Saliva protein RP402 and application thereof as target spot in prevention and treatment of soybean green disease

Abstract

The invention belongs to the technical field of agricultural pest prevention and control, and particularly relates to an apis cerana sialoprotein RP402 and application thereof. The invention provides the sequence of the salivary protein RP402 of the point bug and the coding gene of the salivary protein RP402, and the RP402 gene is silent in a specific targeting manner through an RNA (Ribonucleic Acid) interference technology, so that the inhibition of a soybean aging process can be obviously relieved, the normal aging of leaves is accelerated, and the occurrence of a green symptom phenomenon is reduced, thereby effectively improving the normal ripening rate and the yield of soybeans. Therefore, the prevention and control method for the Eriomycorus lividus or the prevention and control method for the soybean disease green provided by the invention has the characteristics of accuracy, high efficiency and environmental protection, not only makes up for the defects of the existing prevention and control measures, but also reduces the use of chemical pesticides, reduces the environmental pollution and the risk of pest resistance to drugs, and improves the economic benefits of the Eriomycorus lividus and the soybean disease green. Popularization and application of the method can provide powerful guarantee for green and sustainable development of the soybean industry in China.

Description

Technical Field

[0001] The present invention belongs to the technical field of agricultural pest prevention and control, and particularly relates to the saliva protein RP402 of Riptortus pedestris and its application as a target in the prevention and control of soybean "symptom greening". Background Art

[0002] Riptortus pedestris ( Riptortus pedestris ) is a polyphagous piercing-sucking pest widely distributed in East Asia and Southeast Asia, with more than 30 host plants in more than 13 families. Among them, soybean ( Glycine max ) is its most suitable host. When Riptortus pedestris feeds on soybean, it causes the nutrients in the leaves to be unable to be effectively transported to the sink organs through piercing-sucking, resulting in excessive accumulation of nutrients in the leaves and destroying the source-sink relationship of the plant. This abnormal nutrient distribution inhibits the natural senescence of the leaves, making the plant continuously maintain the vegetative growth state, thus showing the typical "symptom greening" phenomenon. In recent years, the population density of Riptortus pedestris has been continuously increasing in soybean-producing areas such as the Huang-Huai-Hai region of China, and it has become one of the main pests, seriously threatening the yield and quality of soybeans.

[0003] Leaf senescence is a key process for plants to transition from the vegetative assimilation stage to the nutrient redistribution stage. Normal leaf senescence promotes the transfer of nutrients from leaves to seeds and improves reproductive success. However, the piercing-sucking feeding of Riptortus pedestris inhibits leaf senescence and hinders the transfer of nutrients to seeds, resulting in "symptom greening" of the plants.

[0004] Further research found that the saliva secretions of Riptortus pedestris contain a variety of effector proteins, and these effectors play a key role in regulating plant defense responses and senescence processes. Among them, effectors such as RpSP10.3, RpSP13.4, RpSP13.8, and RpSP17.8 weaken the plant's defense ability and reduce the insect resistance of soybeans by inhibiting the jasmonic acid (JA) and salicylic acid (SA) signaling pathways. In addition, the effector RPH1 of Riptortus pedestris can be recognized by soybeans and activate the plant's immune response, but variant effectors such as RPH1L2-5 improve the feeding success rate of Riptortus pedestris by inhibiting this immune response. It is worth noting that the Rp614 and Rp2155 effectors of Riptortus pedestris promote the occurrence of soybean "symptom greening" while inhibiting the JA and SA signaling pathways. The feeding of Riptortus pedestris also significantly reduces the expression level of the senescence-related gene GmFT2a in soybean leaves, and overexpression of GmFT2a can effectively alleviate the "symptom greening" symptoms and enhance the insect resistance of the plants.

[0005] At present, the control methods for Riptortus pedestris mainly include chemical pesticide spraying, breeding of insect-resistant varieties, and biological control. Among them, chemical pesticides such as imidacloprid and other insecticides have a certain control effect on Riptortus pedestris. However, due to the strong avoidance and drug resistance of this pest, the effectiveness of chemical control is limited, and the problem of pesticide residues may cause environmental pollution. The breeding of insect-resistant varieties is still in its early stage. At present, there is no resistant soybean variety against Riptortus pedestris, and traditional insect-resistant breeding methods are difficult to meet the actual production needs. In terms of biological control, although certain progress has been made in controlling the population of Riptortus pedestris by using predatory natural enemies or parasitic wasps, its application in large-scale agricultural production is still limited.

[0006] Therefore, there is an urgent need to find a green and effective control method for the agricultural pest Riptortus pedestris. Summary of the Invention

[0007] To solve the above technical problems, the present invention proposes a precise control strategy based on RNA interference (RNAi) technology. By targeting and silencing the key effector gene salivary protein RP402 of Riptortus pedestris, the feeding ability of this pest can be effectively reduced, thereby reducing the occurrence of the "symptom of greening" in soybeans.

[0008] On the one hand, the present invention provides a salivary protein RP402 of Riptortus pedestris, and the salivary protein RP402 is any one of the following (1)-(3): (1) A protein composed of the amino acids shown in SEQ ID NO.1; (2) A protein derived from (1) with the same function, which is obtained by substituting and / or deleting and / or adding one or several amino acid residues in the amino acids shown in SEQ ID NO.1; (3) A protein or its derivative with at least 95% sequence identity and the same function as (1), which is derived from other varieties of rice or other species.

[0009] On the other hand, the present invention also provides a gene encoding the salivary protein RP402 of Riptortus pedestris, and the nucleotide sequence of the gene is any one of the following (4)-(6): (4) A DNA molecule whose coding region is the sequence shown in SEQ ID NO.2; (5) A DNA molecule that hybridizes with the DNA sequence defined in (4) under stringent conditions and encodes a protein with the same function; (6) A DNA molecule that has at least 95% sequence identity with the DNA sequence defined in (4) and encodes a protein with the same function.

[0010] On the other hand, the present invention also provides the application of the salivary protein RP402 or the gene as a target, and the application is any one of the following, a) Alleviate the soybean symptom blight phenomenon; b) Reduce the proportion of soybean abortion and empty pods; c) Increase the 100-seed weight of soybean seeds.

[0011] On the other hand, the present invention also provides a substance capable of reducing the activity of the salivary protein RP402 or capable of reducing the gene expression level, and the substance targets the sequence SEQ ID NO.5 to reduce the activity of the salivary protein RP402 or reduce the gene expression level by RNA interference.

[0012] In certain embodiments, the substance includes but is not limited to miRNA, siRNA, dsRNA or shRNA.

[0013] In certain embodiments, the substance is dsRNA, and the sense strand and antisense strand sequences of the dsRNA are shown in SEQ ID NO.10 and SEQ ID NO.11.

[0014] On the other hand, the present invention also provides a pesticide composition, and the active ingredient of the pesticide composition includes the substance described above that reduces the activity of the salivary protein RP402 or reduces the gene expression level by RNA interference.

[0015] In certain embodiments, the substance includes but is not limited to miRNA, siRNA, dsRNA or shRNA.

[0016] In certain embodiments, the substance is dsRNA, and the sense strand and antisense strand sequences of the dsRNA are shown in SEQ ID NO.10 and SEQ ID NO.11.

[0017] In certain embodiments, the pesticide composition further includes a nanocarrier material, and the nanomaterial includes chitosan nanoparticles, liposome nanoparticles, carbon-based nanomaterials or polymer nanomaterials. By utilizing the encapsulation effect of the nanomaterial, the stability and environmental tolerance of dsRNA can be effectively improved, its field action time can be prolonged, and at the same time, the dsRNA absorption efficiency of Riptortus pedestris after feeding or contact can be enhanced, thereby improving the gene silencing effect.

[0018] On the other hand, the present invention also provides the application of the substance or the composition in the preparation of a pesticide for controlling soybean symptom blight.

[0019] On the other hand, the present invention also provides a method for controlling Riptortus pedestris or a method for controlling soybean "symptom blight", and the method includes the step of introducing any one of the substances or the composition into the body of Riptortus pedestris or spraying it on the surface of soybean plants.

[0020] In some embodiments, the concentration of the substance or the composition is 400 - 600 ng / μl, preferably 500 ng / μl.

[0021] In some embodiments, the introduction is carried out by microinjection.

[0022] Compared with the prior art, the present invention for the first time discovers and verifies the important role of the RP402 gene of Riptortus pedestris in inhibiting the normal senescence of soybean leaves and aggravating the "symptom green" phenomenon of soybeans. By specifically targeting and silencing the RP402 gene, it can significantly relieve the inhibition of the soybean senescence process, accelerate the normal senescence of leaves, reduce the occurrence of symptom green phenomenon, and thus effectively improve the normal maturation rate and yield of soybeans. In addition, the present invention also provides an efficient preparation method of RP402 gene-specific dsRNA and a microinjection silencing technique, which have the advantages of simple operation, high efficiency, good stability and easy promotion. Therefore, the control method of Riptortus pedestris or the control method of soybean symptom green provided by the present invention has the characteristics of precision, high efficiency and environmental protection. It not only makes up for the deficiencies of existing prevention and control measures, but also reduces the use of chemical pesticides, reduces environmental pollution and the risk of pest resistance. Its popularization and application will provide a strong guarantee for the green and sustainable development of China's soybean industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments.

[0024] Figure 1 is the relative expression level of RP402 after gene interference.

[0025] Figure 2 is the effect of the feeding of Riptortus pedestris treated with dsRNA under greenhouse conditions on the senescence process of soybean leaves.

[0026] Figure 3 is the effect of the feeding of Riptortus pedestris treated with dsRNA under field conditions on the growth of soybeans.

[0027] Figure 4 is the effect of the feeding of Riptortus pedestris treated with dsRNA under field conditions on the "symptom green" phenotype of soybeans; wherein, Figures A - D are respectively the effects of the feeding of Riptortus pedestris treated with dsRNA under field conditions on the green stem rate of soybeans, on the empty pod rate of soybeans, on the abortion rate of soybeans and on the 100-seed weight of soybeans. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0028] Example 1

[0029] 1. Extraction of total RNA from Riptortus pedestris.

[0030] (1)Place 1 healthy adult Riptortus pedestris in a sterilized 2.0 mL EP tube and add sterilized grinding beads to facilitate sufficient fragmentation.

[0031] (2)Use a grinding machine pre-cooled with liquid nitrogen for tissue grinding. Set the grinding conditions to 50 Hz for 30 s and repeat multiple times until the sample is ground into a fine powder.

[0032] (3)Extract RNA using the RNA simple Total RNA Kit (Tiangen, China). First, quickly add 1 mL of lysis buffer RZ to the ground sample, mix well using a vortex mixer, and let it stand at room temperature for 5 min to fully lyse the cells.

[0033] (4)After lysis, centrifuge the sample at 12,000 rpm at 4 °C for 5 min. Transfer 800 μL of the supernatant to a new centrifuge tube and add 200 μL of pre-cooled chloroform.

[0034] (5)Vigorously shake for 15 s and then let it stand at room temperature for 3 min to promote phase separation.

[0035] (6)Centrifuge the sample at 12,000 rpm at 4 °C for 10 min. After centrifugation, three layers are formed. Transfer approximately 400 μL of the upper aqueous phase to a new centrifuge tube, add 200 μL of pre-cooled absolute ethanol, mix well by pipetting, and quickly transfer it to the adsorption column CR3.

[0036] (7)Centrifuge at 12,000 rpm at 4 °C for 30 s, discard the effluent, and place the adsorption column back into the collection tube.

[0037] (8)Add 500 μL of wash buffer RW to the adsorption column CR3, let it stand at room temperature for 2 min, centrifuge at 12,000 rpm at 4 °C for 30 s, discard the effluent, and repeat this step once to enhance RNA purity.

[0038] (9)Add 500 μL of wash buffer RW to the adsorption column CR3, let it stand at room temperature for 2 min, centrifuge at 12,000 rpm at 4 °C for 30 s, discard the effluent, and repeat this step once to enhance RNA purity.

[0039] (10)Centrifuge at 12,000 rpm at 4 °C for 2 min. After removing the residual liquid, transfer the adsorption column CR3 to a new centrifuge tube and air-dry it on ice in a laminar flow hood for 8 min.

[0040] (11)Add 30 - 50 μL of RNase-Free ddH2O to the center of the adsorption column, incubate at room temperature for 2 min, and then centrifuge at 12,000 rpm at 4 °C for 2 min to elute the RNA.

[0041] The RNA concentration was determined using a spectrophotometer, snap-frozen in liquid nitrogen, and stored at -80°C for long-term preservation.

[0042] 2. Cloning of the RP402 gene of Riptortus pedestris (1) Reverse transcription was performed using HiScript II Reverse Transcriptase (Vazyme, China) to obtain cDNA. First, a genomic DNA removal reaction was carried out: in 800 ng of total RNA, 4 μL of 4×gDNA wiperMix was added, and RNase-free ddH2O was used to make up to 16 μL. The mixture was pipetted gently to mix evenly and reacted at 42°C for 2 min. Subsequently, a reverse transcription reaction system was prepared: 4 μL of 5×HiScript II qRT SuperMix was added to the above reaction system, gently pipetted to mix evenly, reacted at 50°C for 15 min, and at 85°C for 5 s to obtain cDNA.

[0043] (2) Using the obtained cDNA as a template, PCR amplification was performed with the primers shown in SEQ ID NO.3 and SEQ ID NO.4 and the ultra-fidelity enzyme Phanta Super-Fidelity DNA Polymerase (Vazyme, China) to obtain the CDS sequence (SEQ ID NO.2) of the salivary protein RP402 of Riptortus pedestris, and the amino acid sequence encoded by it is as shown in SEQ ID NO.1.

[0044] Forward primer: 5’-GACGAGCTGTACAAGGGTACCCCAGTCCAGGAAGACGATACCCA-3’ (SEQ IDNO.3) Reverse primer: 5’-GCGGACTCTAGTTCATCTAGATTCCCATCCCAGCACTTCCTCCA-3’ (SEQ IDNO.4).

[0045] Reaction system: 25 μL of 2×Phanta Max Buffer, 1 μL of dNTP Mix (10 mM each), 2 μL each of forward and reverse primers (10 mM each), 1 μL of Phanta DNA Polymerase, 2 μL of template cDNA, and ddH2O was added to make up to 50 μL. PCR amplification was carried out according to the PCR program of pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1.5 min, for 35 cycles, and extension at 72°C at 1 kb / min.

[0046] (3) Recover and purify the target gene fragment obtained by PCR amplification, ligate it to the cloning vector pBinGFP2, then transform it into competent Escherichia coli DH5α cells, and spread them on LB solid medium containing kanamycin for culture to screen for monoclonal colonies containing the recombinant plasmid.

[0047] (4) Pick positive monoclonal colonies, inoculate them into LB liquid medium containing kanamycin for amplification culture, and extract the recombinant plasmid. Use sequencing technology to perform Sanger sequencing on the recombinant plasmid to confirm whether the RP402 target gene is successfully inserted. Finally, obtain the recombinant plasmid pBinGFP2-RP402 containing the sequence shown in SEQ ID NO.1, laying a foundation for subsequent functional verification experiments.

[0048] Example 2

[0049] (1) The designed dsRNA targets the highly conserved region of the RP402 gene, and the target sequence is as shown in SEQ ID NO.5. Using the recombinant plasmid pBinGFP2-RP402 obtained in Example 1 as a template, use the primers shown in SEQ ID NO.6 and SEQ ID NO.7 to amplify the sense strand, and the primers shown in SEQ ID NO.8 and SEQ ID NO.9 to amplify the antisense strand. The PCR amplification program is the same as that in Example 1. After the PCR amplification is completed, the product is detected by agarose gel electrophoresis to confirm whether the band sizes of the sense strand and antisense strand are correct, and the correct PCR products are purified.

[0050] Upstream primer for sense strand amplification: 5’- TAATACGACTCACTATAGGG CAGTCCAGGAAGACGATACC-3’ (SEQ ID NO.6), downstream primer for sense strand amplification: 5’-TGGGGGACGCTTTCCTGGGC-3’ (SEQ ID NO.7), upstream primer for antisense strand amplification: 5’-CAGTCCAGGAAGACGATACC-3’ (SEQ ID NO.8), downstream primer for antisense strand amplification: 5’- TAATACGACTCACTATAGGG TGGGGGACGCTTTCCTGGGC-3’ (SEQ ID NO.9). The T7 promoter is underlined. The amplified sense strand sequence is as shown in SEQ ID NO.10, and the antisense strand sequence is as shown in SEQ ID NO.11.

[0051] (2) The RiboMAX™ Express RNAi System (Promega) kit was used to synthesize double-stranded RNA (dsRNA) specific to the RP402 gene. The synthesis system included 10 μL of RiboMAX™ Express T7 2×Buffer, 1 μg of sense / antisense ssRNA, 2 μL of Enzyme mix, and 20 μL of ddH2O. After mixing, the mixture was reacted at 37°C for 4 h to ensure sufficient RNA synthesis.

[0052] (3) Mix the obtained positive-strand ssRNA and anti-sense-strand ssRNA in equal amounts, incubate in a 70°C water bath for 10 min, and then place at room temperature for 20 min to complete the annealing reaction. Then add 2 μL RQ1 RNase-Free DNase and 2 μL RNase Asolution, and incubate in a 37°C water bath for 30 min to remove any residual DNA and single-stranded RNA and ensure the purity of the double-stranded RNA.

[0053] (4) Add 4.4 μL sodium acetate (NaOAc) and 110 μL 95% ethanol to the reaction solution, mix thoroughly and place on ice for 5 min. After a cloudy precipitate appears in the solution, place the reaction tube in a precooled centrifuge and centrifuge at 16,000 g for 10 min to recover the dsRNA precipitate.

[0054] (5) After centrifugation, discard the supernatant, add 500 μL of pre-cooled 70% ethanol to the centrifuge tube, and centrifuge at 16,000 g for 10 min at 4°C. After centrifugation, discard the supernatant again and ventilate in a clean bench for 4 min to remove residual ethanol to ensure the purity and stability of the dsRNA precipitate.

[0055] (6) Add 50 μL of Nuclease-Free water to the centrifuge tube to resuspend the dsRNA pellet and gently pipette or briefly vortex to completely dissolve the dsRNA.

[0056] Take 5 μL of dsRNA for agarose gel electrophoresis to confirm whether the dsRNA band size is in line with expectations, and use a nucleic acid protein analyzer to determine the dsRNA concentration. After the dsRNA product is packaged, store it at -80℃ for a long time for subsequent experiments.

[0057] Example 3

[0058] (1)Take fourth- or fifth-instar nymphs of Riptortus pedestris and place them in 50 mL centrifuge tubes. Anesthetize them with CO2 to ensure that the insects are in a stationary state during the experimental operation. After anesthesia, place the Riptortus pedestris on its back on a pre-prepared 1% agarose gel plate for subsequent microinjection operations. (2) Use a capillary tube (model: WPI 504949) to aspirate a 500 ng / μL dsRP402 solution and perform microinjection using an NL-type microinjector (capacity 4.5 μL, needle length 25.0 mm). The injection volume is set to 100 nL, the injection speed is 30 nL / s, and the injection site is selected as the intersegmental membrane between the second and third thoracic segments of Riptortus pedestris to ensure the effective delivery of dsRNA. At the same time, injection of dsGFP (green fluorescent protein, GFP) is used as a negative control group to exclude the possible effects of non-specific dsRNA treatment.

[0059] (3)After the injection is completed, transfer the revived Riptortus pedestris to a labeled insect rearing cage for rearing to ensure the survival of individuals, and use them for feeding experiments in subsequent greenhouse and field insect inoculation experiments.

[0060] (4)One week after the injection, randomly grab the injected Riptortus pedestris individuals in the experimental cage, extract total RNA, and obtain cDNA through reverse transcription. Use ChamQ SYBR qPCR Master Mix (Vazyme, China) for fluorescence quantitative PCR (RT-qPCR), and use the specific primers shown in SEQ ID NO.11 and SEQ ID NO.12 to detect the expression level of the RP402 gene, with RPactin as the internal reference gene. The RT-qPCR reaction system is 20 μL, including 10 μL of 2× ChamQ SYBR qPCR Master Mix, 0.4 μL of each upstream and downstream primer (10 μM), 2 μL of template cDNA, and ddH2O is added to make up to 20 μL. The RT-qPCR reaction program is pre-denaturation at 95°C for 30 s, 95°C for 10 s, 60°C for 30 s, for a total of 40 cycles. The 2 -ΔΔCt method is used to calculate the relative expression level of the RP402 gene to evaluate the silencing efficiency of dsRNA treatment.

[0061] Upstream primer: 5’-AGGACCACCTCCCTTCTCAA-3’ (SEQ ID NO.12) Downstream primer: 5’-GAGTTCACGGGCTTCTTCCA-3’ (SEQ ID NO.13).

[0062] The experimental results are as Figure 1As shown in the figure, one week after injecting dsRP402, through fluorescence quantitative PCR (qRT-PCR) detection, it was found that the relative expression level of the RP402 gene in Riptortus pedestris decreased to 0.14798, which was significantly lower than that in the control group, indicating a high efficiency of RP402 gene silencing.

[0063] Example 4

[0064] 1. Greenhouse insect inoculation experiment (1) Test materials and planting conditions: Select the soybean variety Williams 82 as the experimental material and plant it in a plant culture room to ensure controllable experimental conditions. The planting environment is set as follows: temperature 26 ± 2°C, relative humidity 50 ± 2%, and photoperiod 16:8 (L:D). Only one soybean plant is cultivated in each pot, and when the soybean enters the initial grain filling stage (R5), each plant is enclosed with a 20-mesh 30×30×60 cm insect-proof net to prevent interference from non-experimental insects.

[0065] (2) Select fourth- or fifth-instar Riptortus pedestris as the experimental subjects and divide them into three groups, with three biological replicates in each group. Inject dsRP402 (experimental group) and dsGFP (control group) into Riptortus pedestris respectively through microinjection technology, and set up a blank control group (not exposed to Riptortus pedestris). Place a pot of soybeans in each experimental cage, and place three dsRNA-injected Riptortus pedestris on each soybean plant to observe the effect of their feeding on soybean growth. The insects are replaced every three weeks to ensure the continuity of the experiment.

[0066] (3) Observe the growth status of soybeans at any time during the experiment, including changes in leaf color, growth momentum, senescence process, etc., and record the data at key time points.

[0067] The experimental results are as Figure 2 shown. The feeding of Riptortus pedestris has a significant impact on the senescence process of soybean leaves. After 17 days of insect inoculation, for the soybean plants not fed by Riptortus pedestris, only the lowest leaves showed slight yellowing, indicating natural senescence. The soybean plants fed by Riptortus pedestris injected with dsGFP remained green and showed no obvious premature senescence. However, for the soybean plants fed by Riptortus pedestris injected with dsRP402, the lower leaves quickly turned yellow, and the senescence was significantly accelerated. The experimental results show that RP402 is the main effector protein that inhibits the senescence of soybean leaves, and the treatment with dsRP402 leads to premature senescence of soybean leaves, indicating that RP402 is a key effector protein that regulates the growth and development of soybeans and causes "symptom greening".

[0068] 2. Field insect inoculation experiment (1) Experimental materials and planting conditions: In this experiment, the soybean variety Sucheng 2 was selected as the experimental material, and the experimental site was set in the field environment of the Baima Teaching and Research Base of Nanjing Agricultural University (119.19°E, 31.62°N). To prevent interference from non-experimental insects, a U-shaped insect-proof net rack (length × width × height = 170 cm × 85 cm × 150 cm) was built in the experimental field and covered with a 60-mesh insect-proof net. When the soybeans entered the initial grain-filling stage (R5), 10-12 soybean plants were planted in each insect-proof cage, and 20 Riptortus pedestris were inoculated in each cage until the soybean maturity stage. Four groups of treatments were set in the experiment, including the Mock group (soybean plants not fed on by Riptortus pedestris), the CK group (fed on by Riptortus pedestris without RNA interference injection), the dsGFP group (fed on by Riptortus pedestris injected with dsGFP), and the dsRP402 group (fed on by Riptortus pedestris injected with dsRP402), with three biological replicates in each group.

[0069] (2) At the soybean maturity stage, the main agronomic traits of the plants in each experimental group were statistically analyzed, including the green stem rate, abortion rate, empty pod rate, and 100-seed weight, to evaluate the effects of different treatments on soybean seed setting.

[0070] The experimental results are as Figure 3 shown. There were significant differences in soybean plants under different treatments. In the Mock group, the soybean plants were healthy without obvious stay-green phenomenon, while the soybean plants in the CK group and the dsGFP group showed significant stay-green phenomenon, and their green stem rates increased significantly ( Figure 4 A in). In contrast, the stay-green phenomenon in the dsRP402 group was significantly alleviated, and the green stem rate decreased significantly, approaching the level of the Mock group ( Figure 4 A in). In addition, in terms of seed setting traits, the empty pod rates of the CK group and the dsGFP group were significantly higher than those of the Mock group, while the empty pod rate of the dsRP402 group decreased significantly, approaching the level of the Mock group ( Figure 4 B in); the abortion rates of the CK group and the dsGFP group were significantly higher than those of the Mock group, while the abortion rate of the dsRP402 group was significantly lower than those of the CK group and the dsGFP group ( Figure 4 C in); the 100-seed weight of the Mock group was significantly higher than those of the CK group and the dsGFP group, while the 100-seed weight of the dsRP402 group was significantly higher than those of the CK and dsGFP groups and approached the level of the Mock group ( Figure 4 D in).

[0071] The results showed that feeding by the bee-spotted beetle significantly caused soybean greening, which was manifested by an increase in the rate of green stems, seed abortion, an increase in the rate of empty pods, and a decrease in 100-grain weight. Silencing the RP402 gene of the bee-spotted beetle (dsRP402 treatment) significantly alleviated the greening phenomenon, reduced the rate of abortion and empty pods, and increased seed weight. This study further confirmed the key role of RP402 in the bee-spotted beetle-induced soybean greening, and silencing this gene provides an effective strategy to reduce the damage of the bee-spotted beetle to soybean.

[0072] Unless otherwise specifically stated, the numerical value set forth in these embodiments does not limit the scope of the present invention. In all examples shown and described here, unless otherwise specified, any specific value should be interpreted as merely exemplary, rather than as restriction, and therefore, other examples of exemplary embodiments may have different values.

Claims

1. A saliva protein RP402 of Riptortus pedestris, characterized in that, The salivary protein RP402 is any one of the following (1)-(3): (1) A protein consisting of the amino acids shown in SEQ ID NO.1; (2) A protein derived from (1) with the same function, in which the amino acids shown in SEQ ID NO.1 are substituted and / or deleted and / or added by one or several amino acid residues; (3) A protein or its derivative with at least 95% sequence identity derived from other varieties of rice or other species and having the same function as (1).

2. A gene encoding the saliva protein RP402 of Riptortus pedestris, characterized in that, The nucleotide sequence of the gene is any one of the following (4)-(6): (4) A DNA molecule whose coding region is the sequence shown in SEQ ID NO.2; (5) A DNA molecule that hybridizes with the DNA sequence defined in (4) under stringent conditions and encodes a protein with the same function; (6) A DNA molecule having at least 95% sequence identity with the DNA sequence defined in (4) and encoding a protein with the same function.

3. Use of the salivary protein RP402 according to claim 1 or the gene according to claim 2 as a target, characterized in that, The application is any one of the following: a) Alleviating the soybean sudden death syndrome; b) Reducing the proportion of soybean abortion and empty pods; c) Increasing the 100-seed weight of soybean seeds.

4. A substance that can reduce the activity of the salivary protein RP402 described in claim 1 or can reduce the gene expression level described in claim 2, characterized in that, The substance reduces the activity of the salivary protein RP402 described in claim 1 or reduces the gene expression level described in claim 2 by RNA interference targeting the sequence SEQ ID NO.

5.

5. The substance according to claim 4, characterized in that, The substance is miRNA, siRNA, dsRNA or shRNA.

6. The substance according to claim 5, wherein The substance is dsRNA, and the sense strand and antisense strand sequences of the dsRNA are shown in SEQ ID NO.10 and SEQ ID NO.

11.

7. A pesticide composition, characterized in that, The active ingredient of the pesticide composition includes the substance described in any one of claims 4-6.

8. Use of the substance described in any one of claims 4-6 or the composition described in claim 7 in the preparation of a pesticide for controlling soybean sudden death syndrome.

9. A method for controlling Riptortus pedestris or a method for controlling the "symptom of greening" of soybeans, characterized in that, The method includes the step of introducing the substance described in any one of claims 4-6 or the composition described in claim 7 into Riptortus pedestris or spraying it on the surface of soybean plants.

10. The application according to claim 9, wherein The concentration of the substance described in any one of claims 4-6 or the composition described in claim 7 is 400-600 ng / μl, preferably 500 ng / μl.

Images