Rhodococcus equi antigen protein, recombinant expression vector, recombinant protein, subunit vaccine and preparation method

Abstract

The embodiment of the invention discloses a rhodococcus equi antigen protein, a recombinant expression vector, a recombinant protein, a subunit vaccine and a preparation method. The coding gene sequence of the rhodococcus antigen protein VapA is as shown in SEQ ID NO: 001, and the coding gene sequence of the rhodococcus antigen protein VapG is as shown in SEQ ID NO: 002; the recombinant expression vector contains a coding gene of the rhodococcus equi antigen protein VapA or VapG; the recombinant expression vector pPICZ [alpha] A-VapA or the recombinant expression vector pPICZ [alpha] A-VapG is constructed by respectively cloning a coding gene of a rhodococcus equi antigen protein VapA or VapG into a pichia pastoris expression vector pPICZ [alpha] A; the recombinant expression vector pPICZ alpha A-VapA or pPICZ alpha A-VapG is further subjected to transformation, amplification, induced expression and purification to respectively obtain recombinant proteins VapA and VapG, and the Rhodococcus equi subunit vaccine prepared from the recombinant proteins VapA and / or VapG has a good prevention effect on Rhodococcus equi infection.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to Rhodococcus equi antigen protein, recombinant expression vector, recombinant protein, subunit vaccine and preparation method thereof. Background Art

[0002] Rhodococcus equi (abbreviated as Rhodococcus equi) is a facultative intracellular parasitic Gram-positive coccobacillus existing in soil, commonly found in horse settlements, and highly infectious to donkeys. Especially in intensive farming environments, it is prone to cause epidemic infections, resulting in serious economic losses. At present, the treatment of Rhodococcus equi infection mainly relies on antibiotics, but the problems of drug resistance and the limitations of hyperimmune serum therapy make preventive strategies particularly important.

[0003] Developing subunit vaccines and evaluating their immunoprotective efficacy to provide an efficient and safe prevention plan for Rhodococcus equi infection in susceptible animals such as donkeys and horses is an urgent problem to be solved at present. Summary of the Invention

[0004] In view of this, on the one hand, some embodiments disclose Rhodococcus equi antigen proteins, which include Rhodococcus equi antigen protein VapA and Rhodococcus equi antigen protein VapG. The coding gene sequence of Rhodococcus equi antigen protein VapA is shown as SEQ ID NO:001, and the coding gene sequence of Rhodococcus equi antigen protein VapG is shown as SEQ ID NO:002.

[0005] On the other hand, some embodiments disclose recombinant expression vectors, which contain the coding gene of Rhodococcus equi antigen protein VapA, and the base sequence is shown as SEQ ID NO:001; or the coding gene of Rhodococcus equi antigen protein VapG, and the base sequence is shown as SEQ ID NO:002.

[0006] Furthermore, some embodiments disclose recombinant expression vectors, including recombinant expression vectors pPICZαA-VapA and pPICZαA-VapG; wherein, the recombinant expression vector pPICZαA-VapA is constructed by cloning the coding gene of Rhodococcus equi antigen protein VapA into the Pichia pastoris expression vector pPICZαA; the recombinant expression vector pPICZαA-VapG is constructed by cloning the coding gene of Rhodococcus equi antigen protein VapG into the Pichia pastoris expression vector pPICZαA.

[0007] On yet another hand, some embodiments disclose recombinant proteins, which are prepared from the recombinant expression vectors disclosed in the embodiments of the present invention.

[0008] Further, the recombinant proteins disclosed in some embodiments include recombinant protein VapA and recombinant protein VapG; wherein, the preparation method of recombinant protein VapA or recombinant protein VapG includes:

[0009] Introduce the recombinant expression vector pPICZαA-VapA or pPICZαA-VapG into Pichia pastoris X33 competent cells by electroporation;

[0010] Screen to obtain the recombinant strains X33-pPICZαA-VapA or X33-pPICZαA-VapG;

[0011] Amplify the obtained recombinant strains X33-pPICZαA-VapA or X33-pPICZαA-VapG in BMGY medium;

[0012] Transfer the amplified recombinant strains into BMMY medium for induction expression;

[0013] Centrifuge to collect the supernatant of induction expression, and obtain recombinant protein VapA or recombinant protein VapG by Ni-IDA affinity chromatography purification.

[0014] On the other hand, some embodiments disclose a Rhodococcus equi subunit vaccine, comprising the recombinant protein disclosed in the embodiments of the present invention.

[0015] Further, the Rhodococcus equi subunit vaccine disclosed in some embodiments comprises recombinant protein VapA and an adjuvant.

[0016] Some embodiments disclose a Rhodococcus equi subunit vaccine comprising recombinant protein VapG and an adjuvant.

[0017] Some embodiments disclose a Rhodococcus equi subunit vaccine comprising recombinant protein VapG, recombinant protein VapA and an adjuvant.

[0018] Finally, some embodiments disclose a preparation method of a Rhodococcus equi subunit vaccine, including:

[0019] Optimize the coding gene sequence of Rhodococcus equi virulence protein VapA or VapG to obtain Rhodococcus equi antigen protein VapA or VapG; the base sequence of the coding gene of Rhodococcus equi antigen protein VapA is shown in SEQ ID NO:001; the base sequence of the coding gene of Rhodococcus equi antigen protein VapG is shown in SEQ ID NO:2;

[0020] Clone the optimized coding gene fragment of VapA or VapG into the Pichia pastoris expression vector pPICZαA to construct the recombinant expression vector pPICZαA-VapA or pPICZαA-VapG;

[0021] The recombinant expression vectors pPICZαA-VapA or pPICZαA-VapG were introduced into competent cells of Pichia pastoris X33 by electrotransformation;

[0022] Recombinant strains X33-pPICZαA-VapA or X33-pPICZαA-VapG were screened and obtained;

[0023] The obtained recombinant strains X33-pPICZαA-VapA or X33-pPICZαA-VapG were amplified in BMGY medium;

[0024] The amplified recombinant strains were transferred to BMMY medium for induced expression;

[0025] The supernatant of the induced expression was collected by centrifugation, and the recombinant protein VapA or the recombinant protein VapG was obtained by purification with Ni-IDA affinity chromatography;

[0026] The purified recombinant protein VapA and / or the recombinant protein VapG were mixed with an adjuvant to obtain the Rhodococcus equi subunit vaccine.

[0027] The embodiments of the present invention disclose the Rhodococcus equi antigen proteins, recombinant expression vectors, recombinant proteins, subunit vaccines and preparation methods; they are obtained by sequence optimization and truncation of the coding genes of the Rhodococcus equi virulence proteins VapA and VapG. The optimized coding genes of the Rhodococcus equi antigen proteins VapA and VapG were further cloned into the Pichia pastoris expression vector pPICZαA to construct the recombinant expression vectors pPICZαA-VapA and pPICZαA-VapG. Further through transformation, amplification, induced expression, and purification, the recombinant proteins VapA and VapG were respectively obtained. The Rhodococcus equi subunit vaccine was prepared from the recombinant protein VapA and / or VapG, which has a good preventive effect on the infection of Rhodococcus equi. Description of the Drawings

[0028] Figure 1 It is the sequence comparison before and after truncation of the transmembrane domain and signal peptide of the protein VapA coding gene in Example 1.

[0029] Figure 2 It is the sequence alignment before and after optimizing the codons of the truncated protein VapA coding gene to yeast-preferred codons in Example 1.

[0030] Figure 3 It is the sequence comparison before and after truncation of the signal peptide of the protein VapG coding gene in Example 2.

[0031] Figure 4 It is the sequence alignment before and after optimizing the codons of the truncated VapG coding gene to yeast-preferred codons in Example 2.

[0032] Figure 5 It is the map of recombinant plasmid pPICZαA-VapA in Example 3.

[0033] Figure 6 It is the map of recombinant plasmid pPICZαA-VapG in Example 3.

[0034] Figure 7 It is the single-enzyme digestion verification result of recombinant plasmids pPICZαA-VapA and pPICZαA-VapG in Example 4.

[0035] Figure 8 They are the transformed colonies of recombinant Pichia pastoris strains X33-pPICZαA-VapA and X33-pPICZαA-VapG on YPD plates containing Zeocin+; among them, 1-6 are recombinant yeast strain X33-pPICZαA-VapA, and 7-12 are recombinant Pichia pastoris strain X33-pPICZαA-VapG.

[0036] Figure 9 It is the PCR identification result of recombinant yeast strains in Examples 5-10, where lanes 3-8 are recombinant yeast strain X33-pPICZαA-VapA, and lanes 9-14 are recombinant yeast strain X33-pPICZαA-VapG.

[0037] Figure 10 It is the SDS-PAGE result map of the expression and purification of recombinant proteins in Examples 11 and 12, where the samples loaded in lanes 1 and 2 are the induced expression supernatant and the purified product of the induced expression supernatant of X33-pPICZαA-VapA respectively; the samples loaded in lanes 3 and 4 are the induced expression supernatant and the purified product of the induced expression supernatant of X33-pPICZαA-VapG respectively.

[0038] Figure 11 It is the Western blot identification map of recombinant proteins in Examples 11 and 12. The sample loaded in lane 1 is purified recombinant protein VapA, and the sample loaded in lane 2 is purified recombinant protein VapG. Detailed implementation manners

[0039] The special term "Example" here. Any example described as "exemplary" does not have to be construed as superior or better than other examples. For the performance index tests in the embodiments of the present invention, unless otherwise specified, conventional test methods in the art are adopted. It should be understood that the terms described in the embodiments of the present invention are only used to describe specific implementation manners and are not used to limit the content disclosed in the embodiments of the present invention.

[0040] Unless otherwise specified, the technical and scientific terms used herein have the same meanings as commonly understood by those of ordinary skill in the technical field to which the embodiments of the present invention belong; other test methods and technical means not specifically noted in the embodiments of the present invention refer to the experimental methods and technical means commonly adopted by those of ordinary skill in the art.

[0041] As used herein, the terms "substantially" and "about" are used to describe minor fluctuations. For example, they can refer to less than or equal to ±5%, such as less than or equal to ±2%, such as less than or equal to ±1%, such as less than or equal to ±0.5%, such as less than or equal to ±0.2%, such as less than or equal to ±0.1%, such as less than or equal to ±0.05%. Numerical data presented or represented in a range format herein is used only for convenience and brevity and should therefore be interpreted flexibly to include not only the values explicitly listed as the bounds of the range but also all individual values or sub-ranges included within that range. For example, a numerical range of "1 to 5%" should be interpreted to include not only the explicitly listed values of 1% to 5% but also the individual values and sub-ranges within the indicated range. Thus, within this numerical range, individual values such as 2%, 3.5%, and 4% are included, and sub-ranges such as 1% to 3%, 2% to 4%, and 3% to 5% etc. This principle also applies to ranges that list only one numerical value. In addition, such an interpretation applies regardless of the width of the range or the characteristics described.

[0042] In some embodiments, the Rhodococcus equi antigenic proteins include Rhodococcus equi antigenic protein VapA and Rhodococcus equi antigenic protein VapG. The coding gene sequence of Rhodococcus equi antigenic protein VapA is as shown in SEQ ID NO:001, and the coding gene sequence of Rhodococcus equi antigenic protein VapG is as shown in SEQ ID NO:002. It has been found that VapA and VapG in the Vap protein family of Rhodococcus equi are important antigenic proteins that can induce specific cellular immune and humoral immune responses respectively, and the Th1-type immune response induced by VapA can inhibit the proliferation of Rhodococcus equi in macrophages.

[0043] In some embodiments, the coding gene sequence of the Rhodococcus equi virulence protein VapA is analyzed, and gene optimization is carried out with the goal of increasing eukaryotic expression level, and the optimized coding gene sequence of Rhodococcus equi antigenic protein VapA is:

[0044] GACTCTGGTTCTTCATCCGCTATTTTGAACTCAGGTGCAGGCTCAGGAATCGTTGGTAGTGGCTCATACGACTCTAGTACCACTTCACTAAATCTTCAGAAAGATGAACCAAACGGTAGGGCTTCTGATACCGCTGGCCAAGAACAACAGTACGATGTCCACGGAGATGTTATCTCTGCTGTCGTTTACCAACGATTCCATGTTTTCGGTCCCGAAGGTAAAGTATTCGATGGTGATGCCGGTGGACTTACTCTACCTGGAGCTGGAGCTTTTTGGGGAACATTGTTCACTAACGATCTTCAGAGGCTGTACAAAGATACCGTATCTTTCCAATATAATGCAGTTGGACCCTACCTGAACATAAACTTCTTTGATTCCTCCGGATCTTTTTTGGGCCATATTCAGTCCGGCGGTGTTAGTACTGTTGTTGGAGTAGGCGGTGGTTCTGGTTCTTGGCATAACGCTTAA。

[0045] In some embodiments, the coding gene sequence of the virulence protein VapG of Rhodococcus equi was analyzed, and gene optimization was carried out with the goal of increasing eukaryotic expression. The coding gene sequence of the Rhodococcus equi antigen protein VapG is:

[0046] GAAACGTCAATGGTTAGTACTACAGCCGCTTCTAGTGTTGAACATGCTGCAAATACTTACGATTTTGCTGAGGCAAAGTCAGGATCTTCTATCCCAGCAAAAGTCGCAGCTGAACAGGCTAACTCATACTCTGTGCACGGATTGGTGACCTCACTGGCCGTTTACCAACATTTTAGTCTAACAGTAGAAGGTGGTGGAAAAACCTTCACAGGTGACAGTGGAGGTATCTCCATTCCTGGTGTTGCTGTTTTGGAAGGTACCTTGTTTACTGAGGATTTGCAACACTTGTACTCTGACACCGTGTCTTTTGAGTATAACGCCGTTGGACCTTATCTGAACATCAACTTTTTCGACTCTCATGGTACTTTGTTGGGACACGTACGTAGTGGCTCAATAGGAACCGTTAGTGGAATCGGAGGTGGTACTGGAGGTTGGCAATAA。

[0047] In some embodiments, the recombinant expression vector comprises the coding gene of Rhodococcus equi antigen protein VapA, the base sequence of which is shown in SEQ ID NO: 001; or the coding gene of Rhodococcus equi antigen protein VapG, the base sequence of which is shown in SEQ ID NO: 002.

[0048] In some examples, the recombinant expression vectors include pPICZαA-VapA and pPICZαA-VapG; wherein, the recombinant expression vector pPICZαA-VapA is constructed by cloning the coding gene of Rhodococcus equi antigen protein VapA into the Pichia pastoris expression vector pPICZαA; the recombinant expression vector pPICZαA-VapG is constructed by cloning the coding gene of Rhodococcus equi antigen protein VapG into the Pichia pastoris expression vector pPICZαA.

[0049] In some embodiments, the recombinant protein is prepared from the recombinant expression vector.

[0050] In some examples, the recombinant proteins include recombinant protein VapA, recombinant protein VapG; wherein, the preparation method of recombinant protein VapA or recombinant protein VapG includes: introducing the recombinant expression vector pPICZαA-VapA or pPICZαA-VapG into Pichia pastoris X33 competent cells by electroporation;

[0051] Screen and obtain the recombinant strains X33-pPICZαA-VapA or X33-pPICZαA-VapG;

[0052] Amplify the obtained recombinant strains X33-pPICZαA-VapA or X33-pPICZαA-VapG in BMGY medium;

[0053] Transfer the amplified recombinant strains into BMMY medium for induction expression;

[0054] Centrifuge to collect the supernatant of induction expression, and obtain recombinant protein VapA or recombinant protein VapG by Ni-IDA affinity chromatography purification.

[0055] The preparation methods of recombinant proteins disclosed in some embodiments include:

[0056] Select Pichia pastoris X33 as the eukaryotic expression vector, culture the X33 strain in YPD medium to an appropriate growth density, centrifuge to collect the cells, wash them successively with deionized water and sorbitol, and finally resuspend the cells with pre-cooled sorbitol to obtain Pichia pastoris X33 competent cells;

[0057] Electrotransform the recombinant expression vector pPICZAα-VapA or pPICZAα-VapG into yeast competent cells, then transfer the cells to YPD medium for recovery, and then coat them on Zeocin+ antibiotic plates for culture;

[0058] In some more preferred embodiments, linearize the recombinant plasmids pPICZAα-VapA and pPICZAα-VapG by single digestion with Sac I;

[0059] Select yeast monoclonal colonies with correct PCR identification, which are recombinant Pichia pastoris X33-pPICZAα-VapA or X33-pPICZAα-VapG;

[0060] Inoculate the recombinant Pichia pastoris X33-pPICZAα-VapA or X33-pPICZAα-VapG in BMGY medium and grow to an appropriate density, then resuspend and induce expression with BMMY medium, and use methanol as the inducer during the expression;

[0061] In some more preferred embodiments, the OD600 value of the strain amplified in BMGY medium is 2.0;

[0062] In some more preferred embodiments, the addition amount of the inducer methanol is 1% per 24 h;

[0063] In some more preferred embodiments, the induction temperature is 29 °C;

[0064] In some more preferred embodiments, the volume ratio transferred from BMGY to BMMY is 1:4;

[0065] In some more preferred embodiments, the induction expression time of X33-pPICZAα-VapA is 72 h;

[0066] In some more preferred embodiments, the induction expression time of X33-pPICZAα-VapG is 84 h;

[0067] The yeast protein induced for expression is purified by centrifugation and filtration, followed by binding and elution steps through a His purification column to obtain purified recombinant protein VapA or recombinant protein VapG, and the purification effect is analyzed by SDS-PAGE. Subsequently, the protein concentration is determined using the BCA method, and after aliquoting, it is stored frozen at -20 °C.

[0068] Some embodiments disclose a Rhodococcus equi subunit vaccine comprising the recombinant protein disclosed in the embodiments of the present invention.

[0069] The Rhodococcus equi subunit vaccine disclosed in some embodiments comprises recombinant protein VapA and an adjuvant. In some embodiments, the adjuvant is the polymer adjuvant MONTANIDE TM GEL 02PR, designed specifically for vaccines, slowly releases antigens through a polymer gel, significantly enhancing the humoral and cellular immune responses while maintaining excellent safety, and can be used in the adjuvant part for the preparation of Rhodococcus equi subunit vaccines.

[0070] The Rhodococcus equi subunit vaccine disclosed in some embodiments comprises recombinant protein VapG and an adjuvant. Generally, the mass ratio of recombinant protein VapG to the adjuvant is 1:1.

[0071] The Rhodococcus equi subunit vaccine disclosed in some embodiments comprises recombinant protein VapG, recombinant protein VapA and an adjuvant. Generally, the mass ratio of recombinant protein VapA to recombinant protein VapG is 1:1; the total mass ratio of recombinant protein VapA and VapG to the adjuvant is 1:1.

[0072] Some embodiments disclose a method for preparing a Rhodococcus equi subunit vaccine, comprising:

[0073] Optimizing the coding gene sequence of the Rhodococcus equi virulence protein VapA or VapG; the optimized coding gene base sequence of VapA is as shown in SEQ ID NO:001; the optimized coding gene base sequence of VapG is as shown in SEQ ID NO:2;

[0074] Cloning the optimized coding gene fragment of VapA or VapG into the Pichia pastoris expression vector pPICZαA to construct a recombinant expression vector pPICZαA-VapA or pPICZαA-VapG;

[0075] The recombinant expression vector pPICZαA-VapA or pPICZαA-VapG was introduced into the competent cells of Pichia pastoris X33 by electrotransformation;

[0076] The recombinant strains X33-pPICZαA-VapA or X33-pPICZαA-VapG were obtained by screening;

[0077] The obtained recombinant strains X33-pPICZαA-VapA or X33-pPICZαA-VapG were amplified in BMGY medium;

[0078] The amplified recombinant strains were transferred to BMMY medium for induced expression;

[0079] The supernatant of the induced expression was collected by centrifugation, and the recombinant protein VapA or recombinant protein VapG was obtained by purification with Ni-IDA affinity chromatography;

[0080] The purified recombinant protein VapA and / or recombinant protein VapG was mixed with an adjuvant to obtain the Rhodococcus equi subunit vaccine.

[0081] In this document, including the claims, conjunctions such as "comprising", "including", "carrying", "having", "containing", "involving", "accommodating", etc. are understood to be open-ended, that is, "including but not limited to". Only the conjunctions "consisting of" and "composed of" are closed conjunctions.

[0082] In order to better illustrate the content of the present invention, numerous specific details are given in the following specific embodiments. Those skilled in the art should understand that the present invention can also be implemented without certain specific details. In the embodiments, some methods, means, instruments, equipment, etc. well-known to those skilled in the art are not described in detail in order to highlight the gist of the present invention.

[0083] On the premise of no conflict, the technical features disclosed in the embodiments of the present invention can be combined arbitrarily, and the obtained technical solutions belong to the content disclosed in the embodiments of the present invention.

[0084] The following further exemplarily illustrates the technical details in combination with the embodiments.

[0085] Example 1

[0086] Optimization of the Coding Gene Sequence of VapA Protein from Rhodococcus equi

[0087] For the gene sequence encoding the virulence-related lipoprotein VapA of Rhodococcus equi, it was optimized with the aim of increasing the protein expression level and making it more suitable for expression in the yeast expression system; rare codons in the optimized sequence were optimized, the transmembrane domain located at 12 - 34 aa and the signal peptide structure located at 1 - 31 aa were truncated, and part of the base sequence was changed to make it suitable for the yeast expression system. The size of the protein is approximately 16.6 kDa.

[0088] Figure 1 It is the sequence comparison of the transmembrane domain and signal peptide of the gene encoding protein VapA before and after truncation;

[0089] Figure 2 It is the sequence alignment of the codons of the truncated VapA-encoding gene before and after being optimized to yeast-preferred codons.

[0090] The gene sequence encoding the virulence-related lipoprotein VapA of Rhodococcus equi before optimization is:

[0091] ATGAAGACTCTTCACAAGACGGTTTCTAAGGCGATCGCAGCCACAGCCGTAGCTGCGGCTGCGGCTATGATTCCCGCCGGCGTCGCTAATGCGACCGTTCTTGATTCCGGTAGCAGCAGTGCGATTCTCAATAGTGGGGCAGGCAGTGGCATTGTCGGTTCTGGGAGCTATGACAGCTCGACGACTTCGTTAAACCTTCAGAAAGACGAACCGAACGGTCGAGCAAGCGATACCGCCGGGCAAGAGCAGCAGTACGACGTTCACGGAGACGTCATCAGCGCGGTCGTCTACCAGAGGTTTCACGTATTCGGGCCAGAAGGAAAGGTCTTCGATGGCGATGCAGGGGGACTCACGCTTCCTGGGGCCGGCGCGTTCTGGGGGACTCTCTTCACAAATGACCTTCAGCGTCTCTACAAAGACACCGTCTCGTTCCAGTACAACGCCGTGGGGCCATACCTGAACATCAACTTCTTCGATAGCTCAGGTAGCTTCCTCGGCCATATCCAGTCCGGTGGAGTTAGTACTGTGGTGGGCGTCGGCGGCGGCTCTGGTAGCTGGCACAACGCCTAG。

[0092] The gene sequence encoding the antigen protein VapA of Rhodococcus equi after optimization is:

[0093] GACTCTGGTTCTTCATCCGCTATTTTGAACTCAGGTGCAGGCTCAGGAATCGTTGGTAGTGGCTCATACGACTCTAGTACCACTTCACTAAATCTTCAGAAAGATGAACCAAACGGTAGGGCTTCTGATACCGCTGGCCAAGAACAACAGTACGATGTCCACGGAGATGTTATCTCTGCTGTCGTTTACCAACGATTCCATGTTTTCGGTCCCGAAGGTAAAGTATTCGATGGTGATGCCGGTGGACTTACTCTACCTGGAGCTGGAGCTTTTTGGGGAACATTGTTCACTAACGATCTTCAGAGGCTGTACAAAGATACCGTATCTTTCCAATATAATGCAGTTGGACCCTACCTGAACATAAACTTCTTTGATTCCTCCGGATCTTTTTTGGGCCATATTCAGTCCGGCGGTGTTAGTACTGTTGTTGGAGTAGGCGGTGGTTCTGGTTCTTGGCATAACGCTTAA。

[0094] The optimized coding gene sequence of Rhodococcus equi antigen protein VapA is shown in Sequence Listing SEQ ID NO:001.

[0095] Example 2

[0096] Optimization of the Coding Gene Sequence of VapG Protein from Rhodococcus equi:

[0097] For the coding gene sequence of Rhodococcus equi virulence-related lipoprotein VapG, optimization was carried out with the aim of increasing the protein expression level and making it more suitable for expression in the yeast expression system; rare codons in the optimized sequence were truncated, the signal peptide structure of the VapG sequence located at 1-26aa was truncated, and part of the base sequence was changed to make it suitable for the yeast expression system. The protein size is approximately 16 kDa.

[0098] The coding gene sequence of Rhodococcus equi virulence-related lipoprotein VapG before optimization is:

[0099] GTGAGTGTTCGGACCCTTTTGGCGGCAACGCTCGTTGTTGGAATATCAGTCTTGGCACCGGCCGGCATTGCGAACGCGGAAACTTCAATGGTATCCACTACAGCAGCATCGAGTGTCGAGCACGCTGCAAACACCTACGACTTTGCAGAGGCGAAGAGCGGGAGCTCTATCCCCGCCAAAGTAGCCGCAGAGCAGGCAAACAGCTATTCGGTCCACGGGCTTGTCACCAGCCTCGCCGTATACCAGCACTTTTCACTGACCGTTGAAGGCGGCGGAAAGACGTTTACTGGTGATTCTGGCGGGATTTCGATTCCCGGGGTTGCAGTGCTGGAGGGAACCCTATTCACCGAGGATCTGCAGCATTTGTACAGCGACACCGTCTCGTTCGAGTACAACGCCGTAGGCCCGTACCTGAACATCAACTTTTTTGACAGCCATGGCACTCTCCTAGGCCACGTGCGGTCTGGATCCATCGGGACCGTCTCCGGCATCGGTGGCGGAACCGGAGGGTGGCAATAG。

[0100] Figure 3 Sequence comparison before and after truncation of the transmembrane domain and signal peptide of the gene encoding protein VapA;

[0101] Figure 4 Sequence alignment of the codons of the truncated VapA-encoding gene before and after optimization to yeast-preferred codons.

[0102] The optimized coding gene sequence of Rhodococcus equi antigen protein VapG is:

[0103] GAAACGTCAATGGTTAGTACTACAGCCGCTTCTAGTGTTGAACATGCTGCAAATACTTACGATTTTGCTGAGGCAAAGTCAGGATCTTCTATCCCAGCAAAAGTCGCAGCTGAACAGGCTAACTCATACTCTGTGCACGGATTGGTGACCTCACTGGCCGTTTACCAACATTTTAGTCTAACAGTAGAAGGTGGTGGAAAAACCTTCACAGGTGACAGTGGAGGTATCTCCATTCCTGGTGTTGCTGTTTTGGAAGGTACCTTGTTTACTGAGGATTTGCAACACTTGTACTCTGACACCGTGTCTTTTGAGTATAACGCCGTTGGACCTTATCTGAACATCAACTTTTTCGACTCTCATGGTACTTTGTTGGGACACGTACGTAGTGGCTCAATAGGAACCGTTAGTGGAATCGGAGGTGGTACTGGAGGTTGGCAATAA。

[0104] The optimized coding gene sequence of Rhodococcus equi antigen protein VapG is shown in Sequence Listing SEQ ID NO:002.

[0105] Example 3

[0106] Construction of Recombinant Plasmids pPICZαA-VapA and pPICZαA-VapG

[0107] The optimized sequence was synthesized, and the yeast expression vector pPICZαA was digested with double enzymes. The vector was ligated with the VapA and VapG gene fragments using T4 DNA ligase respectively. The ligation products were transformed into competent DH5α cells, positive transformants were screened and plasmids were extracted, and double digestion identification was carried out using EcorI and XbaI; recombinant plasmids pPICZαA-VapA and pPICZαA-VapG were obtained respectively;

[0108] Figure 5 This is the map of recombinant plasmid pPICZαA-VapA; Figure 6 This is the map of recombinant plasmid pPICZαA-VapG.

[0109] Example 4

[0110] Construction of Recombinant Pichia pastoris Strains X33-pPICZαA-VapA and X33-pPICZαA-VapG

[0111] S1. Preparation of Pichia pastoris competent cells

[0112] Pick single colonies of X33 and inoculate them into YPD medium. Incubate overnight in a shaker at 29°C and 250 r / min; Take 500 μL of the culture solution and inoculate it into 500 mL of YPD medium until the OD600 reaches 1.5; Centrifuge at 3000 r / min and 4°C for 5 min to collect the bacteria, and wash them three times each with deionized water and 1 M sorbitol; Add 1 mL of pre-cooled 1 M sorbitol in advance to resuspend the bacteria and gently mix evenly to obtain Pichia pastoris competent cells;

[0113] S2. Linearization of recombinant plasmids pPICZαA-VapA and pPICZαA-VapG

[0114] To improve the homologous recombination efficiency between the plasmid and the Pichia pastoris genome, first perform single enzyme digestion and linearization of the correctly sequenced plasmids pPICZαA-VapA and pPICZαA-VapG with SacI respectively; Place the reaction system in a 37°C water bath for 1.5 h, take 15 μL for 1% gel electrophoresis to detect whether the linearization is complete; Figure 7 Verification results of single enzyme digestion of recombinant plasmids pPICZαA-VapA and pPICZαA-VapG;

[0115] S3. Under ice bath conditions, add 10 μg of the linearized plasmid to 80 μL of yeast competent cells respectively. After gently pipetting and mixing evenly, transfer it to the bottom of a 2 mm electrode cup, place it in an electroporation chamber, and perform transformation under the conditions of a voltage of 1500 V, a resistance of 200 Ω, and a capacitance of 25 μF; After transformation, add 1 mL of ice-bathed 1 M sorbitol to the electroporation cup, mix evenly and transfer it to 2 mL of YPD liquid medium, let it stand at 30°C for 30 min, take 100 μL and spread it on a YPD Zecocin+(100 μg / mL) plate and culture at 29°C for 2 d until colonies grow;

[0116] S4. Screening and identification of recombinant Pichia pastoris strains X33-pPICZαA-VapA and X33-pPICZαA-VapG

[0117] Respectively pick single colonies into YPD medium containing Zeocin+ and culture at 29°C for 12 h; Take 1 mL of the bacterial liquid and add it to a 1.5 mL centrifuge tube, centrifuge at 8000 r / min for 5 min to collect the bacteria; Add 100 μL of distilled water to resuspend, repeat three times at 98°C and -80°C for 5 min each time, centrifuge and take 1 μl of the supernatant as a template for PCR identification;

[0118] The correctly identified positive recombinant yeast strains are named X33-pPICZαA-VapA and X33-pPICZαA-VapG respectively.

[0119] Figure 8Colonies transformed from recombinant Pichia pastoris strains X33-pPICZαA-VapA and X33-pPICZαA-VapG on YPD plates containing Zeocin+; among them, 1-6 are recombinant yeast strain X33-pPICZαA-VapA, and 7-12 are recombinant Pichia pastoris strain X33-pPICZαA-VapG.

[0120] Example 5

[0121] Induced Expression of Recombinant Pichia pastoris Strains

[0122] S1. Pick the transformants identified as positive by yeast colony PCR on the transformed YPD plates containing Zeocin+ and inoculate them into 25 mL of BMGY liquid medium. Incubate with shaking at 29°C and 180 r / min until the OD600 reaches 2.0.

[0123] S2. Collect part of the culture broth and centrifuge it at 6000 r / min for 5 min at room temperature. Discard the supernatant and wash the cells twice with sterile PBS to completely remove glycerol.

[0124] S3. Transfer the cells to 50 mL of BMMY medium, control the initial OD600 = 1.0, incubate with shaking at 29°C and 180 r / min for 48 - 96 h, and add 0.5% methanol to the medium every 24 h to continuously induce protein production by the cells. Sample every 12 h to analyze the cell growth and screen for high-expression strains.

[0125] Example 6

[0126] Induced Expression of Recombinant Pichia pastoris Strains

[0127] The expression method refers to Example 5; among them, the methanol is added to a final concentration of 1% in S3.

[0128] Example 7

[0129] Induced Expression of Recombinant Pichia pastoris Strains

[0130] The expression method refers to Example 5; among them, in step S3, the cells are transferred to 100 mL of BMMY medium; the methanol is added to a final concentration of 0.5%.

[0131] Example 8

[0132] Induced Expression of Recombinant Pichia pastoris Strains

[0133] The expression method refers to Example 5; among them, in step S3, the cells are transferred to 100 mL of BMMY medium; the methanol is added to a final concentration of 1%.

[0134] Example 9

[0135] Induced Expression of Recombinant Pichia pastoris Strains

[0136] The expression method refers to Example 5; among them, in step S3, the bacterial cells are transferred to 200 mL of BMMY medium; methanol is supplemented to a final concentration of 0.5%.

[0137] Example 10

[0138] Induced Expression of Recombinant Pichia pastoris Strains

[0139] The expression method refers to Example 5; among them, in step S3, the bacterial cells are transferred to 200 mL of BMMY medium, and methanol is supplemented to a final concentration of 1%.

[0140] Figure 9 The PCR identification results of the recombinant yeast strains in Examples 5-10 are shown. Among them, lanes 3-8 are the recombinant yeast strain X33-pPICZαA-VapA, and lanes 9-14 are the recombinant yeast strain X33-pPICZαA-VapG.

[0141] Example 11

[0142] Purification of Recombinant Protein VapA

[0143] Using an affinity chromatography system, the supernatant of the recombinant Pichia pastoris strain X33-pPICZαA-VapA induced and expressed in Examples 5-10 was respectively loaded onto an affinity chromatography column pre-equilibrated with Ni-IDA Binding-Buffer at a flow rate of 0.5 mL / min; washed with Ni-IDA Binding-Buffer at a flow rate of 0.5 mL / min until the OD280 value of the effluent reached the baseline; washed with Ni IDA Washing-Buffer at a flow rate of 1 mL / min until the OD280 value of the effluent reached the baseline; eluted the target protein with Ni IDA Elution-Buffer at a flow rate of 1 mL / min, collected the effluent, and detected the protein purification concentration using a BCA detection kit.

[0144] The concentration of the recombinant protein VapA obtained under the expression conditions of Example 8 and induced for 72 h was the highest, which was 0.24 mg / ml.

[0145] Example 12

[0146] Purification of Recombinant Protein VapG

[0147] Using an affinity chromatography system, the supernatant solutions of the recombinant Pichia pastoris strains X33-pPICZαA-VapG induced and expressed in Examples 5-10 were respectively loaded onto an affinity chromatography column pre-equilibrated with Ni-IDA Binding-Buffer at a flow rate of 0.5 mL / min; washed with Ni-IDA Binding-Buffer at a flow rate of 0.5 mL / min until the OD280 value of the effluent reached the baseline; washed with Ni IDA Washing-Buffer at a flow rate of 1 mL / min until the OD280 value of the effluent reached the baseline; eluted the target protein with Ni IDA Elution-Buffer at a flow rate of 1 mL / min, and collected the effluent. The protein purification concentration was detected using a BCA detection kit.

[0148] Using the expression conditions of Example 8 and inducing expression for 84 h, the highest concentration of VapG protein was obtained, and the VapG protein was 0.21 mg / ml.

[0149] Figure 10 It is the SDS-PAGE result diagram for the expression and purification of the recombinant proteins in Examples 11 and 12. Among them, the samples loaded in lanes 1 and 2 were the induced expression supernatant and the purified product of the induced expression supernatant of X33-pPICZαA-VapA respectively; the samples loaded in lanes 3 and 4 were the induced expression supernatant and the purified product of the induced expression supernatant of X33-pPICZαA-VapG respectively. Figure 11 It is the Western blot identification diagram for the recombinant proteins in Examples 11 and 12. The sample loaded in lane 1 was the purified recombinant protein VapA, and the sample loaded in lane 2 was the purified recombinant protein VapG.

[0150] Example 13

[0151] Preparation of Rhodococcus equi Subunit Vaccine VapA-Montanide

[0152] Mix the purified recombinant protein VapA with MONTANIDE TM GEL 02PR innovative polymer adjuvant in a mass ratio of 1:1. After the protein is mixed evenly, VapA-Montanide can be successfully prepared.

[0153] Example 14

[0154] Preparation of Rhodococcus equi Subunit Vaccine VapG-Montanide:

[0155] Mix the purified recombinant protein VapG with MONTANIDE TM GEL 02PR innovative polymer adjuvant in a mass ratio of 1:1. After the protein is mixed evenly, VapG-Montanide can be successfully prepared.

[0156] Example 15

[0157] Preparation of Rhodococcus equi Subunit Vaccine VapA+VapG-Montanide:

[0158] Mix the purified virulence-related lipoproteins VapA and VapG at a mass ratio of 1:1, and then mix the mixed proteins with MONTANIDE TM GEL 02PR innovative polymer adjuvant at a mass ratio of 1:1. After the proteins are mixed evenly, VapA+VapG-Montanide can be successfully prepared.

[0159] Example 16

[0160] Safety Detection of Rhodococcus equi Subunit Vaccine

[0161] 1. Sterility test

[0162] Take 0.2 mL of the Rhodococcus equi subunit vaccine samples prepared in Examples 13, 14, and 15 respectively, and evenly coat them on a brain heart infusion agar plate containing 5% (V / V) defibrinated sheep blood, and incubate them in an inverted position at 37 °C for 5 days;

[0163] The test results of Examples 13, 14, and 15 are all negative, indicating that the Rhodococcus equi subunit vaccines prepared in Examples 13, 14, and 15 are free of bacterial contamination.

[0164] 2. Animal safety test

[0165] Take 20 healthy female BALB / c mice aged 6-8 weeks, and divide them into 4 groups evenly, with 5 mice in each group; Group 1 of the test: Intramuscularly inject the subunit vaccine prepared in Example 13 with an antigen amount of 40 μg; Group 2 of the test: Intramuscularly inject the subunit vaccine prepared in Example 14 with an antigen amount of 40 μg; Group 3 of the test: Intramuscularly inject the subunit vaccine prepared in Example 15 with an antigen amount of 40 μg; Control group: Intramuscularly inject 0.2 mL of normal saline; The test period is 14 days;

[0166] During the test period, the mice in the test groups and the control group were all healthy and lively, without death, and had normal food intake and water intake, indicating that the subunit vaccines prepared in Examples 13, 14, and 15 are safe.

[0167] Example 17

[0168] Immune Effect of Rhodococcus equi Subunit Vaccine

[0169] 1. The antibody titer change rule after vaccine immunization

[0170] Select 40 SPF-grade female BALB / c mice with a body weight of 18-22 g, and divide them into 4 groups evenly.

[0171] Immune group 1: 10 experimental mice were intramuscularly injected with the subunit vaccine prepared in Example 13 with an antigen amount of 40 μg in the leg muscles at 6 - 8 weeks of age. The vaccine of Example 13 was administered for the second immunization 14 days after the primary immunization, and the vaccine of Example 13 was administered for the third immunization 14 days after the second immunization. The doses for the second and third immunizations were the same as those for the primary immunization;

[0172] Immune group 2: 10 experimental mice were intramuscularly injected with the subunit vaccine prepared in Example 14 with an antigen amount of 40 μg in the leg muscles at 6 - 8 weeks of age. The vaccine of Example 14 was administered for the second immunization 14 days after the primary immunization, and the vaccine of Example 14 was administered for the third immunization 14 days after the second immunization. The doses for the second and third immunizations were the same as those for the primary immunization;

[0173] Immune group 3: 10 experimental mice were intramuscularly injected with the subunit vaccine prepared in Example 15 with an antigen amount of 40 μg in the leg muscles at 6 - 8 weeks of age. The vaccine of Example 15 was administered for the second immunization 14 days after the primary immunization, and the vaccine of Example 15 was administered for the third immunization 14 days after the second immunization. The doses for the second and third immunizations were the same as those for the primary immunization;

[0174] Control group: 10 experimental mice were intramuscularly injected with 0.2 mL of normal saline in the leg muscles at 6 - 8 weeks of age. Normal saline was administered for the second injection 14 days after the first injection, and normal saline was administered for the third immunization 14 days after the second injection. The doses for the second and third injections were the same as those for the first injection;

[0175] Whole blood was collected by tail amputation on the day of the second immunization, 7 days after the second immunization, on the day of the third immunization, 7 days after the third immunization, and 14 days after the third immunization, respectively. Serum was separated, and the antibody titer in the serum of the experimental mice was determined by indirect ELISA using the sonicated Rhodococcus equi bacterial suspension as the coated antigen;

[0176] The results showed that the serum titer levels of the three immune groups of mice were relatively stable after the second immunization, and the antibody titers could all be maintained above 1:2000; after the third immunization, the serum titer levels of the two immune groups of mice both increased rapidly, and the antibody titers on the 14th day after the third immunization could all be maintained above the level of 1:6400.

[0177] 2. Immune protection efficacy of the vaccine

[0178] Forty SPF - grade female BALB / c mice with a body weight of 18 - 22 g were selected and evenly divided into 4 groups.

[0179] Immune group 1: 10 experimental mice were intramuscularly injected with the subunit vaccine prepared in Example 13 with an antigen amount of 40 μg in the leg muscles at 6 - 8 weeks of age. The vaccine of Example 13 was administered for the second immunization 14 days after the primary immunization, and the vaccine of Example 13 was administered for the third immunization 14 days after the second immunization. The doses for the second and third immunizations were the same as those for the primary immunization;

[0180] Immune group 2: 10 experimental mice. When they were 6 - 8 weeks old, they were intramuscularly injected with 40 μg of the subunit vaccine prepared in Example 14 in the leg muscles. The vaccine of Example 14 was used for the second immunization 14 days after the primary immunization, and the vaccine of Example 14 was used for the third immunization 14 days after the second immunization. The dosages for the second and third immunizations were the same as that of the primary immunization.

[0181] Immune group 3: 10 experimental mice. When they were 6 - 8 weeks old, they were intramuscularly injected with 40 μg of the subunit vaccine prepared in Example 15 in the leg muscles. The vaccine of Example 15 was used for the second immunization 14 days after the primary immunization, and the vaccine of Example 15 was used for the third immunization 14 days after the second immunization. The dosages for the second and third immunizations were the same as that of the primary immunization.

[0182] Control group: 10 experimental mice. When they were 6 - 8 weeks old, 0.2 mL of normal saline was intramuscularly injected into their leg muscles. Normal saline was injected for the second time 14 days after the first injection, and normal saline was used for the third immunization 14 days after the second injection. The dosages for the second and third injections were the same as that of the first injection.

[0183] 14 days after the third immunization, each group of mice was infected with 2×LD 50 bacterial challenge dose. The mortality rate of the experimental mice caused by Rhodococcus equi infection during the entire experimental period was calculated, as shown in Table 1.

[0184] Table 1 List of immune mortality rates

[0185] Group Mortality Rate (%) Immunization Group 1 30 Immunization Group 2 30 Immunization Group 3 20 Control Group 100

[0186] The data in Table 1 show that the mortality rates of the experimental mice in Immune group 1 and Immune group 2 were both 30%, the mortality rate of the experimental mice in Immune group 3 was 20%, while the morbidity rate of the experimental mice in the normal control group was 100%. The results indicate that the Rhodococcus equi subunit vaccine prepared in the embodiments of the present invention has a good preventive effect against Rhodococcus equi infection, and among them, the preventive effect of the subunit vaccine prepared in Example 15 is better.

[0187] In the embodiments of the present invention, the recombinant Pichia pastoris X33 - pPICZAα - VapA and X33 - pPICZAα - VapG that can express the virulence factors VapA and VapG of Rhodococcus equi were successfully constructed, and the recombinant proteins VapA and VapG were obtained by induced expression and purification. The recombinant proteins were combined with adjuvants to prepare the Rhodococcus equi subunit vaccine. Through animal experiment safety detection, it is concluded that the Rhodococcus equi subunit vaccine obtained in the embodiments of the present invention has a good preventive effect against Rhodococcus equi infection.

[0188] In the present invention, by synergistically using the virulence antigen proteins VapA and VapG of Rhodococcus equi, combined with the technical breakthroughs of genetic engineering optimization strategies and the Pichia pastoris eukaryotic expression system, a double improvement in vaccine efficacy and safety is achieved. Through codon preference optimization and truncation modification of signal peptides and transmembrane domains, the protein secretion and expression efficiency is significantly improved, and the recombinant proteins VapA and VapG with natural conformation antigens are obtained through the post-translational modification ability of Pichia pastoris strain X33; in combination with the sustained-release and efficacy-enhancing effect of MONTANIDE TM GEL 02PR innovative adjuvant, a significant protective effect is demonstrated in the mouse challenge experiment, and its production process can avoid the risk of residual pathogen nucleic acids.

[0189] The technical solutions disclosed in the embodiments of the present invention and the technical details disclosed in the embodiments are only exemplary illustrations of the inventive concept of the present invention and do not constitute limitations on the technical solutions of the embodiments of the present invention. Any conventional changes, substitutions or combinations made to the technical details disclosed in the embodiments of the present invention have the same inventive concept as the present invention and are within the protection scope of the claims of the present invention.

Claims

1. Rhodococcus equi antigen protein, characterized in that, The antigen proteins include Rhodococcus equi antigen protein VapA and Rhodococcus equi antigen protein VapG. The coding gene sequence of the Rhodococcus equi antigen protein VapA is as shown in SEQ ID NO:001, and the coding gene sequence of the Rhodococcus equi antigen protein VapG is as shown in SEQ ID NO:

002.

2. Recombinant expression vector, characterized in that, The recombinant expression vector contains the coding gene of Rhodococcus equi antigen protein VapA, and the base sequence is as shown in SEQ ID NO:001; or the coding gene of Rhodococcus equi antigen protein VapG, and the base sequence is as shown in SEQ ID NO:

002.

3. The recombinant expression vector according to claim 2, characterized in that, It includes recombinant expression vectors pPICZαA-VapA and pPICZαA-VapG; wherein, the recombinant expression vector pPICZαA-VapA is constructed by cloning the coding gene of Rhodococcus equi antigen protein VapA into the Pichia pastoris expression vector pPICZαA; the recombinant expression vector pPICZαA-VapG is constructed by cloning the coding gene of Rhodococcus equi antigen protein VapG into the Pichia pastoris expression vector pPICZαA.

4. A recombinant protein, characterized in that, The recombinant protein is prepared from the recombinant expression vector described in claim 3.

5. The recombinant protein according to claim 4, wherein It includes recombinant protein VapA and recombinant protein VapG; wherein, the preparation method of recombinant protein VapA or recombinant protein VapG includes: Introducing the recombinant expression vector pPICZαA-VapA or pPICZαA-VapG into Pichia pastoris X33 competent cells by electroporation; Screening to obtain recombinant strains X33-pPICZαA-VapA or X33-pPICZαA-VapG; Amplifying the obtained recombinant strains X33-pPICZαA-VapA or X33-pPICZαA-VapG in BMGY medium; Transferring the amplified recombinant strains into BMMY medium for induction expression; Centrifuging to collect the supernatant of the induced expression, and purifying to obtain recombinant protein VapA or recombinant protein VapG by Ni-IDA affinity chromatography.

6. Rhodococcus equi subunit vaccine, characterized in that, It contains the recombinant protein described in claim 5.

7. The Rhodococcus equi subunit vaccine according to claim 6, characterized in that, It contains recombinant protein VapA and an adjuvant.

8. The Rhodococcus equi subunit vaccine according to claim 6, characterized in that, It contains recombinant protein VapG and an adjuvant.

9. The Rhodococcus equi sub-unit vaccine according to claim 6, characterized in that, It contains recombinant protein VapG, recombinant protein VapA and an adjuvant.

10. The preparation method of the Rhodococcus equi sub-unit vaccine according to claims 6 to 9, characterized in that, It includes: Optimizing the coding gene sequence of Rhodococcus equi virulence protein VapA or VapG to obtain Rhodococcus equi antigen protein VapA or VapG; the coding gene base sequence of Rhodococcus equi antigen protein VapA is as shown in SEQ ID NO:001; the coding gene base sequence of Rhodococcus equi antigen protein VapG is as shown in SEQ ID NO:002; Cloning the optimized coding gene fragment of VapA or VapG into the Pichia pastoris expression vector pPICZαA to construct recombinant expression vectors pPICZαA-VapA or pPICZαA-VapG; Introducing the recombinant expression vector pPICZαA-VapA or pPICZαA-VapG into Pichia pastoris X33 competent cells by electroporation; The recombinant strains X33-pPICZαA-VapA or X33-pPICZαA-VapG were screened and obtained; The obtained recombinant strains X33-pPICZαA-VapA or X33-pPICZαA-VapG were amplified in BMGY medium; The amplified recombinant strains were transferred to BMMY medium for induced expression; The supernatant of induced expression was collected by centrifugation, and the recombinant protein VapA or the recombinant protein VapG was obtained by purification with Ni-IDA affinity chromatography; The purified recombinant protein VapA and / or the recombinant protein VapG were mixed with an adjuvant to obtain the Rhodococcus equi subunit vaccine.

Images