5) Add 5% BSA solution to each well and block at room temperature for 1 h. After blocking, wash with PBS buffer 2 times, 5 min each time. (6) Dilute the IL4I1 antibody with PBS at a ratio of 1:50, add 200 μL of the diluted primary antibody solution to each well, and incubate overnight in a refrigerator at 4 °C. The next day, recover the primary antibody, wash each well 5 times with PBS buffer, 5 min each time. Add red goat anti-rabbit fluorescent secondary antibody diluted with PBS at a ratio of 1:800, and incubate in the dark at room temperature for 2 h. After incubation, wash with PBS buffer 5 times, 5 min each time. (7) Nuclear staining: Dilute the DAPI solution with PBS buffer to a final concentration of 1 μg / mL, add 200 μL to each well, and stain in the dark at room temperature for 15 min. After staining, add 1 mL of PBS buffer to each well and wash 5 times, 5 min each time. (8) Mounting: Take a glass slide and label the cell information, add a drop of anti-fluorescence quenching mounting medium in the middle, carefully pick out the cell culture slide with forceps, invert the side with cells onto the mounting medium, avoid generating bubbles, and apply a layer of nail polish around the slide to fix it on the glass slide, pay attention to avoid light throughout the process. (9) After the nail polish solidifies naturally, take a laser confocal microscopy image in time. If it is not possible to take a picture in time, the slide can be stored in a refrigerator at 4 °C in the dark for one week. The test results are as Figure 14 shown in Figures A and 14B.

[0163] shown Figure 14 in Figures A and 14B, IL4I1 and IP01 polypeptide are co-localized.

[0164] (2) Immunoprecipitation experiment

[0165] The operation process is as follows: (1) Take 50 μL of anti-FITC magnetic beads, wash them three times with PBS, and use a magnetic stand for magnetic separation to wash the magnetic bead protective solution. (2) Add 10 μM of the polypeptide with FITC label, incubate on a shaker at room temperature for two hours to conjugate the polypeptide to the anti-FITC magnetic beads for subsequent target protein capture. After incubation, discard the supernatant and wash the magnetic beads 3 times with PBS to remove the unbound polypeptide. (3) Add the total cell protein lysate solution, incubate on a shaker at 4 °C overnight, discard the supernatant, and wash the magnetic beads 3 times with PBS to remove the unbound protein. (4) Add 6× Loading buffer for denaturation, and use Western blot to analyze the experimental results. The test results are shown in Figures 14C and 14D.

[0166] As can be seen from Figure 14 Figures 14C and 14D, the IP01 polypeptide has targeting specificity for IL4I1 at the cellular level.

[0167] Experimental Example VII: Design and Synthesis of IL4I1 Polypeptide-PROTAC

[0168] Using the polypeptide IP01 as the ligand for the IL4I1 target protein, connect the E3 ligand through a linker to design and synthesize IL4I1 p-PROTAC. According to the MOE molecular docking simulation results, it is determined that the N-terminus of the polypeptide is the modification position for connecting the linker. After determining the connection position of the linker, in the present invention, the small molecule CRBN and the polypeptide Keap1 are used as E3 ligands respectively to design and synthesize two p-PROTACs, named C1 and K1 respectively, to investigate the degradation effects of different polypeptide-PROTACs on IL4I1.

[0169] In order to improve the cell entry efficiency of the polypeptide, the present invention selects to connect a TAT transmembrane peptide with the sequence of RKKRRQRRR at the E3 ligase. Since there is no extra amino group at the N-terminus of the polypeptide IP01, therefore, the present invention adds a lysine as a linker at the C-terminus of the transmembrane peptide, and connects the small molecule CRBN E3 ligand through the pomalidomide-PEG2 chain it contains to the extra amino group of this lysine. The specific sequences and structural schematic diagrams of the finally constructed C1 and K1 are as Figure 15 shown.

[0170] Figure 15 In, the structural sequence of C1 is RKKRRQRRR-K(pomalidomide-PEG2)-DHSDWAYWFSDP( Figure 15As shown in Figure A, that is, the IL4I1 polypeptide-protein degradation targeting chimera (IL4I1 polypeptide-PROTAC) of Example 2 of the present invention. The structure of K1 is RKKRRQRRR-LDPETGEYL-GSGS-DHSDWAYWFSDP( Figure 15 As shown in Figure B. C1 and K1 were synthesized by Shanghai Chutai Biotechnology Co., Ltd. for subsequent experiments.

[0171] Experimental Example VIII: Degradation of IL4I1 in gastric cancer cells induced by IL4I1 polypeptide-PROTAC

[0172] 1. Concentration-dependent degradation of IL4I1 by IL4I1 polypeptide-PROTAC

[0173] First, the degradation activity of the above-synthesized C1 (IL4I1 polypeptide-PROTAC) was evaluated, and the results are as Figure 16 shown. As Figure 16 shown in Figures A and 16B, within the concentration range of 0-40 μM, the degradation of intracellular IL4I1 protein in gastric cancer cells MKN45 and MKN1 by C1 was concentration-dependent, and the degradation effect enhanced with the increase in concentration. The quantitative results are as Figure 16 shown in Figures C and 16D, indicating that the degradation of IL4I1 in gastric cancer cells by C1 was concentration-dependent and time-dependent.

[0174] Next, the degradation activity of K1 was evaluated. As Figure 16 shown in Figures E and 16F, within the concentration range of 0-40 μM, K1 could not degrade the intracellular IL4I1 protein in gastric cancer cells MKN45 and MKN1, so only C1 (IL4I1 polypeptide-PROTAC) was used for subsequent research.

[0175] 2. Time-dependent degradation of IL4I1 by IL4I1 polypeptide-PROTAC

[0176] The present invention has screened that C1 (IL4I1 polypeptide-PROTAC) has degradation activity against IL4I1. Next, Western blot was used to detect the degradation effect of C1 on IL4I1 at a concentration of 10 μM. The results are as Figure 17 shown.

[0177] Figure 17 In Figure, as Figure 17 shown in Figures A and 17B, time-dependent degradation occurred in MKN45 and MKN1 cells. The quantitative results are as Figure 17 shown in Figures C and 17D. In MKN45 cells, the degradation effect weakened at 48 hours, probably because the degradation agent was metabolized due to too long time. Therefore, the degradation of IL4I1 in gastric cancer cells by C1 was time-dependent.

[0178] Experimental Example IX: Ferroptosis of Gastric Cancer Cells Induced by IL4I1 Polypeptide-PROTAC

[0179] In this experiment, a lipid reactive oxygen species detection kit was used for detection. C11 BODIPY581 / 591 is an oxidation-sensitive fluorescent fatty acid analogue with an emission peak of 595 nm. C11 BODIPY581 / 591 is easily incorporated into the membrane and exhibits red fluorescence in the intact state, but turns green upon free radical-induced oxidation. The specific operation method is as follows:

[0180] 1. Preparation of Staining Solution

[0181] (1) Preparation of stock solution: Dissolve C11 BODIPY 581 / 591 in DMSO to prepare a stock solution with a concentration of 1-10 mM. After aliquoting, store it at -20°C in the dark and avoid repeated freezing and thawing. (2) Preparation of working solution: Dilute the stock solution with sterile PBS when in use to prepare a working solution with a concentration of 1-10 μM. Prepare it freshly before use.

[0182] 2. Cell Staining

[0183] (1) Take a six-well plate, add 2 mL of cell suspension so that the number of cells per well is approximately 2.0×10 5 cells. After adding PROTAC and Fer-1 inhibitor for treatment, collect the cells. Wash the cells twice with PBS, add trypsin to digest the cells, and centrifuge at 400 g for 5 min after digestion is complete. (2) Resuspend the cells with 1 mL of C11 BODIPY 581 / 591 working solution and incubate at 37°C in the dark for 30 min. After incubation, centrifuge at 400 g for 5 min using a 4°C ultra-low temperature centrifuge, remove the supernatant, add 1 mL of PBS and wash twice, 5 min each time. (3) Resuspend the cell pellet with 300 μL of PBS and filter it through a sieve into a flow tube.

[0184] 3. Flow Cytometry Detection

[0185] Use a flow cytometer for detection and analyze the flow results with Flowjo. The results are as Figure 18 shown.

[0186] As Figure 18 can be seen, C1 can cause an increase in intracellular lipid ROS and induce ferroptosis of cells. As Figure 18 shown in Figures A and 18B, under the action of 10 μM p-PROTAC, the positive proportion of lipid ROS in MKN45 cells increased from 35.9% in the control group to 81.7%. As Figure 18 shown in Figures C and 18D, in MKN1 cells, it increased from 27% to 52%. As Figure 18As shown in Figures E and 18F, in gastric cancer cells MKN45 and MKN1, Western blot showed that the expression of ferroptosis-related marker proteins GPX4 and SLC7A11 was downregulated after using PROTAC. After using the inhibitor Fer-1, the downregulation trend was reversed, indicating again that C1 (IL4I1 polypeptide-PROTAC) could induce ferroptosis in gastric cancer cells.

[0187] In summary, the polypeptide targeting IL4I1 provided by the present invention is a high-affinity binding polypeptide targeting IL4I1 screened by phage display technology. It not only has good cell membrane permeability but also has excellent targeting to IL4I1 intracellularly. Further, the IL4I1 polypeptide-protein degradation targeted chimera constructed using this polypeptide targeting IL4I1 can not only efficiently degrade highly expressed IL4I1 in tumor cells but also induce ferroptosis in gastric cancer cells by degrading intracellular IL4I1 to hinder the malignant development of gastric cancer. Therefore, it can provide a new solution with precision, long-term efficacy, and immune regulation function for the treatment of gastric cancer.

[0188] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A polypeptide targeting IL4I1, characterized in that, The amino acid sequence of the polypeptide targeting IL4I1 is shown as SEQ ID No.

1.

2. Use of a polypeptide targeting IL4I1 as described in claim 1, characterized in that, Use in the preparation of anti-tumor drugs.

3. Use of the polypeptide targeting IL4I1 according to claim 2, characterized in that, The anti-tumor drug is an anti-gastric cancer drug.

4. An IL4I1 polypeptide-protein degradation targeting chimera, characterized in that, The IL4I1 polypeptide-protein degradation targeting chimera is mainly constructed from a polypeptide targeting IL4I1, an E3 ubiquitin ligase ligand, a cell-penetrating peptide, and a linker; the amino acid sequence of the polypeptide targeting IL4I1 is shown as SEQ ID No.

1.

5. The IL4I1 polypeptide-protein degradation targeting chimera according to claim 4, wherein The E3 ubiquitin ligase ligand is a Cereblon ligand.

6. The IL4I1 polypeptide-protein degradation targeting chimera according to claim 5, wherein The Cereblon ligand is pomalidomide-PEG2.

7. The IL4I1 polypeptide-protein degradation targeting chimera according to claim 4, characterized in that, The linker is lysine.

8. The IL4I1 polypeptide-protein degradation targeting chimera according to claim 4, characterized in that, The amino acid sequence of the cell-penetrating peptide is shown as SEQ ID No.

2.

9. Use of an IL4I1 polypeptide-protein degradation targeting chimera as described in any one of claims 4 to 8, characterized in that, Use in the preparation of anti-tumor drugs.

10. Use of the IL4I1 polypeptide-protein degradation targeting chimera according to claim 9, characterized in that, The anti-tumor drug is an anti-gastric cancer drug.

Images