A method for improving protein yield and uses thereof

By improving the inclusion peptide variant and fusion protein strategy, the problem of low refolding efficiency of recombinant protein inclusion bodies has been solved, achieving efficient expression and purification, which is suitable for the industrial-scale production of a variety of recombinant proteins.

CN120365385BActive Publication Date: 2026-06-12广东普言生物科技有限公司
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
广东普言生物科技有限公司
Filing Date
2025-04-21
Publication Date
2026-06-12

Smart Images

  • Figure CN120365385B_ABST
    Figure CN120365385B_ABST
Patent Text Reader

Abstract

The application discloses a method for improving protein yield, which is mainly realized by screening an intron peptide variant, and the amino acid sequence of the intron peptide variant is shown in any one of SEQ ID NO. 2-4. The application also discloses a coding gene and application of the intron peptide variant and a corresponding fusion protein. The intron peptide variant has the following functions: (1) promoting the expression of a recombinant protein inclusion body, (2) being capable of significantly enhancing the renaturation effect of the recombinant protein, (3) being capable of significantly improving the purity of the recombinant protein, and (4) being capable of simultaneously reducing the proportion of a non-target protein part in the fusion protein, thereby improving the yield of the recombinant protein. The application solves the technical problems of low yield and renaturation difficulty of the recombinant protein in the existing recombinant protein production technology, and has a good commercial application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method and application for improving protein yield, belonging to the field of protein expression technology. Background Technology

[0002] Escherichia coli is widely used for obtaining recombinant proteins due to its ease of handling, clear genetic background, low production cost, and high expression levels. Inclusion bodies are aggregates formed within E. coli where suitable conditions for the correct folding of recombinant proteins are lacking. Inclusion bodies generally contain mostly recombinant proteins that lack both native structure and activity, along with small amounts of bacterial proteins and other substances. They are in an amorphous state, have a high density, and are generally poorly soluble in water. Although inclusion bodies have advantages such as being less susceptible to degradation by bacterial proteases and having high expression levels, the challenge of converting inactive, misfolded, insoluble proteins into active, soluble proteins remains. Furthermore, their refolding efficiency is generally low.

[0003] Of all the crude purification steps, refolding is the most critical, determining the efficiency of inclusion body-based processes. Traditional inclusion body-based recombinant protein purification processes typically include (1) inclusion body denaturation, (2) denaturant removal, and (3) protein refolding. To date, many approaches have been developed to improve refolding yield. On the one hand, these approaches focus on the removal of denaturants and optimization of physical conditions. For example, Pizarro et al. have patented a method in which inclusion bodies are denatured and dissolved at pH greater than 9 and then refolded under strongly alkaline conditions (pH 9-11) (Pizarro S, Sanchez A, Schmelzer CH. Refolding of recombinant proteins [P]. US20110294990, 2011.). On the other hand, refolding yield can be further improved by adding refolding additives, such as using ion exchange resins and size exclusion media directly as refolding additives. It has been found that the refolding rate using gel matrices is significantly better than that using macroporous resins. However, due to the diversity of protein surfaces, no universal refolding tool has yet been discovered for all proteins.

[0004] In recent years, a class of integument peptides capable of autocleavage under specific in vitro conditions has been developed for the isolation and purification of recombinant proteins. These integument peptides can form active inclusion bodies within E. coli cells, and after in vitro separation, they can autocleave under specific conditions (such as pH and temperature) to release biologically active recombinant proteins, which greatly improves the refolding efficiency of inclusion bodies. However, these integument peptides often undergo autocleavage during expression, leading to the loss of recombinant proteins, which greatly limits their application in industrial-scale production.

[0005] Therefore, there is still a need in the field to develop more effective and universal inclusion body refolding strategies to achieve simple, large-scale production of exogenous recombinant proteins. Summary of the Invention

[0006] One of the objectives of this invention is to provide an in-cell peptide variant for improving protein yield.

[0007] The technical solution adopted in this invention is as follows:

[0008] An intima-peptide variant having an amino acid sequence as shown in any one of SEQ ID NO.2-4.

[0009] The genes encoding the aforementioned inteptide variants.

[0010] Preferably, its nucleotide sequence is shown in any one of SEQ ID NO.6-8.

[0011] Another object of the present invention is to provide the application of the above-described in-containment peptide variants in improving protein yield.

[0012] A fusion protein comprising the aforementioned intein variant and a target protein, wherein the target protein is located at the C-terminus of the intein variant.

[0013] Preferably, it further comprises a phase-separating peptide and / or a linking peptide, wherein the phase-separating peptide and / or the linking peptide is located at the N-terminus of the intended peptide variant. The phase-separating peptide may be L6KD, or may be a commonly used phase-separating peptide such as ELK16. The linking peptide may be PTlinker, or may be a commonly used linking peptide such as (GGGS)3linker. The final structure is a phase-separating peptide-linking peptide-intended peptide variant-target protein.

[0014] The gene encoding the aforementioned fusion protein.

[0015] An expression vector for expressing the aforementioned fusion protein.

[0016] A host cell that expresses the aforementioned fusion protein.

[0017] The host cell is selected from prokaryotes, yeast, and higher eukaryotic cells, wherein the prokaryotes include bacteria of the genera Escherichia, Bacillus, Salmonella, Halomonas, Pseudomonas, and Streptomyces, with Escherichia coli being preferred.

[0018] Another object of the present invention is to provide a method for improving protein yield, the steps of which include:

[0019] (1) Construct the above expression vector and transform it into host cells;

[0020] (2) Culture host cells to induce fusion protein expression;

[0021] (3) The host cells were broken, the precipitate was collected by centrifugation, the precipitate was subjected to protein refolding treatment, the supernatant was collected by centrifugation, and the target protein was obtained by enrichment and purification by filter membrane.

[0022] The beneficial effects of this invention are:

[0023] The peptide variants of this invention not only significantly promote the expression of recombinant protein inclusion bodies but also significantly reduce the loss rate of recombinant proteins during refolding, lower the production cost of recombinant proteins, and improve the purity of the target protein. Simultaneously, they reduce the proportion of non-target protein components in the fusion protein, thereby increasing the yield of recombinant proteins. This invention is applicable to the production of various recombinant human proteins, laying the foundation for high expression and efficient refolding of various recombinant protein inclusion bodies. This invention solves the technical problems of low recombinant protein yield and difficult refolding in existing recombinant protein production technologies, and has good commercial application prospects. Attached Figure Description

[0024] Figure 1 Plasmid map of pET30a-L6KD-PT linker-included peptide-target protein (fibronectin in the figure).

[0025] Figure 2 SDS-PAGE results of inclusion body proteins containing inteptide variants. Channel 1: Marker; Channel 2: Conventional inteptide; Channel 3: Inteptide variant 1; Channel 4: Inteptide variant 2; Channel 5: Inteptide variant 3.

[0026] Figure 3 SDS-PAGE results of the target protein after refolding of inclusion body protein containing inteptide variants. pore 1: marker; pore 2: conventional inteptide; pore 3: inteptide variant 1; pore 4: inteptide variant 2; pore 5: inteptide variant 3.

[0027] Figure 4 Image of purified fibronectin SDS-PAGE. Channel 1: Marker; Channel 2: Conventional intima-peptide; Channel 3: Intima-peptide variant 1.

[0028] Figure 5SDS-PAGE results of inclusion bodies of different recombinant human proteins containing peptide variant 1. Well 1: Marker; Well 2: Recombinant human filaggrin (includes peptide variant 1); Well 3: Recombinant human filaggrin (traditional inclusion peptide); Well 4: Recombinant human type III collagen (traditional inclusion peptide); Well 5: Recombinant human type III collagen (includes peptide variant 1).

[0029] Figure 6 SDS-PAGE results of different recombinant human proteins after refolding and purification. Well 1: Marker; Well 2: Recombinant human filaggrin (conventional intended peptide); Well 3: Recombinant human filaggrin (intended peptide variant 1); Well 4: Recombinant human type III collagen (conventional intended peptide); Well 5: Recombinant human type III collagen (intended peptide variant 1); Well 6: Marker. Detailed Implementation

[0030] The present invention is further illustrated below by way of examples, but is not intended to limit the invention. Specific materials used in the embodiments of the present invention and their sources are provided below. However, it should be understood that these are merely exemplary and not intended to limit the invention. Materials of the same or similar type, model, quality, properties, or function as the reagents and instruments described below can be used to implement the present invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials, reagents, etc., used in the following examples are commercially available.

[0031] Example 1: Rational Design and Vector Construction of Intended Peptide Mutants

[0032] (1) Rational design of peptide mutants

[0033] The amino acid sequence of a traditional microintegrant is shown in SEQ ID NO. 1. Based on sequence alignment and searching, the amino acid sequence of the microintegrant was shortened at multiple positions without affecting its function and structure. The shortened positions were linked by linker peptides, and saturation mutations were performed at the linker sites to obtain integrant variants 1-3, whose amino acid sequences are shown in SEQ ID NO. 2-4, respectively. The encoding DNA sequence of the traditional microintegrant is shown in SEQ ID NO. 5, and the encoding DNA sequences of the obtained integrant variants 1-3 are shown in SEQ ID NO. 6-8. Simultaneously, AlphaFold3 was used to predict and compare the protein structures of the traditional integrant and the integrant variants. It was found that the tertiary structures of the integrant proteins before and after rational design were highly similar, and the active site of the integrant was not affected, maintaining its original structure.

[0034] (2) Construction of recombinant expression vectors

[0035] Taking the construction of the expression vector for inteptide variant 1 (SEQ ID NO.2) as an example, using a traditional inteptide as a template, the inteptide variant fragment was amplified by PCR. The inteptide variant fragment, the target gene fragment, and the pET30a expression vector backbone containing the self-aggregating tag L6KD and the PT-type adapter were ligated using Gibson assembly to construct an expression system of L6KD-PT-inteptide-target protein plasmid. The plasmid structure map is shown below. Figure 1 The expression vectors for peptide variants 2 and 3 are constructed in the same manner as for peptide variant 1. The self-aggregating tag (phase-separating peptide) serves to facilitate the formation of inclusion bodies in vivo, making subsequent separation of these inclusion bodies easier.

[0036] Table 1: Primers for PCR amplification

[0037] Primer name Primer sequence Carrier F AGGCGTTGTGGTTCATAAC Carrier R CCAGCGCGAATTCTGG M1-F CCAGAATTCGCGCTGG M1-R ACCGGTTTCGACGTCACGGACTGCAACACGGTCACCC M1-F2 GTCCGTGACGTCGAAACCGGTGAACTGCGTTACTCTGTTATCC M1-R2 GTTATGAACCACAACGCCT

[0038] Table 2: PCR amplification system

[0039]

[0040]

[0041] Prepare the PCR system, mix well and centrifuge. The PCR amplification conditions are as follows: Stage 1: 98℃ pre-denaturation for 30s; Stage 2: 98℃ denaturation for 10s, 50-72℃ annealing for 30s, 72℃ extension for 30s / kb, 32 cycles; Stage 3: 72℃ final extension for 2min. The vector and gene fragments were recovered using a universal DNA purification kit (Tiangen Biotech Co., Ltd.), following the instructions in the product manual.

[0042] Table 3 Gibson Assembly System

[0043] System components Component volume Gibson Assembly Master Mix(2X) 5μL Connecting fragments 0.2–1 pmols*XμL <![CDATA[dd H2O]]> (5-X)μL Overall system 10μL

[0044] After mixing the above components on ice, place them in a 37°C heat bath for 60 minutes. Store the resulting ligation product on ice or at -20°C for subsequent competent cell transformation.

[0045] The ligation product was transformed into the host bacterium *E. coli* DH5α using a heat shock method, plated onto LB agar plates, and incubated overnight at 37°C. Single clones were picked for colony PCR. The initially obtained positive clones were transferred to LB liquid medium and incubated overnight on a shaker at 37°C and 220 rpm. Plasmids were extracted using a rapid plasmid extraction kit. The successfully constructed plasmids were named M0 (traditional inteptide), M1 (inteptide variant 1), M2 (inteptide variant 2), and M3 (inteptide variant 3), respectively.

[0046] (3) Construction of engineered bacteria

[0047] The recombinant expression plasmid obtained above was transformed into *E. coli* BL21(DE3) competent cells via chemical transformation. Positive engineered bacteria were obtained by screening with antibiotic plates. The specific procedure was as follows: ① 4 μL of the recombinant expression plasmid was added to 100 μL of *E. coli* BL21(DE3) competent cells and incubated on ice for 30 min; ② The mixture was heat-shocked in a 42℃ water bath for 90 s, then quickly placed on ice for 2 min; ③ 900 μL of antibiotic-free LB liquid medium (10 g / L peptone, 5 g...) was added to the mixture. / L yeast extract, 10g / L sodium chloride), and incubate at 37℃ and 220rpm for 1h; ④ Take 200μL of this bacterial solution and spread it evenly on LB solid medium plates containing ampicillin (10g / L peptone, 5g / L yeast extract, 10g / L sodium chloride, 15g / L agar, 100μg / mL ampicillin); ⑤ Invert the plates and incubate at 37℃ for about 16h until clearly visible colonies grow, obtaining the corresponding engineered strains EM0, EM1, EM2, and EM3. Example 2: Induction expression of engineered bacteria and detection of inclusion body yield

[0048] Single colonies from the above plates were placed in LB broth containing ampicillin and incubated at 37°C and 220 rpm for 10 hours. This was the primary seed culture. A 1% inoculum was then added to fresh LB broth containing ampicillin and incubated overnight at 37°C. A 5% inoculum was then added to fresh LB broth containing ampicillin and incubated at 37°C for 2 hours. IPTG was then added to a final concentration of 0.5 mM and the culture was incubated at 18°C ​​for 16 hours. The bacterial cells were collected by centrifugation at 4000g and 4°C for 20 minutes.

[0049] Taking recombinant human fibronectin (FN, sequence shown in CN117186246A) as the target protein, the bacterial cells were resuspended in 1×PBS and washed 2-3 times. Then, an equal volume of lysis buffer 1 (20mM Tris-HCl, 1mM EDTA, 500mM NaCl, pH 8.5) was added for resuspending. 100× protease inhibitor PMSF was added, and the cells were lysed on ice using an ultrasonic homogenizer. 1 mL of the lysate was centrifuged at 4℃ and 12000 rpm for 2 min. 80 μL of the supernatant was collected, and the precipitate was resuspended in 200 μL of lysis buffer. 80 μL of the resuspended precipitate was collected, and 20 μL of 5× protein loading buffer was added to both the supernatant and the precipitate. The mixture was then heated in a boiling water bath for 10 min for SDS-PAGE. Staining with Coomassie Brilliant Blue R-250 was performed. The gel image is shown below. Figure 2 As shown in Table 4, grayscale analysis gel images were generated using ImageJ software, and the inclusion body protein yields are listed below.

[0050] Table 4 Inclusion body protein yield

[0051] protein Protein yield (mg / L) Traditional in-cell peptide (SEQ ID NO.1)-FN 389.2 Including peptide variant 1 (SEQ ID NO.2)-FN 523.3 Including peptide variant 2 (SEQ ID NO.3)-FN 562.7 Including peptide variant 3 (SEQ ID NO.4)-FN 473.4

[0052] From Table 4 and Figure 2 It can be seen that the expression level of inclusion body protein in the inteptide variant is significantly higher than that of the traditional inteptide MtuΔI-CM, indicating that the inteptide variant can promote the expression of recombinant protein.

[0053] Example 3: Refolding and Purity Detection of Inclusion Bodies

[0054] Based on the data in Table 4, dilute or concentrate the cells with confirmed protein expression obtained in Example 2 to a concentration of 400 mg / mL for inclusion body protein. Take 1 mL of each diluted or concentrated cell from Example 2, wash 2-3 times with 1×PBS, resuspend in buffer 1 (20 mM Tris-HCl, 500 mM NaCl, 1 mM EDTA, pH 8.5), and sonicate on ice using an ultrasonic homogenizer. Centrifuge at 15,000 g, 4 °C for 20 min. Wash the precipitate twice with buffer 1, and then resuspend in the same volume of buffer 2 (PBS buffer with 40 mM Bis-Tris, 2 mM EDTA, pH 6.2). Incubate at 25-30 °C for 24 h to refold the recombinant protein. Centrifuge to collect the supernatant (target protein). Take 80 μL of the supernatant and add 20 μL of 5× protein loading buffer. Mix well and heat in a boiling water bath for 10 min before performing SDS-PAGE. Then stain with Coomassie Brilliant Blue R-250. The gel image is shown below. Figure 3 As shown in Table 5, grayscale analysis gel images were generated using ImageJ software, and protein yield and purity were obtained.

[0055] Table 5. Target protein yield and purity

[0056] protein Protein yield (mg / L) purity% FN (traditional inteptide, SEQ ID NO.1) 273.2 96.4 FN (includes peptide variant 1, SEQ ID NO.2) 342.4 99 FN (includes peptide variant 2, SEQ ID NO.3) 351.7 99 FN (includes peptide variant 3, SEQ ID NO.4) 344.1 99

[0057] From Table 5 and Figure 3 It was found that the yield of the target protein (FN) purified by inteptide variants 1-3 was significantly higher than that of the traditional inteptide, indicating that the inteptide variants can significantly enhance the refolding effect of inclusion body proteins. Taking fibronectin obtained by refolding with inteptide variant 1 (SEQ ID NO.2) as an example, its supernatant protein solution was subjected to membrane enrichment and purification. The purified target protein with high purity was collected. 80 μL of supernatant was added to 20 μL of 5× protein loading buffer, mixed, and heated in a boiling water bath for 10 min for SDS-PAGE. Grayscale analysis gel images were generated using ImageJ software. The protein yield and purity are shown in Table 6.

[0058] Table 6. Target protein yield and purity

[0059] protein Production (mg / L) purity% FN (traditional inteptide, SEQ ID NO.1) 169.3 99.9 FN (includes peptide variant 1, SEQ ID NO.2) 239.7 99.9

[0060] The purification results of the target protein (fibronectin) are as follows: Figure 4 As shown, the experimental results indicate that the target protein purified by containing peptide variants has a single band and high purity.

[0061] Example 4: Detection of recombinant protein bioactivity

[0062] The cell adhesion-promoting activity of purified recombinant fibronectin was measured. Purified recombinant fibronectin from the experimental group and fibronectin from the positive control group (i.e., recombinant human fibronectin obtained through conventional intima-side expression) were added to 96-well cell culture plates at concentrations of 1 μg / ml (low concentration) and 10 μg / ml (high concentration), respectively. The plates were incubated at 37°C for 2 h, with physiological saline (50 μL) as a negative control. Mouse embryonic fibroblasts (BALB / c 3T3 cells) were digested with trypsin and counted; 5 × 10⁶ cells were added to each well. 4 Cells were cultured in a 37℃ CO2 incubator for 2 hours, then washed three times with PBS to remove unadhered cells. 200 μL of LMEM medium was added to each well, along with 10 μL of CCK-8 reagent. The cells were incubated in a 37℃, 5% CO2 cell culture incubator for 2 hours. The absorbance of the 96-well plate at 450 nm and 630 nm was read using a microplate reader. Using 630 nm as the reference wavelength, the absorbance at 450 nm was measured. The results were recorded. Cell adhesion promotion rate = (Experimental group 450 nm absorbance - Negative control group 450 nm absorbance) / Negative control group 450 nm absorbance × 100%. The results are shown in Table 7.

[0063] Table 7 Results of the relative cell adhesion promotion rate of recombinant human fibronectin

[0064] Group Number of holes Cell adhesion promotion rate (%) Low concentration experimental group (containing peptide variant 1) 3 15.7±1.2 High-concentration experimental group (containing peptide variant 1) 3 32.1±1.5 Low concentration experimental group (containing peptide variant 2) 3 15.1±1.3 High-concentration experimental group (containing peptide variant 2) 3 31.4±1.6 Low concentration experimental group (containing peptide variant 3) 3 14.7±1.3 High-concentration experimental group (containing peptide variant 3) 3 30.8±1.2 Low-concentration positive control group (traditional intended peptides) 3 14.9±1.9 High-concentration positive control group (traditional peptide-containing peptides) 3 31.2±1.7

[0065] Experimental results show that the recombinant human fibronectin obtained by purification of the peptide variant of the present invention can promote cell proliferation, indicating that the recombinant human fibronectin obtained by purification of the peptide variant of the present invention has its corresponding biological activity, and the effect is comparable to that of fibronectin obtained by conventional peptide refolding.

[0066] Example 5: In-cell peptide variants used in the production of different recombinant human proteins

[0067] Taking inclusion peptide variant 1 (SEQ ID NO.2) as an example, recombinant human type III collagen (COL-III, CN117304306A) and recombinant human filaggrin (FLG, CN118344460A) were used as target proteins. Corresponding plasmids and engineered strains were constructed according to the method in Example 1, and protein expression was induced according to the method in Example 2. The inclusion body protein yield is shown in Table 8.

[0068] Table 8 Inclusion body protein yield

[0069]

[0070]

[0071] Inclusion body protein extraction results are as follows Figure 5 As shown, the results indicate that the in-peptide variant 1 can significantly promote the expression of inclusion body proteins of the target recombinant proteins (COL-III and FLG), thereby increasing the yield of the inclusion body proteins of the target recombinant proteins.

[0072] The inclusion body protein was refolded and purified according to the method described in Example 3 above. The yield and purity of the purified target protein are shown in Table 9.

[0073] Table 9. Target protein yield and purity

[0074] protein Protein yield (mg / L) purity% COL-III (traditional inteptide, SEQ ID NO.1) 153.4 99.9 COL-III (inclusion peptide variant 1, SEQ ID NO.2) 207.3 99.9 FLG (conventional inteptide, SEQ ID NO.1) 147.5 99.9 FLG (includes peptide variant 1, SEQ ID NO.2) 219.4 99.9

[0075] The purification results of inclusion body proteins after refolding are as follows: Figure 6 As shown, experimental results indicate that the peptide variants of the present invention can be applied to the production of various target proteins, and the purified target proteins have high purity.

Claims

1. An endogenous peptide variant, characterized in that... Its amino acid sequence is shown in SEQ ID NO.3 or 4.

2. The gene encoding the peptide variant of claim 1.

3. The encoding gene according to claim 2, characterized in that... Its nucleotide sequence is shown in SEQ ID NO.7 or 8.

4. Application of in-cell peptide variants in improving protein yield, wherein the amino acid sequence of the in-cell peptide variant is shown in any one of SEQ ID NO. 2-4.

5. A fusion protein comprising an intipeptide variant and a target protein, the target protein being located at the C-terminus of the intipeptide variant, wherein the amino acid sequence of the intipeptide variant is as shown in any one of SEQ ID NO. 3-4.

6. The fusion protein according to claim 5, characterized in that... It also contains phase-separating peptides and / or linking peptides located at the N-terminus of the contained peptide variant.

7. The gene encoding the fusion protein of claim 5 or 6.

8. An expression vector for expressing the fusion protein of claim 5 or 6.

9. A host cell expressing the fusion protein of claim 5 or 6.

10. A method for improving protein yield, characterized in that... The steps include: (1) Construct the expression vector as described in claim 8 and transform it into a host cell; (2) Culture host cells to induce fusion protein expression; (3) Break the host cells, centrifuge to collect the precipitate, perform protein refolding treatment on the precipitate, centrifuge to collect the supernatant, and filter membrane to enrich and purify to obtain the target protein.

Citation Information

Patent Citations

  • Recombinant fibronectin Pro. FN as well as preparation method and application thereof

    CN117186246A

  • Dipeptide receptor stimulant as well as preparation method and application thereof

    CN117264081A