Method for improving protein yield and application

Abstract

The invention discloses a method for improving protein yield, which is mainly realized by screening intein variants, and the amino acid sequence of the intein variants is shown as any one of SEQ ID NO.2-4. The invention also discloses a coding gene and application of the intein variant and a corresponding fusion protein. The intein variant has the following functions of (1) promoting expression of a recombinant protein inclusion body, (2) remarkably enhancing the renaturation effect of recombinant protein, (3) remarkably improving the purity of the recombinant protein, and (4) reducing the proportion of a non-target protein part in fusion protein so as to improve the yield of the recombinant protein. The technical problems of low recombinant protein yield, difficulty in renaturation and the like in the existing recombinant protein production technology are solved, and the method has a good commercial application prospect.

Description

Technical Field

[0001] The present invention relates to a method and application for improving protein yield, belonging to the technical field of protein expression. Background Art

[0002] Escherichia coli is widely used in the acquisition of recombinant proteins due to its easy operation, clear genetic background, low production cost and high expression level. Inclusion bodies refer to aggregates formed in Escherichia coli due to the lack of suitable conditions for the correct folding of recombinant proteins. Inclusion bodies generally contain most of the recombinant proteins that have neither natural structure nor activity, as well as a small amount of bacterial proteins and other substances. They are in an amorphous state, have a relatively high density, and are generally insoluble in water. Although inclusion bodies have advantages such as being not easily decomposed by proteases in the bacteria and having a high expression level, the problem of how to convert inactive and misfolded insoluble proteins into active soluble proteins still troubles people, and their refolding efficiency is generally low.

[0003] Among all the crude purification steps, refolding (renaturation) is the most critical step, which determines the efficiency of the inclusion body-based process. Traditional inclusion body-based recombinant protein purification processes usually include (1) denaturation of inclusion bodies, (2) removal of denaturants, and (3) protein refolding. So far, many ideas have been developed to improve the refolding yield. On the one hand, it is aimed at the removal of denaturants and the optimization of physical conditions. For example, Pizarro et al. applied for a patent for a method. Inclusion bodies are denatured and dissolved under the condition that the pH is greater than 9, and refolded under strong alkaline conditions (pH 9-11) (Pizarro S, Sanchez A, Schmelzer CH. Refolding of recombinant proteins [P]. US20110294990, 2011.); on the other hand, the refolding yield is further improved by adding refolding additives. For example, ion exchange resins and size exclusion media are directly used as refolding additives, and it is found that the refolding rate using a gel matrix is significantly better than that of macroporous resins. However, due to the diversity of protein surfaces, no universal refolding tool for all proteins has been found yet.

[0004] In recent years, a class of inteins that can perform self-cleavage under specific conditions in vitro has been developed and applied to the separation and purification of recombinant proteins. Such inteins can form active inclusion bodies in Escherichia coli cells. After in vitro separation, they can perform self-cleavage under specific conditions (such as pH, temperature, etc.) to release bioactive recombinant proteins, which greatly improves the refolding efficiency of inclusion bodies. However, such inteins often undergo self-cleavage during the expression process, resulting in the loss of recombinant proteins, which greatly limits their application in industrial scale production.

[0005] Therefore, there is still a need in the art to develop more effective and general inclusion body refolding strategies to achieve simple large-scale production of exogenous recombinant proteins. Summary of the Invention

[0006] One object of the present invention is to provide an intein variant for improving protein yield.

[0007] The technical solution adopted by the present invention is as follows:

[0008] An intein variant, the amino acid sequence of which is shown in any one of SEQ ID NO.2-4.

[0009] The coding gene of the above-mentioned intein variant.

[0010] Preferably, the nucleotide sequence is shown in any one of SEQ ID NO.6-8.

[0011] Another object of the present invention is to provide the application of the above-mentioned intein variant in improving protein yield.

[0012] A fusion protein, comprising the above-mentioned intein variant and a target protein, wherein the target protein is located at the C-terminus of the intein variant.

[0013] Preferably, it further comprises a phase separation peptide and / or a linker peptide, the phase separation peptide and / or the linker peptide are located at the N-terminus of the intein variant, the phase separation peptide can be L6KD, and common phase separation peptides such as ELK16 can also be selected. The linker peptide can be PTlinker, and common linker peptides such as (GGGS)3linker can also be used. Finally, it is constructed as a phase separation peptide-linker peptide-intein variant-target protein.

[0014] The coding gene of the above-mentioned fusion protein.

[0015] An expression vector for expressing the above-mentioned fusion protein.

[0016] A host cell for expressing the above-mentioned fusion protein.

[0017] The host cell is selected from prokaryotes, yeasts and higher eukaryotic cells, wherein the prokaryotes include bacteria of the genera Escherichia, Bacillus, Salmonella, Halomonas, Pseudomonas and Streptomyces, and preferably Escherichia coli.

[0018] Another object of the present invention is to provide a method for improving protein yield, the steps of which include:

[0019] (1) Construct the above expression vector and transform it into a host cell;

[0020] (2) Culture the host cell to induce the expression of the fusion protein;

[0021] (3) Disrupt the host cell, centrifuge to obtain the precipitate. After subjecting the precipitate to protein refolding treatment, centrifuge to collect the supernatant, and enrich and purify it through a filter membrane to obtain the target protein.

[0022] Advantages of the present invention:

[0023] The intein variant of the present invention can not only significantly promote the expression of recombinant protein inclusion bodies, but also significantly reduce the loss rate of recombinant proteins during the refolding process, reduce the production cost of recombinant proteins, and improve the purity of the target protein. At the same time, it can reduce the proportion of non-target protein parts in the fusion protein, thereby increasing the yield of recombinant proteins. It is applicable to the production of various recombinant human proteins, laying a foundation for the high expression and efficient refolding of various recombinant protein inclusion bodies. The present invention solves the technical problems such as low yield and difficult refolding of recombinant proteins in the existing recombinant protein production technology, and has good commercial application prospects. Description of the Drawings

[0024] Figure 1 Plasmid map of pET30a-L6KD-PT linker-intein-target protein (fibronectin in the figure).

[0025] Figure 2 SDS-PAGE result diagram of inclusion body protein containing intein variant. Lane 1: Marker, Lane 2: Traditional intein; Lane 3: Intein variant 1, Lane 4: Intein variant 2, Lane 5: Intein variant 3.

[0026] Figure 3 SDS-PAGE result diagram of the target protein after refolding of inclusion body protein containing intein variant. Lane 1: Marker, Lane 2: Traditional intein; Lane 3: Intein variant 1, Lane 4: Intein variant 2, Lane 5: Intein variant 3.

[0027] Figure 4 SDS-PAGE result diagram of purified fibronectin. Lane 1: Marker, Lane 2: Traditional intein; Lane 3: Intein variant 1.

[0028] Figure 5SDS-PAGE result diagram of different recombinant human protein inclusion bodies containing intein variant 1. Lane 1: Marker, Lane 2: recombinant human filaggrin (intein variant 1); Lane 3: recombinant human filaggrin (conventional intein), Lane 4: recombinant human type III collagen (conventional intein), Lane 5: recombinant human type III collagen (intein variant 1).

[0029] Figure 6 SDS-PAGE result diagram of different recombinant human proteins after renaturation and purification. Lane 1: Marker, Lane 2: recombinant human filaggrin (conventional intein); Lane 3: recombinant human filaggrin (intein variant 1), Lane 4: recombinant human type III collagen (conventional intein), Lane 5: recombinant human type III collagen (intein variant 1), Lane 6: Marker. Detailed implementation mode

[0030] The present invention is further illustrated by the following examples, which shall not be construed as limiting the present invention. The specific materials used in the embodiments of the present invention and their sources are provided below. However, it should be understood that these are merely exemplary and are not intended to limit the present invention. Materials with the same or similar types, models, qualities, properties or functions as the following reagents and instruments can be used to implement the present invention. The experimental methods used in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0031] Example 1: Rational design of intein mutants and construction of vectors

[0032] (1) Rational design of intein mutants

[0033] The amino acid sequence of the traditional mini-intein is shown in SEQ ID NO.1. According to the alignment and search of the intein sequence, without affecting the function and structure of the mini-intein, multiple positions of the amino acid sequence of the mini-intein were streamlined (truncated), and the truncated parts were connected by a linker peptide, and saturation mutagenesis was performed at the connection sites to obtain intein variants 1-3, whose amino acid sequences are shown in SEQ ID NOs. 2-4 respectively. The coding DNA sequence of the traditional mini-intein is shown in SEQ ID NO.5, and the coding DNA sequences of the obtained intein variants 1-3 are shown in SEQ ID NOs. 6-8. At the same time, AlphaFold3 was used to predict the protein structures of the traditional intein and the intein variants and compare them. It was found that the tertiary structures of the intein proteins before and after rational design were highly similar, and the active center of the intein was not affected, and the original intein structure was still maintained.

[0034] (2) Construction of recombinant expression vectors

[0035] Taking the construction of an expression vector containing intein variant 1 (SEQ ID NO.2) as an example, using a traditional intein as a template, the intein variant fragment was amplified by PCR technology. The intein variant fragment, the target gene fragment, and the pET30a expression vector backbone containing the self-aggregating tag L6KD and the PT-type linker were ligated by Gibson assembly to construct a plasmid with an expression system of L6KD-PT-intein-target protein. The plasmid structural map is shown in Figure 1 . The construction process of the expression vectors of intein variants 2 and 3 is the same as that of intein variant 1. The role of the self-aggregating tag (phase separation peptide) is to form inclusion bodies of the fusion protein in vivo, which is conducive to the subsequent separation of inclusion bodies.

[0036] Table 1: PCR amplification primers

[0037] Primer Name Primer Sequence Vector F AGGCGTTGTGGTTCATAAC Vector R CCAGCGCGAATTCTGG M1-F CCAGAATTCGCGCTGG M1-R ACCGGTTTCGACGTCACGGACTGCAACACGGTCACCC M1-F2 GTCCGTGACGTCGAAACCGGTGAACTGCGTTACTCTGTTATCC M1-R2 GTTATGAACCACAACGCCT

[0038] Table 2: PCR amplification system

[0039]

[0040]

[0041] Prepare the PCR system, mix well and centrifuge. The PCR amplification conditions are as follows: the first stage is pre-denaturation at 98°C for 30 s; the second stage is denaturation at 98°C for 10 s, annealing at 50 - 72°C for 30 s, extension at 72°C for 30 s / kb, with 32 cycles; the third stage is final extension at 72°C for 2 min. Use a universal DNA purification kit (Tiangen Biochemical Technology Co., Ltd.) to recover the above vectors and gene fragments, and perform according to the operation steps of the product manual.

[0042] Table 3 Gibson assembly system

[0043] System Components Component Volume Gibson Assembly Master Mix(2X) 5μL Ligation Fragment 0.2–1pmols*XμL <![CDATA[dd H2O]]> (5-X)μL Total System 10μL

[0044] Mix the above components on ice and then place them in a 37°C water bath for 60 min. The obtained ligation product is stored on ice or at -20°C for subsequent competent cell transformation.

[0045] The ligation product was transformed into the host bacterium E. coli DH5α by heat shock method, spread on an LB culture resistant plate, and cultured overnight in a 37°C constant temperature incubator. Single colonies were picked for colony PCR. The initially obtained positive clones were transferred to an LB liquid medium and cultured overnight at 37°C and 220 rpm in a shaker. Plasmids were extracted using a plasmid rapid extraction kit. The successfully constructed plasmids were named M0 (traditional intein), M1 (intein variant 1), M2 (intein variant 2), and M3 (intein variant 3) respectively.

[0046] (3) Construction of engineered bacteria

[0047] The obtained recombinant expression plasmid was transferred into Escherichia coli BL21(DE3) competent cells by chemical transformation, and positive engineered bacteria were obtained through antibiotic plate screening. The specific process was as follows: ① Take 4 μL of the recombinant expression plasmid and add it to 100 μL of Escherichia coli competent cells BL21(DE3), and let it stand on ice for 30 min; ② Heat shock the mixture in a 42 °C water bath for 90 s, and then quickly place it on ice for 2 min; ③ Add 900 μL of antibiotic-free LB liquid medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride) to the mixture, and incubate it at 37 °C and 220 rpm in a shaker for 1 h; ④ Take 200 μL of the bacterial solution and evenly spread it on an LB solid medium plate containing ampicillin (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar, 100 μg / mL ampicillin); ⑤ Invert the plate and culture it in a 37 °C incubator for about 16 h. Wait until clear visible colonies grow, and the corresponding engineered strains EM0, EM1, EM2, and EM3 were obtained respectively. Example 2: Induced expression of engineered bacteria and detection of inclusion body yield

[0048] The single colonies on the above plate were placed in an LB liquid medium containing ampicillin antibiotic, cultured at 37 °C and 220 rpm for 10 hours. This was the primary seed solution. It was inoculated into a new LB medium containing ampicillin antibiotic at an inoculation amount of 1%, cultured overnight at 37 °C, inoculated into a new LB medium containing ampicillin antibiotic at an inoculation amount of 5%, cultured at 37 °C for 2 h, added IPTG with a final concentration of 0.5 mM, and induced expression at 18 °C for 16 hours. The cells were collected by centrifugation at 4000 g and 4 °C for 20 min.

[0049] Taking recombinant human fibronectin (FN, its sequence is shown in CN117186246A) as an example of the target protein, after the bacteria were resuspended in 1×PBS and washed 2 - 3 times, an equal volume of lysis buffer 1 (20 mM Tris-HCl, 1 mM EDTA, 500 mM NaCl, pH 8.5) was added for resuspension. 100× protease inhibitor PMSF was added. After the cells were lysed on ice using an ultrasonic cell disruptor, 1 mL of the lysate was centrifuged at 4 °C and 12,000 rpm for 2 min. 80 μL of the supernatant was taken, the precipitate was resuspended with 200 μL of lysis buffer, 80 μL of the resuspended solution was taken, and 20 μL of 5× protein loading buffer was added to both the supernatant and the precipitate. After mixing, it was heated in a boiling water bath for 10 min for SDS-PAGE, and stained with Coomassie Brilliant Blue R-250. The gel image was as Figure 2 shown. The gel image was analyzed by gray scale using imagej software, and the inclusion body protein yield is shown in Table 4:

[0050] Table 4 Inclusion body protein yield

[0051] Protein Protein Yield mg / L Traditional Intein (SEQ ID N0.1)-FN 389.2 Intein Variant 1 (SEQ ID N0.2)-FN 523.3 Intein Variant 2 (SEQ ID N0.3)-FN 562.7 Intein Variant 3 (SEQ ID N0.4)-FN 473.4

[0052] From Table 4 and Figure 2 it can be seen that the expression level of inclusion body protein in the intein variants is significantly higher than that of the traditional intein MtuΔI-CM, indicating that the intein variants can promote the expression of recombinant proteins.

[0053] Example 3: Renaturation and purity detection of inclusion bodies

[0054] Combined with the data in Table 4, the cells with confirmed protein expression harvested in Example 2 were diluted or concentrated to an inclusion body protein concentration of 400 mg / mL. 1 mL of the diluted or concentrated cells with confirmed protein expression harvested in Example 2 was taken, washed 2 - 3 times with 1×PBS, and then resuspended in Buffer 1 (20 mM Tris-HCl, 500 mM NaCl, 1 mM EDTA, pH 8.5). It was sonicated on ice using an ultrasonic crusher, centrifuged at 15,000 g and 4 °C for 20 min. The precipitate was washed twice with Buffer 1, and then resuspended with the same volume of Buffer 2 (PBS buffer supplemented with 40 mM Bis-Tris, 2 mM EDTA, pH 6.2), and incubated at 25 - 30 °C for 24 h for recombinant protein renaturation. The supernatant (target protein) was collected by centrifugation. 80 μL of the supernatant was added with 20 μL of 5× protein loading buffer, mixed and heated in a boiling water bath for 10 min for SDS-PAGE, and then stained with Coomassie Brilliant Blue R-250. The gel image is as Figure 3 shown. The gel image was analyzed by gray scale using ImageJ software. The protein yield and purity are shown in Table 5:

[0055] Table 5 Target protein yield and purity

[0056] Protein Protein Yield mg / L Purity % FN (Traditional Intein, SEQ ID N0.1) 273.2 96.4 FN (Intein Variant 1, SEQ ID N0.2) 342.4 99 FN (Intein Variant 2, SEQ ID N0.3) 351.7 99 FN (Intein Variant 3, SEQ ID N0.4) 344.1 99

[0057] From Table 5 and Figure 3 it can be seen that the yield of the target protein (FN) purified by the intein variants 1 - 3 is significantly higher than that of the traditional intein, indicating that the intein variants can significantly enhance the renaturation effect of inclusion body proteins. Taking fibronectin renatured by the intein variant 1 (SEQ ID NO.2) as an example, the supernatant protein solution was enriched and purified by a filter membrane, and the purified target protein with high purity was collected. 80 μL of the supernatant was added with 20 μL of 5× protein loading buffer, mixed and heated in a boiling water bath for 10 min for SDS-PAGE. The gel image was analyzed by gray scale using ImageJ software. The protein yield and purity are shown in Table 6:

[0058] Table 6 Target protein yield and purity

[0059] Protein Yield mg / L Purity % FN (Traditional Intein, SEQ ID N0.1) 169.3 99.9 FN (Intein Variant 1, SEQ ID N0.2) 239.7 99.9

[0060] The purification result of the target protein (fibronectin) is as Figure 4 shown. The experimental results show that the target protein band after purification by the intein variant is single and has high purity.

[0061] Example 4: Detection of biological activity of recombinant protein

[0062] Determination of the cell adhesion-promoting activity of the purified recombinant fibronectin. The purified recombinant fibronectin of the experimental group and the fibronectin of the positive control group (i.e., recombinant human fibronectin obtained by traditional intein expression) were added to a 96-well cell culture plate at concentrations of 1 μg / ml (low concentration) and 10 μg / ml (high concentration) respectively, and placed at 37°C for 2 h, with normal saline (50 μL) as the negative control. After digesting and counting mouse embryonic fibroblasts (BALB / c 3T3 cells) with trypsin, 5×10 4 cells were added to each well, and after culturing in a 37°C CO2 incubator for 2 h, they were washed 3 times with PBS to wash away the non-adherent cells, then 200 μL of DMEM medium was added, 10 μL of CCK-8 reagent was added to each well, and after incubating in a 37°C, 5% CO2 cell culture incubator for 2 h, it was taken out, and the absorbance values of the 96-well plate at 450 nm and 630 nm were read by an enzyme-linked immunosorbent assay reader. Using 630 nm as the reference wavelength, the absorbance was measured at 450 nm, the measurement results were recorded, and the cell adhesion promotion rate = (absorbance value at 450 nm of the experimental group - absorbance value at 450 nm of the negative control group) / absorbance value at 450 nm of the negative control group × 100%. The results are shown in Table 7.

[0063] Table 7 Detection results of the relative cell adhesion promotion rate of recombinant human fibronectin

[0064] Group Number of Wells Cell Adhesion Promotion Rate (%) Low Concentration Experimental Group (Intein Variant 1) 3 15.7±1.2 High Concentration Experimental Group (Intein Variant 1) 3 32.1±1.5 Low Concentration Experimental Group (Intein Variant 2) 3 15.1±1.3 High Concentration Experimental Group (Intein Variant 2) 3 31.4±1.6 Low Concentration Experimental Group (Intein Variant 3) 3 14.7±1.3 High Concentration Experimental Group (Intein Variant 3) 3 30.8±1.2 Low Concentration Positive Control Group (Traditional Intein) 3 14.9±1.9 High Concentration Positive Control Group (Traditional Intein) 3 31.2±1.7

[0065] The experimental results show that the recombinant human fibronectin purified by the intein variant of the present invention can promote cell proliferation, indicating that the recombinant human fibronectin purified by the intein variant of the present invention has its corresponding biological activity, and the effect is equivalent to that of fibronectin obtained by traditional intein refolding.

[0066] Example 5: Use of intein variants for the production of different recombinant human proteins

[0067] Taking the intein variant 1 (SEQ ID N0.2) as an example, recombinant human type III collagen (COL-III, CN117304306A) and recombinant human filaggrin (FLG, CN118344460A) were used as target proteins. According to the method in Example 1, the corresponding plasmids and engineering strains were constructed, and protein induction expression was carried out according to the method in Example 2. The inclusion body protein yields are shown in Table 8:

[0068] Table 8 Inclusion body protein yields

[0069]

[0070]

[0071] The results of inclusion body protein extraction are as Figure 5 shown. The results show that the intein variant 1 can significantly promote the expression of the inclusion body proteins of the target recombinant proteins (COL-III and FLG), thereby increasing the yields of the inclusion body proteins of the target recombinant proteins.

[0072] According to the method in the foregoing Example 3, the inclusion body proteins were renatured and purified. The yields and purities of the purified target proteins are shown in Table 9:

[0073] Table 9 Yields and purities of target proteins

[0074] Protein Protein Yield mg / L Purity % COL-III (Traditional Intein, SEQ ID N0.1) 153.4 99.9 COL-III (Intein Variant 1, SEQ ID N0.2) 207.3 99.9 FLG (Traditional Intein, SEQ ID N0.1) 147.5 99.9 FLG (Intein Variant 1, SEQ ID N0.2) 219.4 99.9

[0075] The results of purification after renaturation of inclusion body proteins are as Figure 6 shown. The experimental results show that the intein variant of the present invention can be applied to the production of various target proteins, and the purified target proteins have high purities.

Claims

1. An intein variant, characterized in that Its amino acid sequence is shown in any one of SEQ ID NO.2-4.

2. The coding gene of the intein variant according to claim 1.

3. The coding gene according to claim 2, characterized in that Its nucleotide sequence is shown in any one of SEQ ID NO.6-8.

4. The application of the intein variant according to claim 1 in improving protein yield.

5. A fusion protein, comprising the intein variant according to claim 1 and a target protein, wherein the target protein is located at the C-terminus of the intein variant.

6. The fusion protein according to claim 5, characterized in that It further comprises a phase separation peptide and / or a linker peptide, and the phase separation peptide and / or the linker peptide are located at the N-terminus of the intein variant.

7. The coding gene of the fusion protein according to claim 5 or 6.

8. An expression vector for expressing the fusion protein according to claim 5 or 6.

9. A host cell expressing the fusion protein according to claim 5 or 6.

10. A method for improving protein yield, characterized in that The steps thereof include: (1) Construct the expression vector according to claim 8 and transform it into a host cell; (2) Culture the host cell to induce the expression of the fusion protein; (3) Lyse the host cell, centrifuge to obtain the precipitate, subject the precipitate to protein renaturation treatment, then centrifuge to collect the supernatant, and enrich and purify the supernatant through a filter membrane to obtain the target protein.

Images