Rice purple acid phosphatase OsPAP16 and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and provides rice purple acid phosphatase OsPAP16 and application thereof, and the application is that a rice purple acid phosphatase OsPAP16 mutant is applied to rice cultivation. Two OsPAP16 mutants are prepared by adopting a gene editing technology, then the mutants are subjected to overexpression induction, and the result shows that the purple acid phosphatase OsPAP16 is positioned on a cell membrane, the OsPAP16 is subjected to phosphorus deficiency induced expression on leaves and roots, the phosphorus deficiency induced expression at the roots is quicker and higher, the overexpression of the OsPAP16 can improve the activity of the acid phosphatase on the root surface, and the yield of the acid phosphatase on the root surface is increased. Phosphorus deficiency stress of the rice can be relieved by degrading organic phosphorus in the environment, the phosphorus content of the rice is increased, and then growth and development of the rice are promoted.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to rice purple acid phosphatase OsPAP16, specifically to rice purple acid phosphatase OsPAP16 and its applications. Background Technology

[0002] Phosphorus is one of the essential macronutrients for plant growth and development. Most phosphorus in the soil exists in the form of organic phosphorus or fixed inorganic phosphorus, while the amount of water-soluble inorganic phosphorus that plants can directly absorb and utilize is far from sufficient to meet their normal growth and development needs. Therefore, plants have evolved various physiological and biochemical mechanisms to adapt to phosphorus-deficient environments. Phosphorus deficiency induces plants to synthesize acid phosphatases and secrete them into the environment or cell walls, degrading organic phosphorus and releasing inorganic phosphorus for plant absorption and utilization. Purple acid phosphatases (PAPs) are the largest class of acid phosphatases, and some PAP genes involved in the degradation of organic phosphorus have been cloned in crops such as rice and soybeans. The applicant's team previously used proteomics analysis to screen a secretory purple acid phosphatase, OsPAP16, from rice suspension cells that is significantly induced by phosphorus deficiency (Du et al., 2022). By creating OsPAP16 mutants and overexpression materials, preliminary analysis of acid phosphatase activity and phosphorus content was conducted, elucidating the function of OsPAP16 in rice's adaptation to phosphorus deficiency stress, and providing genetic resources for breeding phosphorus-efficient crop varieties. Summary of the Invention

[0003] The purpose of this invention is to provide rice purple acid phosphatase OsPAP16 expressed in response to phosphorus deficiency and its application. Overexpression of OsPAP16 can increase the activity of acid phosphatase on the root surface of rice and the phosphorus content in rice, and can be used as a target gene to cultivate phosphorus-efficient crop varieties.

[0004] To achieve the above objectives, the technical solution of the present invention is as follows:

[0005] This invention provides a gRNA of rice purple acid phosphatase OsPAP16, the gRNA sequence of which is GTTCTCGCCGTAATGCAGGTCGG.

[0006] This invention also provides a method for constructing a rice purple acid phosphatase OsPAP16 mutant, specifically including the following steps:

[0007] a. Design the gRNA of OsPAP16 as described in claim 1;

[0008] b. Use PCR to anneal the primers to form a double strand of DNA;

[0009] c. The vector pRGEB31 was recovered after being digested with BsaⅠ enzyme, and the vector pRGEB31 and the DNA double strand were ligated using T4 ligase;

[0010] d. The ligation product obtained in step c. was transformed into E. coli DH5α, and after identification, two OsPAP16 mutants with different editing types were obtained;

[0011] The identification method is sequencing identification, including sequencing primers.

[0012] OsPAP16-seq-PF: ATCATTTGCAGCCACCAGC and OsPAP16-seq-PR: GAGAGAACCACTCAGGAGGC.

[0013] Preferably, the PCR annealing system is as follows: 1 µL of 100 µM upstream primer, 1 µL of 100 µM downstream primer, 1 µL of 10×T4 DNA ligase buffer, and 7 µL of ddH2O; the upstream primer is OsPAP16-gRNA-PF: GGCATGCATTACGGCGAGAACGCC, and the downstream primer is OsPAP16-gRNA-PR: AAACGGCGTTCTCGCCGTAATGCA; the PCR program is as follows: hold at 37℃ for 60 min, hold at 95℃ for 10 min, and cycle down to 25℃ at -0.1℃ / sec.

[0014] This invention also provides a method for constructing an overexpression of the rice purple acid phosphatase OsPAP16 mutant, specifically including the following steps: using the cDNA of rice Zhonghua 11 as a template, the CDS sequence of OsPAP16 is amplified by PCR, ligated to the linearized vector pc1300::3x flag using a seamless cloning kit, transformed into Escherichia coli DH5α strain using the heat shock method, positive clones are selected for PCR verification, the verified positive clones are sequenced, and the plasmid with the correct alignment is transformed into Agrobacterium tumefaciens EHA105 for later use.

[0015] Preferably, the PCR amplification includes two primers: OsPAP16-OE-PF:gcccgggggatccactagttctagaGCCGGGATGCGGTGCTGG and OsPAP16-OE-PR:aaagctctgcaggtcgacttctagaCAAGTCTAGGAGCTCAAGC.

[0016] The present invention also provides the application of the above-mentioned gRNA in rice growth.

[0017] The present invention also provides the application of the above-mentioned gRNA in the construction of a mutant vector for the rice purple acid phosphatase OsPAP16 gene.

[0018] The present invention also provides a mutant vector of the purple acid phosphatase OsPAP16 gene obtained by the above construction method.

[0019] The present invention also provides a mutant vector for overexpressing the purple acid phosphatase OsPAP16 gene obtained by the above construction method.

[0020] The present invention also provides the application of the above-mentioned purple acid phosphatase OsPAP16 gene mutant vector and / or the above-mentioned overexpression of purple acid phosphatase OsPAP16 gene mutant vector in rice growth.

[0021] The beneficial effects of this invention are:

[0022] This invention uses gene editing technology to prepare two OsPAP16 mutants and induces their overexpression. The results show that overexpression of OsPAP16 can increase the activity of acid phosphatase in the root surface of rice, which can alleviate phosphorus deficiency stress in rice by degrading organic phosphorus in the environment, increase the phosphorus content of rice, and thus promote the growth and development of rice. Attached Figure Description

[0023] Figure 1 This invention represents the relative expression levels of the purple acid phosphatase OsPAP16 gene at different phosphorus deficiency time points and after phosphorus restoration (A represents the RNA sampling time points corresponding to different phosphorus deficiency time points and phosphorus restoration time points in rice; B represents the relative expression levels of OsPAP16 in leaves and roots).

[0024] Figure 2 This invention shows the subcellular localization of the purple acid phosphatase OsPAP16 protein in tobacco leaves (A is the localization diagram of OsPAP16::GFP and cell membrane marker AtPIP2A::mCherry co-injected into tobacco; B is the localization diagram after plasmolysis with 1 M mannitol).

[0025] Figure 3 This invention relates to the identification of the mutant editing type of OsPAP16 and the transgenic material in the embodiments of the present invention (A represents the mutant editing type, pap16-1 represents the deletion of 40 bases, and pap16-2 represents the deletion of 1 base; B represents the relative expression level of OsPAP16 in the transgenic material).

[0026] Figure 4 The results of the root surface acid phosphatase activity assay in the OsPAP16 mutant and overexpression material under normal phosphorus (+P) and phosphorus deficiency (-P) conditions in this invention are as follows (*P<0.05, intergroup comparison).

[0027] Figure 5 The total phosphorus concentrations in the aboveground parts and roots of the OsPAP16 mutant and overexpression material in this invention under normal phosphorus (+P) and phosphorus deficiency (-P) conditions (A is the total phosphorus concentration in the aboveground parts; B is the total phosphorus concentration in the roots; *P<0.05, **P<0.01, intergroup comparison). Detailed Implementation

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0029] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0031] Example 1: Expression pattern analysis of OsPAP16 in response to phosphorus deficiency stress

[0032] Using wild-type rice Nipponbare as material, the rice was first cultured in normal nutrient solution for 10 days, then subjected to phosphorus-deficient culture for 21 days, and finally cultured in normal phosphorus solution for 2 days. Figure 1 As shown in Figure A, leaves and roots were collected on day 10 of normal culture (designated as day 0), days 1, 3, 5, 7, 10, 15, and 21 of phosphorus-deficient culture (designated as days 1, 3, 5, 7, 10, 15, and 21), and days 1 and 2 of restored phosphorus supply (designated as days R1 and R2). RNA was extracted using an RNA extraction kit (Kangwei), and 1 μg of RNA was synthesized into cDNA using a reverse transcription kit (Kangwei). The cDNA template was diluted 5-fold, and the reaction system was prepared according to the instructions of the real-time PCR kit (Yisheng) for quantitative PCR (Applied Biosystems QuantStudio™ 6 Flex System). 2 -ΔΔCT The relative expression level of OsPAP16 was calculated using the method described above.

[0033] The PCR system is as follows:

[0034]

[0035] The PCR procedure is as follows:

[0036] Pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 10 sec, annealing at 60℃ for 20 sec, extension at 72℃ for 20 sec, for 40 cycles; melting curves were obtained at 95℃ for 15 sec, 60℃ for 1 min, and 95℃ for 15 sec.

[0037] like Figure 1 As shown in Figure B, the expression level of OsPAP16 in roots was higher than that in leaves. After 15 days of phosphorus deficiency, the expression level of OsPAP16 in leaves began to increase, and with the extension of phosphorus deficiency time, the phosphorus-induced expression level increased further. Once phosphorus supply was restored, the expression level immediately decreased. However, after 7 days of phosphorus deficiency, the expression level of OsPAP16 in roots began to increase, and the expression level gradually increased with the extension of phosphorus deficiency time, before significantly decreasing after the restoration of phosphorus supply. This indicates that OsPAP16 expression is induced by phosphorus deficiency in both leaves and roots, with a faster and higher response in roots.

[0038] Example 2 Subcellular localization analysis of OsPAP16 protein

[0039] Vector construction: Using cDNA from rice Zhonghua 11 as a template, the CDS sequence of OsPAP16 was amplified by PCR and ligated to the linearized vector 35S::GFP using a seamless cloning kit (ABclonal) to construct the vector 35S::OsPAP16-GFP, which is fused to the C-terminus of GFP. This vector was then transformed into *E. coli* DH5α strain using the heat shock method. Positive clones were selected for PCR verification, and the verified positive clones were sequenced. Plasmids that confirmed the correct alignment were then transformed into *Agrobacterium* GV3101 for later use.

[0040] Transient expression in tobacco: Host bacteria expressing the target gene were streaked and isolated. Single clones were inoculated into kanamycin- and gentamicin-resistant YEP medium and cultured overnight. The overnight culture was then inoculated into 10 mL of YEP medium (containing 10 mM MES, 20 μM AS) and cultured at 28°C and 200 rpm until OD600 = 1.0. The cells were collected by centrifugation at 4000 rpm for 10 min and resuspended in a resuspension solution (10 mM MES, 10 mM MgCl2, 200 μM AS) until OD600 = 0.8-1.0, and allowed to stand for at least 3 h. Before injection, an equal volume of OsPAP16::GFP and cell membrane marker AtPIP2A::mCherry resuspension solution was mixed. The syringe was de-needled, the resuspension solution was drawn into the syringe, and the bacterial solution was injected from the underside of the tobacco leaf by pressing the upper surface with a finger. After tobacco continued to grow for 2-3 days under normal conditions, the fluorescence in the leaf epidermal cells was observed using a laser confocal microscope (Leica). The excitation / emission wavelengths of GFP were 488 nm / 505-545 nm, and the excitation / emission wavelengths of mCherry were 552 nm / 580-645 nm.

[0041] The results are as follows Figure 2 As shown, the green fluorescence of OsPAP16::GFP overlaps with the red fluorescence of the cell membrane marker AtPIP2A::mCherry ( Figure 2 A). As shown, after plasmolysis with 1 M mannitol, the green and red fluorescence still overlapped ( Figure 2 B), indicating that OsPAP6 is located on the cell membrane.

[0042] The primers for constructing the subcellular localization vector of OsPAP16 are as follows, where lowercase letters represent homologous arms of the backbone vector:

[0043] OsPAP16-GFP-PF: gacacggaattctctagaGCCGGGATGCGGTGCTGG;

[0044] OsPAP16-GFP-PR:gttcttctcctttactcattctagaGGAGCTCAAGCTAATATC.

[0045] Example 3 Creation of OsPAP16 mutants and overexpression materials

[0046] Mutant Material Creation: OsPAP16 edited material was created using gene editing technology. First, the gRNA of OsPAP16 was designed using the website (http: / / www.genome.arizona.edu / crispr / ). Primers were annealed to form double-stranded DNA using a PCR instrument. The PCR system consisted of 1 µL of 100 µM upstream primer, 1 µL of 100 µM downstream primer, 1 µL of 10× T4 DNA ligase buffer, and 7 µL of ddH2O. The PCR program was: 37℃ for 60 min, 95℃ for 10 min, then decreasing to 25℃ at a rate of 0.1℃ / sec. The sample was diluted 1:200 and stored at 4℃. The vector pRGEB31 was recovered after digestion with BsaI and ligated to the linear vector and double-stranded DNA using T4 ligase. The ligation product was then transformed into *E. coli* DH5α. Plasmids that were correctly sequenced were transformed into *Agrobacterium* EHA105. Genetic transformation of rice was carried out using Agrobacterium-mediated transgenic technology. The transgenic materials obtained were subjected to molecular detection. The target segment of gRNA was amplified using OsPAP16-specific primers and sequenced. Gene-edited materials were screened and propagated to obtain homozygotes.

[0047] The gRNA sequence is GTTCTCGCCGTAATGCAGGTCGG.

[0048] Vector construction primers OsPAP16-gRNA-PF: GGCATGCATTACGGCGAGAACGCC;

[0049] OsPAP16-gRNA-PR:AAACGGCGTTCTCGCCGTAATGCA.

[0050] Mutant identification sequencing primers: OsPAP16-seq-PF: ATCATTTGCAGCCACCAGC;

[0051] OsPAP16-seq-PR:GAGAGAACCACTCAGGAGGC.

[0052] Creation of overexpression materials: Using cDNA from rice Zhonghua 11 as a template, the CDS sequence of OsPAP16 was amplified by PCR and ligated into the linearized vector pc1300::3x flag using a seamless cloning kit (ABclonal). The resulting material was then transformed into *E. coli* DH5α strain using the heat shock method. Positive clones were selected for PCR verification, and the verified positive clones were sequenced. Plasmids with correct alignment were transformed into *Agrobacterium* EHA105 for later use. Genetic transformation of rice was performed using *Agrobacterium*-mediated transgenic technology. Molecular analysis was performed on the obtained transgenic materials, and RNA was extracted from the transgenic materials to identify the expression level of OsPAP16. Homozygous individuals were obtained through multiple generations of propagation.

[0053] The primers for constructing the OsPAP16 overexpression vector are as follows, where lowercase letters represent homologous arms of the backbone vector:

[0054] OsPAP16-OE-PF: gcccgggggatccactagttctagaGCCGGGATGCGGTGCTGG;

[0055] OsPAP16-OE-PR:aaagctctgcaggtcgacttctagaCAAGTCTAGGAGCTCAAGC.

[0056] Identification of mutants and overexpression materials: such as Figure 3 As shown in Figure A, sequencing and alignment revealed two different OsPAP16 mutants: pap16-1, which deleted 40 bases, and pap16-2, which deleted 1 base. Both mutants resulted in premature termination of protein translation. Figure 3 As shown in B, the expression levels of OsPAP16 in all three overexpression lines were higher than those in the wild-type ZH11.

[0057] Example 4: Analysis of root surface acid phosphatase activity in OsPAP16 mutants and overexpression materials

[0058] To verify whether OsPAP16 is secreted extracellularly, the acid phosphatase activity of the root surface of mutants and overexpression materials was measured under normal phosphorus and phosphorus-deficient conditions. Rice seeds were cultured in normal nutrient solution for 10 days after germination, followed by normal phosphorus (+P) and phosphorus-deficient (-P) treatments for 15 days. The roots were then rapidly rinsed with distilled water, and the seedlings were transferred to 30 mL of rice culture medium containing 10 mM pNPP (pH 5.5). A blank sample was prepared without plant samples. The reaction was carried out at 30℃ for 30 min. 370 µL of the reaction solution was then added to 1.66 mL of 1 M NaOH to terminate the reaction, and the OD410 absorbance was measured. After the measurement, the root weight was recorded. The root surface acid phosphatase activity was calculated based on the pNP standard curve.

[0059] The results are as follows Figure 4 As shown in P<0.05, compared with normal phosphorus conditions, the root surface acid phosphatase activity of wild-type, mutant, and overexpression materials was increased under phosphorus-deficient conditions. Under normal and phosphorus-deficient conditions, there was no significant difference in root surface acid phosphatase activity between mutants and wild-type, while the activity of overexpression was significantly higher than that of wild-type. This indicates that overexpression of OsPAP16 can increase root surface acid phosphatase activity, alleviating phosphorus deficiency stress in rice by degrading organic phosphorus in the environment.

[0060] Example 5: Total Phosphorus Concentration Analysis of OsPAP16 Mutant and Overexpression Material

[0061] To verify whether OsPAP16 affects phosphorus content in rice, the total phosphorus concentration in the aboveground parts and roots of mutants and overexpression materials was measured under normal phosphorus and phosphorus-deficient conditions. Rice seeds were cultured in normal nutrient solution for 10 days after germination, followed by normal phosphorus (+P) and phosphorus-deficient (-P) treatments for 15 days. The roots were washed three times with distilled water, dried, and then samples from the aboveground parts and roots were collected, bagged, and dried at 60℃ to constant weight. The samples were ground, and 150 mg of the sample was placed in a digestion tube. 1 mL of concentrated sulfuric acid was added, and the mixture was left to stand overnight. The digestion tube was heated at 120℃ for 1 h, and 3-4 drops of 30% H2O2 were added. Digestion continued for 30 min, followed by the addition of another 3-4 drops of 30% H2O2. This process was repeated until the digestion solution became clear, and finally, digestion continued for approximately 1 h to completely decompose the H2O2. After the digestion solution cools, add pure water to 1-2 cm below the graduation mark. Cool to room temperature, then dilute to volume and mix well. Filter through filter paper into a 10 mL centrifuge tube for later use. Dilute the digestion solution a certain factor. Take 1 mL of the diluted solution into a 10 mL centrifuge tube, add one drop of 2,4-dinitrophenol indicator, add 4 M NaOH solution until it turns yellow, then add 2 M H₂SO₄ until it becomes colorless. Add pure water to the 7-8 mL graduation mark, add 1 mL of molybdenum antimony reagent, and dilute to 10 mL. Mix well and incubate at 30℃ for 30 min. Measure the OD700 absorbance using a microplate reader. Calculate the total phosphorus concentration of the sample based on the KH₂PO₄ standard curve.

[0062] The results are as follows Figure 5 As shown, under normal phosphorus and phosphorus-deficient conditions, there was no significant difference in the total phosphorus content of the aboveground parts of wild-type and mutants. However, under normal phosphorus conditions, the total phosphorus content of the aboveground parts of overexpression materials OE4 and OE29 was significantly higher than that of wild-type, while under phosphorus-deficient conditions, the total phosphorus content of the aboveground parts of OE4 was significantly higher than that of wild-type. Figure 5 A, P<0.05, P<0.01. Under phosphorus deficiency conditions, the total phosphorus content in the roots of OE4 was significantly higher than that of the wild type ( Figure 5 B, P<0.05). This indicates that overexpression of OsPAP16 increases the phosphorus content in rice.

[0063] In summary, this invention has found that the purple acid phosphatase OsPAP16 is located in the cell membrane. OsPAP16 is induced to express in both leaves and roots by phosphorus deficiency. In roots, the expression of OsPAP16 is faster and higher in response to phosphorus deficiency. Overexpression of OsPAP16 can increase the activity of root surface acid phosphatase, which can alleviate phosphorus deficiency stress in rice by degrading organic phosphorus in the environment, increase the phosphorus content of rice, and thus promote the growth and development of rice.

[0064] The above-described embodiments are merely preferred embodiments of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.

Claims

1. A gRNA of rice purple acid phosphatase OsPAP16, characterized in that, The gRNA sequence is GTTCTCGCCGTAATGCAGGTCGG.

2. A method for constructing a rice purple acid phosphatase OsPAP16 mutant, characterized in that, Specifically, the following steps are included: a. Design the gRNA of OsPAP16 as described in claim 1; b. Use PCR to anneal the primers to form a double strand of DNA; c. The vector pRGEB31 was recovered after being digested with BsaⅠ enzyme, and the vector pRGEB31 and the DNA double strand were ligated using T4 ligase; d. The ligation product obtained in step c. was transformed into E. coli DH5α, and after identification, two OsPAP16 mutants with different editing types were obtained; The identification method is sequencing identification, including sequencing primers. OsPAP16-seq-PF: ATCATTTGCAGCCACCAGC and OsPAP16-seq-PR: GAGAGAACCACTCAGGAGGC.

3. The construction method according to claim 2, characterized in that, The annealing system for the PCR was as follows: 1 µL of 100 µM upstream primer, 1 µL of 100 µM downstream primer, 1 µL of 10× T4 DNA ligase buffer, and 7 µL of ddH2O. The upstream primer was OsPAP16-gRNA-PF: GGCATGCATTACGGCGAGAACGCC, and the downstream primer was OsPAP16-gRNA-PR: AAACGGCGTTCTCGCCGTAATGCA. The PCR program was as follows: 37℃ for 60 min, 95℃ for 10 min, and then cycled down to 25℃ at a rate of -0.1℃ / sec.

4. A method for constructing a mutant of rice purple acid phosphatase OsPAP16 overexpression, characterized in that, Specifically, the following steps are included: Using cDNA from rice Zhonghua 11 as a template, the CDS sequence of OsPAP16 was amplified by PCR, ligated to the linearized vector pc1300::3x flag using a seamless cloning kit, and transformed into Escherichia coli DH5α strain using the heat shock method. Positive clones were selected for PCR verification, and the verified positive clones were sequenced. The plasmids that were correctly matched were then transformed into Agrobacterium tumefaciens EHA105 for later use.

5. The construction method according to claim 4, characterized in that, The PCR amplification included two primers: OsPAP16-OE-PF:gcccgggggatccactagttctagaGCCGGGATGCGGTGCTGG and OsPAP16-OE-PR:aaagctctgcaggtcgacttctagaCAAGTCTAGGAGCTCAAGC.

6. The application of gRNA in rice growth as described in claim 1.

7. The application of the gRNA as described in claim 1 in the construction of the mutant vector for the rice purple acid phosphatase OsPAP16 gene.

8. The purple acid phosphatase OsPAP16 gene mutant vector obtained by any one of the construction methods described in claims 2-3.

9. The overexpression vector of the purple acid phosphatase OsPAP16 gene mutant obtained by any one of the construction methods of claims 4-5.

10. The application of the purple acid phosphatase OsPAP16 gene mutant vector as described in claim 8 and / or the overexpression purple acid phosphatase OsPAP16 gene mutant vector as described in claim 9 in rice growth.

Images