Apple botryosphaeria dothidea effect protein BdNIS1 as well as coding gene and application thereof

Abstract

The invention provides a botryosphaeria dothidea effect protein BdNIS1 as well as a coding gene and application thereof. The amino acid sequence of the botryosphaeria dothidea effect protein BdNIS1 is shown as SEQ ID NO.1, and the nucleotide sequence of the coding gene of the botryosphaeria dothidea effect protein BdNIS1 is shown as SEQ ID NO.2 Research finds that after the BdNIS1 gene is knocked out, the growth of the botryosphaeria dothidea is not influenced, the stress resistance and the cell wall integrity of the botryosphaeria dothidea are not influenced, but the pathogenicity of the botryosphaeria dothidea to apple fruits and branches is remarkably reduced, so that the BdNIS1 is a key pathogenic gene in the botryosphaeria dothidea infection process. The BdNIS1 is transiently expressed in nicotiana benthamiana, PCD reaction caused by Bax in nicotiana benthamiana leaf cells can be inhibited, and infection of pathogenic bacteria to plants is promoted. The invention has important significance for analyzing the molecular mechanism related to the physalospora piricola and establishing the comprehensive prevention and control technical strategy of the physalospora piricola.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to an effector protein BdNIS1 of Botryosphaeria dothidea ( Botryosphaeria dothidea ), its encoding gene and applications. Background Art

[0002] Apples and their related industries play an important role in China's agricultural economy. At present, apples from Luochuan in Shaanxi, Wafang in Liaoning, Lingbao in Henan, Yantai in Shandong and Aksu in Xinjiang have been sold far and wide at home and abroad. In recent years, due to abnormal global climate changes and the large-scale promotion of ring rot-susceptible varieties such as Fuji and Golden Delicious in China, apple ring rot has caused huge losses to China's apple industry every year. This disease is composed of various pathogenic bacteria of the genus Botryosphaeria, among which Botryosphaeria dothidea ( Botryosphaeria dothidea ), is the main pathogenic bacterium. B. dothidea It can not only infect the branches to form rough bark or ulcer symptoms, seriously weakening the tree vigor and reducing the quality and quantity of fruits. At the same time, it can also damage the fruits during storage, causing the fruits to rot and deteriorate, resulting in serious economic losses. At present, chemical control methods are mainly used to control this disease. However, the extensive use of chemical agents not only pollutes the environment, but also enhances the drug resistance of pathogenic bacteria, and the pesticide residues on fruits also pose a threat to the health of consumers. Therefore, to fundamentally control this disease, it is necessary to deeply explore the infection mechanism of Botryosphaeria dothidea ( B. dothidea ), and on the basis of enhancing the understanding of this type of pathogenic bacteria, continuously inspire new inspirations for the integrated prevention and control of this type of disease.

[0003] Effector proteins are also known as effector molecules, effector factors or effectors, and play an important role in the interaction between pathogenic bacteria and host plants. When the host plant contains a resistance protein (Resistance protein, R) corresponding to the effector protein of the pathogenic bacteria, the effector protein will trigger the plant's defense response (Effector-triggered immunity, ETI). At this time, the effector protein is also called an avirulence protein (Avirulence protein, AVR). When the host plant does not contain the corresponding resistance protein, the effector protein will exhibit toxic functions, inhibit the plant's immune response, thereby promoting the infection of pathogenic bacteria and causing the host plant to become diseased. Therefore, effector proteins are on the one hand the key weapons for plant pathogenic bacteria to successfully infect host plants, and on the other hand, important targets for the plant immune system to recognize the invasion of pathogenic bacteria. The research on the functions of effector genes and effector proteins of plant pathogenic bacteria will strongly promote people's understanding of the pathogenic mechanisms of pathogenic bacteria and the molecular mechanisms of host plant disease resistance.

[0004] In recent years, numerous studies have found that the necrosis-inducing secreted protein NIS1 (Necrosis-inducing secreted protein 1) plays an important role in the pathogenic process of plant pathogenic fungi. Yoshino et al. (Cell Death of Nicotiana benthamiana Is Induced by Secreted Protein NIS1 of Colletotrichum orbiculare and Is Suppressed by a Homologue of CgDN3. Molecular plant-microbe interactions : MPMI, 2012, 25(5):625. DOI:10.1094 / MPMI-12-11-0316.) found that Colletotrichum orbicu-lare and C. higginsianum contain NIS1-like genes CoNIS1 and ChNIS1 , and the proteins encoded by them can trigger programmed cell death in the leaves of Nicotiana benthamiana ( Nicotiana benthamiana ). At the same time, they also have the ability to inhibit cell death triggered by INF1 (Inducin) and various immune responses induced by PAMPs (Pathogen-associated molecular patterns), thereby promoting the infection of the host by the pathogen. The MoNIS1 protein of Magnaporthe oryzae ( M. oryzae ) does not have the activity of inducing cell death, but it has the activity of inhibiting the plant innate immune response. CtNIS1 of Colletotrichum tofieldiae ( C. tofieldiae ) can inhibit the PTI (Pattern-triggered immunity) response of Arabidopsis thaliana, which may be one of the main reasons for its establishment of a mutualistic relationship with Arabidopsis thaliana. The FvNIS1 protein of Fusarium virguliforme, the pathogen of sudden death syndrome of soybean ( Fusarium virguliforme ), can cause cell death in soybean leaves and is considered an effector protein with phytotoxin-like properties. Nie et al. (Two NIS1-like proteins from apple canker pathogen (Valsa mali) play distinct roles in plant recognition and pathogen virulence. Stress Biology, 2022, 2:1-15. DOI:10.1007 / s44154-021-00031-0.) in Valsa mali ( Valsa maliTwo NIS1-like proteins, VmNIS1 and VmNIS2, were found in Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide an effector protein BdNIS1 of Botryosphaeria berengeriana de Not. B. dothidea ), its encoding gene and application, which are of great significance for studying the pathogenic mechanism of Botryosphaeria berengeriana de Not. and the integrated control of ring rot of apple.

[0006] To solve the above technical problems, the technical solution adopted by the present invention is: an effector protein BdNIS1 of Botryosphaeria berengeriana de Not., the amino acid sequence of the effector protein BdNIS1 is shown in SEQ ID NO.1, and its encoding gene BdNIS1 has a nucleotide sequence shown in SEQ ID NO.2.

[0007] The present invention also provides an expression cassette, recombinant vector or recombinant bacterium containing the BdNIS1 gene.

[0008] The present invention also provides the application of the effector protein BdNIS1 of Botryosphaeria berengeriana de Not. or the BdNIS1 gene, or the expression cassette, recombinant vector or recombinant bacterium containing the BdNIS1 gene in the control of ring rot of apple.

[0009] The present invention has significant technical effects compared with the prior art: 1. The present invention provides a new effector protein BdNIS1 of Botryosphaeria berengeriana de Not. B. dothidea ), its encoding gene and application, which are of great significance for analyzing the related molecular mechanisms of Botryosphaeria berengeriana de Not. and establishing technical strategies for the integrated control of ring rot of apple.

[0010] 2. By using the principle of homologous recombination, the present invention knocked out the B. dothidea gene of Botryosphaeria berengeriana de Not. BdNIS1 to obtain a BdNIS1 gene deletion mutant Δ BdNIS1 . Through the growth assay of transformants, it was found that the deletion of the BdNIS1 gene affected vegetative growth. Further stress tests showed that the deletion of the BdNIS1 gene did not affect the stress resistance and cell wall integrity of Botryosphaeria berengeriana de Not. However, the pathogenicity test of transformants found that Δ BdNIS1The pathogenicity to apple fruits and branches was significantly reduced, indicating that BdNIS1 It is a key pathogenic gene in the infection process of apple ring rot fungus, which is involved in the expansion of lesions after infecting plants and plays a key role in the infection process of apple ring rot fungus in plants.

[0011] 3. Transient expression of BdNIS1 in Nicotiana benthamiana can inhibit the PCD reaction induced by Bax in Nicotiana benthamiana leaf cells. Further inoculation of tobacco phytophthora and combined with tissue staining revealed that BdNIS1 can inhibit the PCD reaction induced by Bax in plant cells by inhibiting the O2 - and H2O2 bursts to promote the infection of pathogens to plants.

[0012] The present invention is further described in detail below with reference to the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 It is embodiment 2 of the present invention BdNIS1 Schematic diagram of gene targeted knockout; Figure 2 In Example 2 of the present invention BdNIS1 Construction of gene knockout cassette and mutant detection results, including (a) electrophoresis of one round of fusion fragment PCR amplification, (b) electrophoresis of three rounds of transformation fragment PCR amplification, (c) electrophoresis of knockout mutant detection; Figure 3 In Example 2 of the present invention BdNIS1 Results of gene complementation transformant detection, including (a) electrophoresis of complementation transformant detection, (b) fluorescence observation of mycelium of complementation strain, and (c) RT-PCR test of target gene of complementation transformant; Figure 4 The wild type (WT) of apple ring rot pathogen in Example 2 of the present invention, BdNIS1 Gene knockout (Δ BdNIS1 ), complement mutants ( BdNIS1- C) Analysis of pathogenicity on apple branches and fruits, including: (a) branch pathogenicity detection (10 dpi), the bar graph is the statistics of lesion area (**, P<0.01); (b) fruit pathogenicity detection (3 dpi), the bar graph is the statistics of lesion area (**, P<0.01); Figure 5 The wild type (WT) of apple ring rot pathogen in Example 2 of the present invention, BdNIS1 Gene knockout (Δ BdNIS1 ), complement mutants ( BdNIS1- C) Analysis of growth in four culture media: PDA, CM, MM, and OM. (a) Growth status, (b) Colony diameter statistics (P<0.05); Figure 6This is the analysis of stress tolerance of the wild type (WT), BdNIS1 gene knockout (Δ BdNIS1 ), and complementation mutant ( BdNIS1- C) of Botryosphaeria dothidea in Example 2 of the present invention. Among them, (a) Growth conditions after five stress cultures; (b) Colony diameter inhibition rate after five stress cultures (P<0.05); Figure 7 This is the transient expression analysis of effector protein BdNIS1 in Nicotiana benthamiana in Example 3 of the present invention. (a) Agrobacterium infiltration strategy and infiltration phenotypes. PVX-GFP and Buffer are negative controls, and PVX-GFP+Bax and Buffer+Bax are positive controls. The denominator in the numbers in the figure represents the number of repetitions, and the numerator represents the number of times the corresponding phenotype appears; (b) Results of Western blot test of total proteins in leaves of different regions; Figure 8 This is the functional analysis of effector protein BdNIS1 on the infection of Nicotiana benthamiana by Phytophthora parasitica in Example 3 of the present invention. (a) Results of transient expression of GFP (left) and BdNIS1 (right) on the abaxial (left) and adaxial (right) leaf surfaces. The denominator of the numerical part represents the number of repetitions, and the numerator represents the number of times the corresponding phenotype appears; (b) Lesion length (**, P<0.01) (left) and relative biomass of Phytophthora parasitica in the diseased area (**, P<0.01) (right); (c) Western blot detection of protein expression in the diseased area; Figure 9 This is the analysis of the effect of effector protein BdNIS1 on the burst ability of O 2- and H2O2 in tobacco cells. (a) DAB staining of H2O2. The statistical chart is the quantitative conversion result of the stained area by ImageJ (**, P<0.01); (b) NBT staining of O 2- , and the statistical chart is the quantitative conversion result of the stained area by ImageJ (**, P<0.01); Figure 10 This is the analysis of the relative expression level within 72 h of B. dothidea infection of apple fruits by Botryosphaeria dothidea in Example 3 of the present invention. BdNIS1 Detailed implementation mode

[0014] Example 1 This example is for obtaining the coding gene of effector protein BdNIS1 of Botryosphaeria dothidea ( B. dothidea ).

[0015] Using the Botryosphaeria dothidea ( B. dothidea ) strain Bd180088 preserved in the Mycology Disease Research Laboratory of the College of Plant Protection, Henan Agricultural University as the target strain, Botryosphaeria dothidea (B. dothidea The encoding gene of effector protein BdNIS1 is derived from strain Bd180088, and the acquisition method is as follows: (1) Pick a mycelial block of Botryosphaeria dothidea strain (Bd180088) preserved in a 20% glycerol cryopreservation tube and inoculate it on a fresh PDA plate, and culture it in the dark at 25 °C for 36 - 48 hours. Then, use a 5 mm punch to pick a mycelial block from the edge of the colony and inoculate it, with the mycelial side facing down, onto another fresh PDA plate. Continue to culture it in the dark at 25 °C for 60 - 72 hours. After the strain rejuvenation is completed, it is ready for use.

[0016] (2) Inoculate a 5 mm mycelial cake obtained from the edge of the fully rejuvenated Bd180088 strain onto a PDA plate covered with sterile cellophane, culture it under suitable conditions for 60 - 72 hours, and then collect the mycelia for total nucleic acid extraction.

[0017] (3) For the total RNA extraction of the pathogen, use the CW Biotech Ultra Pure RNA Extraction Kit (CW0581S) and extract it strictly according to the instructions. After the extraction is completed, store the obtained total RNA in a -80 °C low-temperature refrigerator or directly use it for reverse transcription to synthesize cDNA.

[0018] (4) Use the following primers to amplify the gene fragment with cDNA as the template: BdNIS1 Gene fragment: BdNIS1-F: ATGTTCCCCAAGATCGCC, BdNIS1-R: TTAAAAGCCCTTGAACCC; The reaction system for PCR amplification is: Table 1 PCR reaction system (25 μL) The reaction program for PCR amplification is: Table 2 PCR reaction program After the amplified product is detected by 1.2% agarose gel electrophoresis, it is sent to the company for sequencing (Sangon Biotech, Shanghai). The amino acid sequence of effector protein BdNIS1 of Botryosphaeria berengeriana de Not. f. sp. piricola B. dothidea is shown in SEQ ID NO.1, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.2 (excluding introns), BdNIS1 and the full-length gene sequence is shown in SEQ ID NO.3 (including introns).

[0019] Example 2 This example is about the effect of knocking out the BdNIS1 gene on the growth of Botryosphaeria berengeriana de Not. f. sp. piricola B. dothidea and its pathogenicity to infect plants.

[0020] I. BdNIS1 Obtaining of gene knockout mutants Firstly, a gene targeting knockout cassette was constructed based on the principle of homologous recombination, and then the BdNIS1 was knocked out by the PEG-mediated protoplast transformation method. Finally, the obtained mutants were identified by four pairs of primers. BdNIS1

[0021] 1. BdNIS1 Construction of gene knockout cassette (1) Locate the sequences of 2000 base pairs (bp) upstream and downstream of the target gene in the genome of the strain of B. dothidea ), and design two pairs of primers F1 / R1 and F2 / R2 accordingly. Among them, primer R1 contains the HYG 25 bp sequence at the 5' end of the resistance gene, while primer F2 contains the HYG 25 bp sequence at the 3' end of the resistance gene. Using the PCR reaction system, amplify and recover these PCR amplification fragments from genomic DNA. The reaction system is as follows: Table 3 PCR reaction system (25 μL) Note: The primers are F1 / R1 and F2 / R2; The reaction program is: Table 4 Reaction program After the reaction, use a universal DNA purification and recovery kit (Huiling, Shanghai) to cut and recover the amplified upstream and downstream PCR fragments for the next round of fusion.

[0022] (2) Use the PCR reaction system for the second round of fusion. The reaction system is configured as: Table 5 PCR reaction system (20 μL) The reaction program is: Table 6 Reaction program The product obtained from the reaction will be used as the primer for the third round of PCR reaction.

[0023] (3) The reaction system for the third round of PCR amplification of the transformation fragment is: Table 7 PCR reaction system (50 μL) Note: The primers are F1 / HY-R and YG-F / R2; The reaction program is: ​Table 8 Reaction procedure After the reaction, a universal DNA purification and recovery kit (Shanghai Huiling) was used to cut the gel and recover the amplified fusion fragment (upstream: corresponding primer F1 / HY-R, downstream: corresponding primer YG-F / R2), which was then used for subsequent protoplast transformation.

[0024] 2. Preparation of Botrytis cinerea protoplasts and PEG-mediated protoplast transformation a. Preparation of Botrytis cinerea protoplasts (1) Rejuvenate the Botrytis cinerea strain Bd180088 onto a PDA plate and culture at 25°C for 2-3 days; (2) Use a scalpel to cut a 1 cm 2 The edge of the hyphae was chopped as finely as possible and transferred to 100 mL YEPD liquid medium (containing 100 μg / mL AMP + ) and cultured at 25°C and 150 rpm for 48 h; (3) The cultured mycelium was broken up three times using a homogenizer at 6000 rpm for 10 s, then poured back into the original bottle, and fresh YEPD liquid medium was added to 100 mL. The culture was shaken at 25°C and 150 rpm for 10 h. (4) Filter the cultured juveniles through two layers of sterile filter cloth, rinse with 0.7 M NaCl until the mycelium turns white, and transfer an appropriate amount to a 50 mL centrifuge tube; (5) Weigh 0.2 g of Driselase, 0.1 g of Lysing enzyme, and 0.1 g of Snailase into a 50 mL centrifuge tube, add 10 mL of 0.7 M NaCl to dissolve, shake at 30°C and 100 rpm for 25 min, centrifuge at 3500 rpm for 8 min, filter the supernatant with a 0.22 μm filter to sterilize, then add it to the centrifuge tube in (4) to shake the bacteria apart; (6) Incubate the centrifuge tube away from light at 30°C with shaking at 90 rpm for 2-2.5 h (observe the degree of lysis during this period); (7) Place three layers of lens cleaning paper and two layers of non-woven filter cloth in a funnel to filter the enzymatic hydrolysis mixture, and rinse with 0.7 M NaCl 2-3 times; (8) Centrifuge the filtrate at 4°C and 3500 rpm for 10 min and discard the supernatant. (9) Add 20 mL of 1× STC Buffer and gently pipette to suspend. Centrifuge at 3500 rpm at 4°C for 6 min and discard the supernatant. (10) Add 1.5 mL of 1×STC Buffer to resuspend, transfer to a 2 mL sterile centrifuge tube, centrifuge at 6000 rpm for 5 min at room temperature, and discard the supernatant. (11) Repeat step (10) to obtain the protoplasts of Botryosphaeria dothidea strain Bd180088 for standby.

[0025] b. PEG-mediated protoplast transformation (1) Take 200 μL of the prepared protoplasts of Botryosphaeria dothidea strain Bd180088, add 10 μL of each of the DNA fusion fragments (upstream and downstream) obtained in step 1, gently pipette and stir to mix evenly, and incubate on ice for 30 min; (2) Cut off the sharp part of a 1 mL pipette tip, slowly rotate and drip in 1 mL of 40% PEG, and slowly invert to mix evenly, then let stand at room temperature for 20 min; (3) Transfer to a 50 mL sterilized centrifuge tube, make up the volume to 10 mL with TB3 liquid medium (containing 100 μg / mL Amp), let stand at room temperature for more than 2 h, and incubate at 25°C and 90 rpm for 18 - 20 h; (4) After incubation, make up the volume to 45 mL with warm PDA medium (containing 30 μg / mL HYG), slowly rotate and mix evenly, pour plates (15 mL / plate), and culture at 25°C for 24 - 48 h for primary screening; (5) If hyphae grow out, cover the plates with warm PDA medium (containing 50 μg / mL HYG) (10 mL / plate) for secondary screening.

[0026] 3. Detection of knockout mutants (1) Under a stereomicroscope, use a sterile pick to pick a little of the edge hyphae grown on the secondary screening plate and inoculate it onto a fresh PDA plate (containing 50 μg / mL HYG), and culture at 25°C for 2 - 3 d; (2) Pick the edge hyphae of the colony and inoculate it onto a fresh antibiotic-free PDA plate, and culture at 25°C for 2 - 3 d; (3) Cut out the edge hyphal blocks of the colony, and extract the total DNA of the hyphae by the CTAB method; (4) Use four pairs of primers (Target-F / Target-R, HYG-F / HYG-R, PF / HY-R, YG-F / PR) to detect the Target gene, HYG resistance gene 、 upstream and downstream binding sites of the transformants; (5) Inoculate the knockout mutants detected by the four pairs of primers onto a fresh PDA plate (containing 50 μg / mL HYG), culture at 25°C for 2 - 3 d, cut out the hyphal blocks and place them in 20% glycerol, and store at -80°C.

[0027] Figure 1 Yes BdNIS1 Schematic diagram of gene targeting knockout.

[0028] Figure 2 Yes BdNIS1 Construction of gene knockout cassette and detection results of mutants. Among them, (a) Electrophoresis map of PCR amplification of fusion fragments in one round, (b) Electrophoresis map of PCR amplification of transformation fragments in three rounds, (c) Electrophoresis map of detection of gene knockout mutants. The test results show that the upstream and downstream fragments of BdNIS1 were successfully amplified by PCR amplification ( Figure 2 a); then, by fusing it with the hygromycin gene, the upstream and downstream fusion fragments were obtained by PCR amplification ( Figure 2 b); through PEG-mediated transformation, 6 knockout transformants were obtained. After PCR amplification and identification with four pairs of primers, 3 of the transformants BdNIS1-1, BdNIS1-2 , BdNIS1-3 could all amplify the hygromycin band and the upstream and downstream fusion fragments, but could not amplify the BdNIS1 target band ( Figure 2 c), proving that these 3 transformants are BdNIS1 positive mutants with gene deletion, and they were respectively named Δ BdNIS1-1 , Δ BdNIS1-2 and Δ BdNIS1-3 .

[0029] II. BdNIS1 Obtaining of complementation transformants Insert BdNIS1 into the Hind III restriction site of vector pKNTG, and randomly insert BdNIS1 into the genome of knockout mutant Δ BdNIS1 by PEG-mediated protoplast transformation method. Use G418 resistance screening and RT-PCR test to determine whether the complementation transformant is a positive mutant. The steps are as follows: (1) Use Hind III single enzyme digestion of pKNTG vector, and use Gib-Seamless Cloning (Multi-fragment) (Kermey) kit for seamless cloning to obtain pKNTG- BdNIS1 recombinant plasmid; (2) Prepare protoplasts of Δ BdNIS1 strain with reference to the preparation method of protoplasts of Botryosphaeria dothidea strain Bd180088, and transform pKNTG- BdNIS1 recombinant plasmid by PEG-mediated transformation; (3) Use G418 resistance for primary screening (50 μg / mL) and secondary screening (80 μg / mL); (4) For the detection of complementation transformants, refer to the detection method of knockout mutants, change the resistance to G418, and the detection primers are: BdNIS1-Target-F / BdNIS1-Target-R and JC-NEO-F / JC-NEO-R; (5) Inoculate the complemented transformants detected by primers onto a fresh PDA plate (containing 80 μg / mL G418), culture at 25 °C for 2 - 3 d, cut out mycelial blocks and place them in 30% glycerol, and store at -80 °C.

[0030] Figure 3 Yes BdNIS1 Results of gene complementation transformant detection and RT-PCR detection. Among them, (a) Detection electrophoresis map of complemented transformants, (b) Fluorescence observation of mycelia of complemented strains, (c) RT-PCR of complemented transformants to detect target genes. As Figure 3 shown in a, the control wild type and knockout mutant BdNIS1 Complemented transformants can detect target gene bands and G418 resistance gene bands, indicating that the effector gene of Botryosphaeria dothidea BdNIS1 has been successfully transformed into BdNIS1 the mutant lacking it; through fluorescence microscopy observation of the mycelia of the mutant, a large amount of fluorescence was observed in the mycelia of the complemented transformant BdNIS1 -C, further indicating that the effector gene BdNIS1 has been successfully transferred into BdNIS1 the deletion mutant ( Figure 3 b). By RT-PCR detection of the knockout (Δ BdNIS1 )、complemented mutant ( BdNIS1 C) and wild type strain (WT), it was found that the band brightness of WT and BdNIS1- -C was close, indicating that the BdNIS1 expression level of the complemented mutant has been restored to the wild type state ( BdNIS1 c). Figure 3 c).

[0031] Table 9 Primers III. The pathogenicity of Botryosphaeria dothidea ( BdNIS1 ) significantly decreases after knockout B. dothidea Using empty PDA medium as a blank control (CK) and the wild type Botryosphaeria dothidea strain (Bd180088, WT) as a positive control, inoculate the wild type strain (WT), knockout mutant (Δ )、complemented mutant ( BdNIS1 )、complemented mutant ( BdNIS1- C) onto the detached branches and fruits of the current-year "Fuji" apples to detect BdNIS1 the biological role played during B. dothidea the infection process. The steps are as follows: 1. Determination of pathogenicity on branches: (1) Activate and rejuvenate the inoculated strain of Botryosphaeria dothidea; (2)Cut the current-year apple branches with uniform thickness and consistent growth in the field into short branches about 15 cm long; (3)Rinse with tap water 2 - 3 times to remove the dust on the surface of the branches; (4)Spray the whole branches evenly with 75% alcohol for surface disinfection, and then place them in a cool and ventilated place for 10 min to fully volatilize the residual ethanol on the surface; (5)Line the two ends of the inoculation tray with absorbent cotton, and then place the treated branches evenly in the inoculation tray; (6)Use a 5 - mm punch to make small holes in the center of the short branches, and at the same time punch out the mycelium at the edge of the colony; (7)Inoculate the edge mycelium block with the mycelium facing down into the holes, cover the inoculation points with 1 - mm - thick moist absorbent cotton for moisturizing, and seal the inoculation tray with plastic wrap; (8)Cultivate in the dark at 25℃ for 24 h and then give light. After 3 d, no additional water is supplemented. After 7 - 10 d, observe the disease occurrence in the inoculation holes, measure the length and width of the lesions, and perform a t - test using Prism software for significance analysis.

[0032] 2. Pathogenicity determination on fruits: (1)Select mature Fuji apples, wash the surface of the fruits with running water, then spray and wash the whole fruits evenly with 75% ethanol for disinfection, and finally place the fruits in a cool and ventilated place to dry the residual ethanol on the surface; (2)Taking the fruit stalk as the central axis, use a 5 - mm punch to symmetrically punch two small holes with a depth of 2 - 3 mm on the opposite sides of the center of the fruit. From the edge of the fully rejuvenated wild - type Botryosphaeria dothidea strain, BdNIS1 gene - knockout strain (Δ BdNIS1 ), and BdNIS1 gene - complemented strain ( BdNIS1- C), punch out 5 - mm mycelial discs at the edge of the colony, inoculate the mycelial discs (with the mycelium facing down) into the holes, and then carry out moisturizing cultivation at 25℃; (3)Observe the disease occurrence in the inoculation holes three days after the onset of the disease, measure the length and width of the lesions, and perform a t - test using Prism software for significance analysis.

[0033] Figure 4 Analysis of the pathogenicity of wild - type, BdNIS1 gene - knockout and gene - complemented mutants of Botryosphaeria berengeriana f. sp. piricola on apple branches and fruits. (a) Detection of the pathogenicity of knockout and complemented mutants on current - year apple branches (10 dpi), the bar graph shows the statistical results of lesion area (**, P < 0.01); (b) Detection of the pathogenicity of knockout and complemented mutants on fruits (3 dpi), the bar graph shows the statistical results of lesion area (**, P < 0.01). As Figure 4As shown, no lesions appeared on the branches and fruits of the control treatment group (CK), while ulcer-like lesions of different sizes occurred at the inoculation sites of the wild-type strain, knockout mutant, and complemented mutant. Among them, the ulcer area caused by the knockout mutant was significantly smaller than that of the wild type, and there was no significant difference in the ulcer area formed by the complemented mutant and the wild type. These experimental results indicate that after knocking out the effector gene BdNIS1 , B. dothidea the pathogenicity to the current-year apple branches and fruits was significantly reduced, suggesting that the effector gene BdNIS1 is B. dothidea one of the key pathogenic genes

[0034] IV. Knocking out BdNIS1 does not affect the growth, stress resistance, and cell wall integrity of B. dothidea Botryosphaeria berengeriana f. sp. piricola 1. Growth determination of mutants: To examine the effect of knocking out BdNIS1 on the growth of Bd180088, the wild type (Bd180088), knockout mutant (Δ BdNIS1 ), and complemented mutant ( BdNIS1- C) of Botryosphaeria berengeriana f. sp. piricola were cultured using different media (PDA, CM, MM, OM). The medium formulations are as follows: PDA medium: 200 g peeled potatoes, 20 g glucose, 15 g agar powder, made up to 1000 mL with deionized water, sterilized at 121 °C for 20 min.

[0035] OM medium (oatmeal medium): 50 g oatmeal was boiled and filtered through gauze. 15 g agar powder was suspended in deionized water and added to the filtrate, made up to 1000 mL, sterilized at 121 °C for 20 min.

[0036] CM medium (complete medium): 2 g peptone, 1 g yeast extract, 1 g acid-hydrolyzed casein, 10 g glucose, 6 g sodium nitrate, 0.5 g potassium chloride, 1 g magnesium sulfate heptahydrate, 1.5 g potassium dihydrogen phosphate, 15 g agar powder. Add 800 mL deionized water to dissolve, adjust the pH to 6.5, and then make up to 1000 mL with deionized water.

[0037] MM medium (minimal medium): 5 g glucose, 1 g ammonium nitrate, 0.5 g potassium dihydrogen phosphate, 1.5 g disodium hydrogen phosphate, 1 g sodium chloride, 0.2 g magnesium sulfate heptahydrate, 15 g agar powder. Add 800 mL deionized water to dissolve, adjust the pH to 7.2, and then make up to 1000 mL with deionized water.

[0038] The culture conditions were: 25 °C, dark culture. After 3 d, the colony diameter was measured by the cross method.

[0039] Figure 5 is the wild type of Botryosphaeria berengeriana f. sp. piricola, BdNIS1 Analysis of vegetative growth of gene knockout and complemented mutants of Botryosphaeria berengeriana f. sp. piricola. (a) Growth in four media, namely PDA, CM, MM, and OM. (b) Colony diameter statistics after 3 days of culture in the four media (P<0.05). The test results show that there is no significant difference in the growth rate of the wild type, knockout mutant, and complemented mutant on the same medium, indicating that knockout BdNIS1 does not affect B. dothidea vegetative growth. However, there are significant differences in their growth rates and colony morphologies on the four different media. On the PDA medium, the three different types of pathogens grow most vigorously with more aerial hyphae; on the CM medium, the growth of hyphae is somewhat inhibited, but aerial hyphae can still be produced; while on the OM and MM media, the aerial hyphae produced by different types of strains are less, and the colonies are also somewhat inhibited. Among them, the inhibitory effect on the hyphae on the MM medium is the most obvious.

[0040] 2. Stress test of mutants: To clarify BdNIS1 's effect on the cell wall integrity of Bd180088, the wild type of Botryosphaeria berengeriana f. sp. piricola (Bd180088), knockout mutant (Δ BdNIS1 ), and complemented mutant ( BdNIS1- C) were cultured using different stress media (0.3 g / L CR, 0.5 M NaCl, 0.04% SDS, 0.5 M Sorbitol, 0.8 mM H2O2). The above media are PDA media containing the corresponding amounts of stress substances. Among them, CR: Congo red stress medium for testing cell wall integrity; NaCl: sodium chloride stress medium for testing salt stress; SDS: sodium dodecyl sulfate stress medium for testing cell wall integrity and stress resistance; Sorbitol: sorbitol stress medium for testing osmotic stress; H2O2: hydrogen peroxide stress medium for testing oxidative stress; blank PDA medium as a control.

[0041] The culture conditions were: 25°C, dark culture, and after 3 days, the colony diameter was measured by the cross method.

[0042] Figure 6 is the wild type of Botryosphaeria berengeriana f. sp. piricola, BdNIS1Analysis of stress tolerance of gene knockout and complementation mutants. Among them, (a) Growth conditions after five kinds of stress cultures; (b) Colony diameter inhibition rate after five kinds of stress cultures (P<0.05). The test results show that there is little difference in colony diameter among the wild type, knockout mutant and complementation mutant of Botryosphaeria dothidea on the same medium, indicating that the same tested medium has little effect on the knockout mutant and complementation mutant, suggesting that knockout BdNIS1 does not affect B. dothidea the stress resistance ability and cell wall integrity; while the different tested media have a greater impact on the knockout mutant and complementation mutant. The deletion mutant and complementation mutant both grow best on the 0.5 M Sorbitol and 0.8 mM H2O2 media, and grow worst on the 0.04% SDS media.

[0043] Example 3 This example is the transient expression of the effector protein BdNIS1 of Botryosphaeria dothidea ( B. dothidea ) in Nicotiana benthamiana.

[0044] I. BdNIS1 can inhibit the PCD reaction induced by Bax Bax The gene mainly comes from mammals. When expressed in the plant system, it can be recognized by plants as a PAMP and cause plant immune responses, thus effectively inducing apoptosis. In this example, the complete cDNA coding sequence of BdNIS1 was constructed into the PVX transient expression vector. The PVX- BdNIS1 transient expression vector was transformed into Agrobacterium by the liquid nitrogen cold shock method, and then the Agrobacterium was infiltrated into the Nicotiana benthamiana leaves to achieve BdNIS1 heterologous expression in tobacco cells. PVX-GFP and Buffer (MMA) were used as negative controls, and PVX-GFP + Bax and Buffer + Bax were used as positive controls. Bax was injected at the same site after 24 h.

[0045] 1. Construction of expression vector a. Vector digestion The PVX transient expression vector was digested with SmaⅠ. The following digestion reaction system was prepared on ice: Table 10 Digestion reaction system (50 μL) The digestion reaction program was: Table 11 Digestion reaction program After digestion, 1.2% agarose gel electrophoresis (120V, 30min) was performed, and the linearized vector was recovered by cutting the gel using a universal DNA purification and recovery kit (Huiling, Shanghai).

[0046] b. Construction of expression vector (1) Using the cDNA of Bd180088 strain as a template, amplify the complete coding region sequence (CDS region) from the start codon to the stop codon by PCR technology and recover it; BdNIS1 Recover the complete coding region sequence (CDS region) from the start codon to the stop codon; (2) Use the Gib-Seamless Cloning (Multi-Fragment) (Kermey) kit to directionally clone the target gene fragment into the PVX vector; (3) Use the heat shock transformation method to transform the fusion plasmid into Escherichia coli DH5α and obtain the recombinant expression vector.

[0047] 2. Preparation of Agrobacterium tumefaciens GV3101 competent cells and liquid nitrogen cold shock transformation method a. Preparation of Agrobacterium tumefaciens GV3101 competent cells (1) Streak the stored Agrobacterium tumefaciens GV3101 glycerol bacteria on an antibiotic-free LB plate and incubate at 28 °C in an inverted position for 48 h; (2) Pick a single colony and inoculate it into 3 mL of LB liquid medium, shake culture at 28 °C and 200 rpm for 6 - 8 h until OD600 = 0.4 - 0.6; (3) Pipette 1 mL of the cultured bacterial solution into 100 mL of LB liquid medium, culture at 28 °C and 200 rpm for 12 h until OD600 = 0.4 - 0.6; (4) Aliquot the cultured bacterial solution into two 50 mL centrifuge tubes and ice-bath for 30 min; (5) Centrifuge at 4 °C and 3500 rpm for 10 min, discard the supernatant, invert the tube to drain the remaining medium; (6) Resuspend and wash the cells 3 times with 20 mL, 6 mL, and 3 mL of pre-cooled 10% glycerol for every 50 mL of culture, centrifuge at 4 °C and 3500 rpm for 10 min, and discard the supernatant; (7) Suspend every 50 mL of culture with 2.5 mL of pre-cooled 10% glycerol, aliquot 100 μL into 1.5 mL sterile centrifuge tubes, freeze quickly in liquid nitrogen, and store in a -80 °C low-temperature refrigerator.

[0048] b. Liquid nitrogen cold shock transformation method of Agrobacterium tumefaciens (1) Take out the pre-prepared Agrobacterium tumefaciens GV3101 competent cells from the -80 °C refrigerator and thaw them in an ice bath for 10 min; (2) Add 2 μg of the recombinant plasmid and gently stir and pipette to mix evenly, seal the tube mouth with a sealing film, and ice-bath for 30 min; (3) Freeze in liquid nitrogen for 4 min; (4) Quickly transfer to a 37 °C water bath for heat shock for 5 min, and cool in an ice bath for 10 min; (5) Add 800 μL of antibiotic-free LB liquid medium, mix gently, and culture with shaking at 28 °C and 200 rpm for 3 - 4 h, then centrifuge at 4000 rpm for 2 min; (6) Discard 600 μL of the supernatant and resuspend the bacterial cells with the remaining culture medium; (7) Pipette 150 μL of the bacterial liquid and spread it on an LB plate containing 50 μg / mL Kana (the corresponding vector resistance of Agrobacterium) and 25 μg / mL rifampicin, and culture it upside down at 28 °C for 48 - 72 h; (8) Pick single colonies and identify positive clones by PCR.

[0049] 3. Inoculating tobacco leaves by Agrobacterium infiltration method (1) Streak the Agrobacterium identified as positive clones onto an LB plate containing 50 μg / mL Kana and 25 μg / mL rifampicin, and culture it upside down at 28 °C for 48 h; (2) Pick single colonies and inoculate them into 800 μL of LB liquid medium containing 50 μg / mL Kana and 25 μg / mL rifampicin (the corresponding resistance), and culture at 28 °C and 200 rpm for 24 h; (3) Pipette 50 μL of the cultured bacterial liquid into 5 mL of LB liquid medium containing 50 μg / mL Kana and 25 μg / mL rifampicin (the corresponding resistance) (100 μL of 0.5 M MES and 2 μL of 100 mM AS have been added to the medium in advance), culture at 28 °C and 200 rpm for 12 - 18 h until OD600 = 1.0, centrifuge at 3500 rpm for 10 min, and discard the supernatant; (4) Wash twice with 2 mL of 10 mM MgCl2; (5) Resuspend the bacterial cells with the infiltration solution MMA until OD600 = 1.0, and let it stand in the dark at room temperature for 3 h; (6) Remove the needle from a 1 mL syringe, and then inject the treated Agrobacterium bacterial liquid into the leaves of Nicotiana benthamiana that have grown for 4 - 6 weeks, are in good health, and have uniform leaf sizes. Circle the injection area with a marker pen for convenient result recording or secondary injection. After injecting Agrobacterium, the tobacco is placed in the dark for 12 h at a constant temperature of 25 °C and then given light.

[0050] 4. Western blot verification a. Extraction of total protein from Nicotiana benthamiana (1) After 48 h of Agrobacterium injection treatment of Nicotiana benthamiana leaves, collect leaf samples; (2) Quickly freeze the samples in liquid nitrogen, and then place them in a liquid nitrogen grinder for thorough grinding at 60 Hz for 180 s; (3) Add 10 μL of 100 mM phenylmethylsulfonyl fluoride (PMSF) protease inhibitor and 1 mL of Tris-buffered saline (TBS) to the ground sample; (4) Centrifuge the mixture at 10,000 × g for 10 min at 4°C; (5) After centrifugation, carefully aspirate 100 μL of the supernatant, add 25 μL of 5× protein loading buffer, and mix well; (6) Heat the mixture in a boiling water bath for 5 min for denaturation, and then immediately cool it on ice for 5 min. The processed sample is stored at -20°C for later use.

[0051] b. Western blot verification (1) Prepare a PAGE gel and perform SDS-PAGE gel electrophoresis. Subsequently, transfer the separated proteins from the gel to a PVDF membrane (BIO-RAD, catalog number 162-0177) using wet transfer technology. Before transfer, the PVDF membrane needs to be soaked in methanol for 15 - 20 s to activate the membrane surface; (2) According to the molecular weight of the target protein and the voltage set on the transfer apparatus, precisely control the transfer time to ensure effective transfer; (3) After transfer, immerse the PVDF membrane in TBST buffer containing 5% (mass / volume) non-fat dry milk and gently shake it at room temperature for 1 h to block non-specific binding sites; (4) Incubate the membrane with the mouse anti-monoclonal antibody diluted in TBST, place it in a horizontal shaker at 4°C overnight to ensure sufficient binding of the antibody to the target protein; (5) The next day, wash the membrane thoroughly 4 times with TBST buffer containing 0.05% (volume / volume) Tween 20, 5 min each time, to remove unbound antibodies; (6) Immerse the membrane in a 3% non-fat dry milk TBST solution containing goat anti-mouse IgG-HRP conjugate (CWBIO, catalog number CW0102) and incubate it at room temperature for 30 min to form an antibody-enzyme complex; (7) Wash the membrane with TBST 4 times again, 5 min each time, to remove unbound secondary antibodies; (8) Finally, react the membrane with Western ECL substrate (BIO-RAD, catalog number 170-5060) in the dark for 1 min to generate a chemiluminescence signal; (9) Use a Bio-Rad fluorescence gel imager (Gel Doc XR+, model 1708195) to capture and analyze the luminescence signal to detect and quantify the expression level of the target protein.

[0052] Figure 7 Figure 1 is the transient expression analysis of the effector protein BdNIS1 in Nicotiana benthamiana. (a) Agrobacterium infiltration strategy and infiltration phenotype, PVX-GFP and Buffer are negative controls, PVX-GFP+Bax and Buffer +Bax are positive controls. The denominator of the numbers in the figure represents the number of repetitions, and the numerator represents the number of occurrences of the corresponding phenotype; (b) Total proteins from leaves in five regions except the Buffer injection site were extracted for Western blot analysis. Figure 7 As shown in a, the PVX-GFP and Buffer treatment groups did not produce necrotic spots, but allergic necrotic spots were produced after Bax injection, while the PVX-BdNIS1 treatment group did not produce necrotic spots before and after Bax refraction. The total protein of Nicotiana benthamiana leaf tissue near the injection site was extracted, and the expression of the target protein could be detected by Western blot, as shown in Figure 7 As shown in b. BdNIS1 itself does not cause a strong allergic necrosis reaction in tobacco cells, but it can inhibit the allergic necrosis reaction caused by Bax. This shows that the BdNIS1 protein of apple ring rot fungus is one of the key pathogenic effectors of the pathogen.

[0053] 2. BdNIS1 promotes the infection of Nicotiana benthamiana by Phytophthora nicotianae The control GFP and effector protein BdNIS1 were expressed at both ends of Nicotiana benthamiana leaves using transient expression technology, and the protein expression region was infected with tobacco phytophthora ( P. nicotianae ) Inoculation test. The steps are as follows: (1) Inject Agrobacterium transformed with the target gene plasmid into tobacco leaves and infiltrate for 36 hours; (2) Take a clean culture dish, place two layers of filter paper in the dish and soak it with an appropriate amount of sterile water for later use; (3) Cut the tobacco leaves from the base of the petiole and wrap the cut surface with moistened absorbent cotton to keep it moist; (4) Place the leaf with the back facing up in a culture dish and pierce a small hole symmetrically on both sides of the center of the leaf. (5) Use a 5 mm puncher to punch out hyphae from the edge of a 5-7 day old tobacco fungus colony, inoculate the wound with the hyphae facing downward, and cover the colony with a thin layer of moistened cotton wool. (6) After sealing the culture dish, place it in a constant temperature environment at 25°C in the dark for 60 h, then observe and record the test results under a handheld ultraviolet lamp; (7) Take a tobacco leaf tissue sample of approximately 1.5 cm × 1.5 cm from the inoculation site. Use the CTAB method to extract the total DNA of the tobacco diseased tissue. Actin As an internal reference gene, RT-qPCR was used to detect the stably expressed EF1Gene expression levels were then used to evaluate the relative biomass of Phytophthora nicotianae in the diseased tissues. Additionally, total proteins were extracted from the diseased tissues according to the method for extracting total proteins from Nicotiana benthamiana, and Western blot was performed to detect the expression of the target protein.

[0054] Figure 8 This is the functional analysis of the effector protein BdNIS1 on the infection of Nicotiana benthamiana by Phytophthora nicotianae. (a) GFP (left) and BdNIS1 (right) were transiently expressed on the abaxial (left) and adaxial (right) leaf surfaces, and 36 h later, Phytophthora nicotianae was inoculated and allowed to infect for 60 h. The denominator of the numerical part represents the number of replicates, and the numerator represents the number of occurrences of the corresponding phenotype; (b) Lesion lengths (*, P<0.01) (left) and relative biomass of Phytophthora nicotianae in the diseased area (*, P<0.01) (right) measured 60 h after inoculation with Phytophthora nicotianae; (c) Protein expression in the diseased area was detected by Western blot. The results showed that the lesion area in the BdNIS1 treatment group was significantly larger than that in the GFP control group (P<0.01). To further analyze the disease situation, total DNA was extracted from the diseased site, and RT-PCR technology was used to detect the expression level of the stably expressed EF1 gene in Phytophthora nicotianae to reflect the relative biomass of Phytophthora nicotianae. The results showed that the expression level of the EF1 gene in the BdNIS1 treatment group was significantly higher than that in the GFP control group (P<0.01). In addition, Western blot was used to detect the total proteins in the diseased site, and the results showed that the target protein was stably expressed in both groups. These experimental results indicate that the effector protein BdNIS1 of Botryosphaeria berengeriana can significantly enhance the infection of Phytophthora nicotianae on Nicotiana benthamiana.

[0055] III. BdNIS1 can inhibit the burst of plant reactive oxygen species to weaken the immune response of Nicotiana benthamiana Under stress conditions, plant tissues produce various reactive oxygen species (ROS), among which hydrogen peroxide (H2O2) and superoxide anion (O2 - ) are two main types. Previous studies found that BdNIS1 can inhibit the PCD reaction induced by Bax and enhance P. nicotianae the pathogenicity to Nicotiana benthamiana. To clarify this pathological mechanism, the accumulation of O2 P. nicotianae and H2O2 in Nicotiana benthamiana leaves transiently expressing BdNIS1 and inoculated with - was studied and analyzed by tissue staining method (DAB 1 mg / mL pH=3.8, NBT 0.5 mg / mL PH=7.8), and the staining depth was quantitatively analyzed using ImageJ software.

[0056] H2O2 and O2 -The principle of content detection is as follows: 3,3'-diaminobenzidine (DAB) and hydrogen peroxide (H2O2) react under the action of peroxidase to form a brown precipitate insoluble in water and ethanol, and nitroblue tetrazolium (NBT) reacts with superoxide anion (O2 - ) to form a blue precipitate insoluble in water and ethanol.

[0057] The test method is as follows: (1) After infiltrating tobacco leaves with BdNIS1 for 36 h, inoculate Phytophthora nicotianae ( P. nicotianae ) and incubate under humidity for 60 h; (2) Immerse the tobacco leaves infected with Phytophthora in DAB (Sigma) staining solution (1 mg / mL, pH = 3.8) or NBT (Sigma) staining solution (0.5 mg / mL, pH = 7.8), and incubate overnight at room temperature; (3) After rinsing the surface residual staining solution with sterile water 3 - 5 times, place it in 95% ethanol and treat it in a water bath at 40°C - 60°C for 6 - 16 h until the green background of the leaves is completely removed (fresh ethanol can be replaced repeatedly during this period); (4) Clamp out the leaves, rinse the surface residual ethanol on the leaves 3 - 5 times with sterile water, then place them in 10% glycerol to observe and record the overall staining results, and observe and record the local tissue staining results under a stereomicroscope; (5) Use ImageJ image analysis software to perform gray value quantitative analysis on the staining results (the operation steps are: ImageJ>Type>8-bit>Adjust>Threshold>Analyze>Measure), and convert the staining depth into quantifiable numerical data. Subsequently, use Prism statistical software to perform t-test analysis on the experimental data to determine the statistical significance of the differences in H2O2 and O2 - content between different treatment groups.

[0058] Figure 9 This is the analysis of the effect of effector protein BdNIS1 on the burst ability of O 2- and H2O2 in tobacco cells. (a) DAB staining for H2O2, and the statistical chart is the quantitative conversion result of the staining area by ImageJ (**, P<0.01); (b) NBT staining for O 2-, The statistical chart shows the quantitative conversion results of the stained area by ImageJ (**, P<0.01). The results indicate that after incubating the corresponding tobacco leaves overnight with DAB staining solution and NBT staining solution respectively, the color reaction in the BdNIS1 treatment group is significantly weaker than that in the GFP control group. When cutting and observing the tissue in the color-changed area under an optical microscope, it can also be found that the color accumulation in the tissue cells of the BdNIS1 treatment group is less than that in the GFP control group. Using ImageJ software to quantitatively convert the stained area, the results show that the conversion amount in the BdNIS1 treatment group is lower than that in the GFP control group. The experimental results show that the accumulation of O2 - and H2O2 in the BdNIS1 treatment group is significantly lower than that in the GFP control group, indicating that BdNIS1 can effectively inhibit the ROS reaction in plants and weaken its immune response to promote pathogen infection.

[0059] IV. Effector genes BdNIS1 are significantly up-regulated B. dothidea at the initial stage of host infection To clarify the expression pattern of effector genes B. dothidea of Botryosphaeria berengeriana f. sp. piricola during the infection of host apple, BdNIS1 we inoculated apple fruits, observed the disease development of apple fruits at 6 - 72 hpi, and extracted the total RNA from the flesh at the diseased-healthy junction at different observation time points. The expression level of B. dothidea was determined using the RT-qPCR system. The steps are as follows: BdNIS1 (1) Select mature Fuji apples, wash the fruit surface with running water, then spray the whole fruit evenly with 75% ethanol for disinfection, and finally place the fruit in a cool and ventilated place to dry the residual ethanol on the surface; (2) Taking the fruit stalk as the central axis, use a 5 mm puncher to symmetrically punch two holes with a depth of 2 - 3 mm at the relative center position on the side of the fruit. Punch a 5 mm mycelial cake from the edge of the fully rejuvenated Bd180088 colony, inoculate the mycelial cake (with the mycelial side facing down) into the holes, and then perform humidity preservation culture at 25°C; (3) According to the experimental needs, collect the flesh tissue at the diseased-healthy junction of diseased fruits at the corresponding time points (6 h, 12 h, 24 h, 36 h, 60 h, 72 h), cut it as finely as possible with a scalpel, and then place it in a liquid nitrogen grinder for sufficient pulverization; (4) Real-time fluorescence quantitative PCR (RT-qPCR) was used to detect the expression level of the BdNIS1 gene. The method is as follows: RNA extraction: Use a rapid universal plant RNA extraction kit (Huayueyang), operate strictly according to the instructions, and the extracted RNA is directly used for reverse transcription or stored at -80°C; cDNA reverse transcription: cDNA was obtained by reverse transcription using the All-in-One Script Rtpremix (with dsDNase) kit (Kermey).

[0060] RT-qPCR detection: Using cDNA as a template, Bd-Actin as an internal reference gene, the expression level of BdNIS1 was measured using a real-time fluorescence quantitative PCR system (ThermoFisher Scientific QuantStudio 3). The primers were as follows: qPCR-BdNIS1-F: ATGTTCCCCAAGATCGCC, qPCR-BdNIS1-R: GGATGTTCTCGATCTGCT; The primers for the internal reference gene were: Bd-Actin-F: CCGCTCCGTTTCTATGCTCT, Bd-Actin-R: ACCCTCACCGACATACCAGT; Referring to the instruction manual of the 2×SYBR Green qPCR Premix (Universal) kit from Kermey, the following reaction system was prepared: Table 12 PCR reaction system (20 μL) Table 13 PCR reaction program After the program ended, the charts were exported, and the expression level of the -ΔΔCt gene was calculated using 2 BdNIS1 The relative expression level analysis within 72 h after infecting apple fruits showed that

[0061] Figure 10 was B. dothidea significantly up-regulated within 6 - 24 h after infecting apple fruits. The up-regulation was the highest at 6 hpi, and then the expression level gradually decreased. The results indicated that the effector gene BdNIS1 played an important role in the early stage (within 6 hours) of pathogen infection and also played an important role in the process of pathogen colonization and disease development. BdNIS1 is one of the key pathogenic genes of Botryosphaeria dothidea on apples. BdNIS1 During B. dothidea the infection of apple fruits, it was significantly up-regulated at 6 - 24 hpi, with the highest up-regulation at 6 hpi, and then the expression level gradually decreased. The results showed that the effector gene BdNIS1 played an important role in the early stage (within 6 hours) of pathogen infection, and also played an important role in the process of pathogen colonization and disease development. BdNIS1 is one of the key pathogenic genes of Botryosphaeria dothidea on apples.

[0062] The above are only the preferred embodiments of the present invention and do not impose any limitations on the present invention. Any simple modifications, changes, and equivalent variations made to the above embodiments based on the technical essence of the invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. An effector protein BdNIS1 of Botryosphaeria dothidea, characterized in that, The amino acid sequence of the effector protein BdNIS1 is shown in SEQ ID NO.

1.

2. A gene encoding the Botryosphaeria dothidea effector protein BdNIS1 according to claim 1, characterized in that, The said BdNIS1 The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

3. An expression cassette, recombinant vector or recombinant bacterium comprising the gene according to claim 2 BdNIS1 ​ 4. Use of the effector protein BdNIS1 of Botryosphaeria dothidea according to claim 1 or the BdNIS1 gene according to claim 2, or the expression cassette, recombinant vector or recombinant bacterium according to claim 3 in the prevention and control of apple ring rot disease.

5. The application according to claim 4, characterized in that, Knockout of the B. dothidea gene of BdNIS1 Botryosphaeria berengeriana f. sp. piricola results in a significant decrease in its pathogenicity to apple fruits and branches.

Images