African trichoderma harzianum 6-5 and application thereof

Abstract

The invention discloses an African trichoderma harzianum strain 6-5 and application thereof, the disclosed strain is named as Trichoderma harzianum, and the preservation number of the strain is CGMCC (China General Microbiological Culture Collection Center) No. 41930. The bacterial strain has obvious bacteriostatic activity on crop pathogenic bacteria such as colletotrichum capsici, apple cyst, botrytis cinerea, alternaria longibrachiata and phytophthora capsici, and fermentation liquor of the bacterial strain has good prevention and control effects on apple anthracnose leaf blight, apple bitter rot and apple tree canker.

Description

Technical Field

[0001] The present invention belongs to the technical field of agricultural microorganisms, and specifically relates to a Trichoderma afroharzianum and its application in the field of biological control microorganisms for plant diseases. Background Art

[0002] Trichoderma afroharzianum is a type of filamentous fungus widely present in soil, plant roots, and decaying plant residues. This type of fungus can act synergistically through multiple mechanisms, including competing for nutrients, producing antibacterial metabolites, and inducing plant systemic resistance.

[0003] Current research shows that Trichoderma afroharzianum can produce a variety of active metabolites and stimulate the plant defense system to resist pathogen infection. Currently, the commercial preparations of this type of fungus mainly involve biological pesticides, microbial fertilizers, and soil conditioners, etc.

[0004] CN118667663B discloses a strain of Trichoderma afroharzianum CCTCC No: M 20241084, which has excellent control efficacy against Sclerotium rolfsii of pepper, with a control efficacy of up to 97.57%. In addition, it also has antagonistic activity against 5 other plant pathogenic fungi on pepper and tobacco.

[0005] CN116445295A discloses a strain of Trichoderma afroharzianum GDMCC No.62645, which can produce siderophores, promote the absorption of iron by highland barley, improve the germination rate and seedling growth, and can be prepared into a seed soaking agent or coating agent for microbial fertilizers.

[0006] CN116622517B discloses a strain of Trichoderma afroharzianum CGMCC No.40523, which can control fungal diseases of quinoa, promote root development, and enhance salt and alkali tolerance. Summary of the Invention

[0007] Based on the research findings of the inventors, the present invention provides a strain of Trichoderma afroharzianum 6-5, whose taxonomic name is Trichoderma afroharzianum; this strain is preserved in the China General Microbiological Culture Collection Center (address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Postcode: 100101), the preservation date is April 27, 2025, and the preservation number is CGMCC No.41930.

[0008] The present invention also provides the fermentation product of the above strain, and this fermentation product is a fermentation broth containing Trichoderma afroharzianum 6-5. This fermentation broth has obvious antibacterial effects on a variety of plant pathogenic fungi. The fermentation product is prepared by fermenting Trichoderma afroharzianum 6-5 using a PDB liquid medium.

[0009] The present invention also provides the uses of Trichoderma harzianum 6-5 from Africa and its fermentation products: inhibiting the growth of plant pathogenic bacteria. The plant pathogenic bacteria are Colletotrichum fructicola, Cytospora mali, Botrytis cinerea, Alternaria longipes, Phytophthora capsici. At the same time, the present invention also provides the applications of Trichoderma harzianum 6-5 from Africa and its fermentation products in preventing and treating apple anthracnose leaf blight, apple bitter rot, and apple tree canker.

[0010] Trichoderma harzianum 6-5 of the present invention can inhibit the growth of various plant pathogenic bacteria such as Colletotrichum fructicola, Cytospora mali, Botrytis cinerea, Alternaria longipes, Phytophthora capsici, and has good biocontrol effects on apple anthracnose leaf blight, apple bitter rot, and apple tree canker. This strain has good application prospects in the development of microbial pesticides. Description of the Drawings

[0011] Figure 1 It is the colony morphology of Trichoderma harzianum 6-5 strain on PDA medium; A is the front colony morphology diagram after growing on PDA medium for 3 days; B is the back colony morphology diagram after growing on PDA medium for 3 days; C is the front colony morphology diagram after growing on PDA medium for 10 days; D is the back colony morphology diagram after growing on PDA medium for 10 days.

[0012] Figure 2 It is the microscopic morphology of Trichoderma harzianum 6-5 strain; A is the conidiophore; B is the conidia, and the scale bars in Figures A and B are 20μm.

[0013] Figure 3 It is the maximum likelihood method phylogenetic tree constructed based on RPB2 and TEF1-a gene sequences; the strain 6-5 of the present invention is shown in bold, and the bootstrap support rate above 50% is marked at the nodes, and T represents the type strain.

[0014] Figure 4 It is the antagonistic effects of Trichoderma harzianum 6-5 strain on Colletotrichum fructicola, Cytospora mali, Botrytis cinerea, Alternaria longipes, Fusarium solani, Phytophthora capsici, and Psychrophilic fruit rot fungi; A is the inhibitory effect on pathogenic bacteria by the plate confrontation method; B is the inhibitory effect on pathogenic bacteria by adding the fermentation broth; C is the inhibition rate of the plate confrontation method and the fermentation broth addition method on the mycelial growth of pathogenic bacteria.

[0015] Figure 5 It is the biocontrol effect of Trichoderma harzianum 6-5 strain on apple anthracnose leaf blight; A is the protection effect 3 days after inoculation; B is the protection effect 7 days after inoculation.

[0016] Figure 6 For the protective effect of Trichoderma harzianum strain 6-5 against apple bitter rot; A shows the disease incidence after inoculating pathogen spores 24 hours after spraying the 6-5 fermentation broth; B shows the number of infection points on apple fruits under different treatments; C shows the estimated disease area of apple fruits under different treatments; D shows the proportion of disease spot grading of apple fruits under different treatments; in B and C, different letters indicate significant differences by Tukey HSD test (p<0.05).

[0017] Figure 7 For the therapeutic effect of Trichoderma harzianum strain 6-5 against apple bitter rot; A shows the disease incidence after spraying the 6-5 fermentation broth 24 hours after inoculating pathogen spores; B shows the number of infection points on apple fruits under different treatments; C shows the estimated disease area of apple fruits under different treatments; D shows the proportion of disease spot grading of apple fruits under different treatments; in B and C, different letters indicate significant differences by Tukey HSD test (p<0.05).

[0018] Figure 8 For the biocontrol effect of antagonistic bacteria against apple tree canker; A shows the disease incidence after inoculating the pathogen 24 hours after spraying the 6-5 fermentation broth; B shows the length of disease spots on apple branches under different treatments, and different letters indicate significant differences by Tukey HSD test (p<0.05). Specific implementation mode

[0019] Unless otherwise specified, the reagents, materials, etc. used in the following examples are all commercially available products.

[0020] Example 1: Isolation and identification of Trichoderma harzianum 6-5 of the present invention

[0021] (1) Source of Salvia miltiorrhiza root samples

[0022] Select the root segments of Salvia miltiorrhiza collected from Shilipu Village, Migangqiao Town, Fengxiang District, Baoji City, Shaanxi Province (107°27'31.731"E, 34°31'6.242"N) in 2023 for the isolation of endophytic fungi and the screening of antagonistic bacteria.

[0023] (2) Isolation of endophytic fungi from Salvia miltiorrhiza roots

[0024] The tissue isolation method was used to isolate endophytic fungi from Salvia miltiorrhiza roots; the isolation medium was potato dextrose agar medium PDA (200 g of potato, 20 g of glucose, 15 g of agar, 1 L of sterile water, pH 5.6 - 6.0); when isolating, select healthy Salvia miltiorrhiza root segment samples with a diameter of 5 - 10 mm, wash the soil on the surface of Salvia miltiorrhiza, spray the surface with 75% alcohol for disinfection and air dry naturally; in the ultra-clean experimental workbench, use a sterile scalpel to cut the sample into 5 mm 2Tissue blocks of about [left and right] were soaked in 75% alcohol for 1 minute and rinsed 3 times with sterile water; soaked in 5% sodium hypochlorite solution (protected from light) for 3 minutes and rinsed 3 times with sterile water; the moisture of the tissue blocks was blotted dry with absorbent paper. The tissue blocks that had completed surface disinfection were placed on PDA plates and incubated at a constant temperature of 25°C; the tissue blocks after surface disinfection were taken out after being placed on the PDA plates for 30 minutes and continued to be cultured in a constant temperature environment of 25°C to verify whether the surface disinfection of the samples was thorough. Observe the growth status of the hyphae in the petri dishes. After fungal colonies appeared on the PDA plates, pick a little hyphae at the edge of each colony and inoculate it onto a new PDA plate. Transfer continuously for two generations until the strain is stable. Subsequently, the strain was stored in 30% glycerol solution and placed in a -80°C refrigerator for standby.

[0025] (3) Screening of antagonistic bacteria

[0026] Using Colletotrichum fructicola (provided by the Fungal Research Laboratory of Northwest A&F University) as the indicator target strain, screen antagonistic fungi from the fungal strains isolated and purified in the previous step (2); through steps such as primary screening and re-screening, 1 fungal strain with better antibacterial effect was obtained, numbered 6-5.

[0027] Using Colletotrichum fructicola as the target bacterium, primary screening was carried out by the plate confrontation method. Inoculate a target bacterium cake in the center of the PDA plate. At both ends of the target bacterium, inoculate endophytic fungi at a position about 4 cm from the center of the target bacterium. Use the inoculated PDA cake as a blank control, and repeat each treatment 4 times; when the target bacterium colony in the control group grows to the edge of the plate, measure the diameters of the target bacteria in the treatment group and the control group by the cross method, calculate the antibacterial rate of the endophytic fungi against the target bacterium, and select the endophytic fungi with obvious antibacterial effect.

[0028] Re-screening was carried out by the fermentation broth addition method. The bacterium cake of the endophytic fungi obtained from the primary screening was broken in a grinder and then inoculated into 50 mL of PDB. Ferment for 14 days in a constant temperature shaker at 25°C and 180 r / min. After filtering the mycelium with a sterilized filter cloth, centrifuge at 8000 r / min for 10 minutes in a low-temperature centrifuge. Take the supernatant and filter it with a 0.22 μm bacterial filter in a laminar flow hood to obtain the endophytic fungi fermentation broth, which is stored at -80°C for standby; the endophytic fungi fermentation broth and the PDA medium are added in a ratio of 1:9 to make an endophytic fungi fermentation broth plate. PDB and PDA medium are also mixed in the same ratio (1:9) as a control plate, and each treatment is repeated 4 times; inoculate the target bacterium in the center of the plate. When the control colony grows to the edge of the plate, measure the colony diameters of the fermentation broth plate and the control plate by the cross method, calculate the antibacterial rate of the endophytic fungi fermentation broth, and select the endophytic fungi with obvious antibacterial effect, numbered 6-5.

[0029] (4) Identification of strain 6-5

[0030] Based on the colony morphological characteristics of the strain and multi-gene molecular phylogenetic analysis, species identification of strain 6-5 was carried out.

[0031] As Figure 1 shown, when cultured on PDA medium at 25 °C for 3 days, the front of the colony of 6-5 was white-green and the back was light green; when cultured for 10 days, the front of the colony was green, the back of the colony was yellow-green, the surface of the colony was flocculent, the texture was loose, the hyphae were dense, and a large number of conidia could be seen on the surface, and the color was the same as that of the colony.

[0032] As Figure 2 shown, the conidiophores of 6-5 had a complex branched structure. The conidiophores were erect, branched in a whorled manner, formed a pyramidal structure, and phialides were borne at the top. The conidia were spherical or oval, smooth on the surface, green in color, and produced from the top of the phialides.

[0033] PCR amplification of the RPB2 (SIQ ID No.1) and TEF1-α genes (SIQ ID No.2) of strain 6-5 was carried out using the primers bRPB2-6F / bRPB2-7R (5’-GAYGAYCGKGAYCAYTTCGG / CCCATRGCYTGYTTRCCCAT-3’) and EF1 / EF2 (5’-CATCGAGAAGTTCGAGAAG G / AACTTGCAGGCAATGTGG-3’), respectively.

[0034] The PCR amplification products were further subjected to Sanger sequencing, and the amplified sequences were BLAST aligned in the NCBI database to screen for reference sequences with higher homology (>95%). The sequences of the antagonistic bacteria and the reference sequences were imported into the MAFFT software for multiple sequence alignment, and the SequenceMatrix software was used to concatenate the different gene sequences of each antagonistic bacterium. Based on the concatenated multi-gene dataset, a phylogenetic tree was constructed on MEG A12 using the Maximum Likelihood (ML) method. As Figure 3 shown, the constructed phylogenetic tree showed that 6-5 and Trichoderma afroharzianum clustered together with a bootstrap support rate of 98%.

[0035] Based on the comprehensive results of morphological and molecular phylogenetic analysis, 6-5 was identified as Trichoderma afroharzianum.

[0036] Example 2: Antagonistic effect of Trichoderma afroharzianum 6-5 of the present invention

[0037] Colletotrichum fructicola, Cytospora mali, Botrytis cinerea, Alternaria longipes, Fusarium solani, Phytophthora capsici and Languo psychrotropha (all strains used in this study were provided by the Fungal Research Laboratory of Northwest A&F University) were respectively inoculated on PDA medium and cultured at room temperature. Agar discs were punched out and inoculated on fermentation broth plates (mixed at a ratio of 1:9) made from 6-5 fermentation broth and PDA medium. PDB and PDA media were mixed at the same ratio as the control plates. Each treatment was repeated 4 times. When the control colonies grew to the edge of the plate, the colony diameters of the fermentation broth plates and the control plates were measured by the cross method, and the inhibition rate of the endophytic fungal fermentation broth was calculated to determine whether the 6-5 strain had an inhibitory effect.

[0038] Figure 4 The results showed that the 6-5 strain had obvious inhibitory effects on Colletotrichum fructicola, Cytospora mali, Botrytis cinerea, Alternaria longipes and Phytophthora capsici. In the plate confrontation experiment, the 6-5 strain had an inhibitory effect on Fusarium solani and Languo psychrotropha, but the inhibition rate was relatively low in the fermentation broth addition experiment. It indicated that the 6-5 strain of the present invention had broad-spectrum antibacterial activity.

[0039] Example 3: Biocontrol effect of Trichoderma harzianum 6-5 of the present invention against Glomerella cingulata leaf blight of apple

[0040] Apple leaves with consistent shape and size and in good health were selected, the surface dust was washed off and air-dried for later use. The petioles of the apple leaves were moisturized with absorbent absorbent cotton and then placed in a moisturized inoculation box. The fermentation broth of the 6-5 strain was evenly sprayed on the leaf surface, and PDB medium was sprayed as a control. Each treatment was repeated 5 times. After incubation at 25 °C for 24 h, a spore suspension of Glomerella cingulata (10 6 CFU / mL) was evenly sprayed on the leaf surface, and incubation was continued under constant temperature and humidity. When the control leaves showed lesions, the disease conditions of the leaves in each treatment were observed and photographed.

[0041] Figure 5 The results showed that 3 days after inoculation, obvious lesions appeared on the control leaves, with large lesion areas and dense distribution; while only sporadic lesions appeared on the leaves of the treatment group pre-sprayed with the fermentation broth of the 6-5 strain, and the lesion areas were significantly smaller than those of the control group. 7 days after inoculation, the lesions on the control leaves expanded rapidly, resulting in large-area disease of the leaves; in contrast, the disease area of the leaves in the treatment group sprayed with the fermentation broth of the 6-5 strain was significantly smaller than that of the control group, and the expansion of the lesions was inhibited. The experimental results indicated that the fermentation broth of the 6-5 strain had a protective effect against Glomerella cingulata leaf blight of apple.

[0042] Example 4: Biocontrol effect of Trichoderma harzianum 6-5 against bitter rot of apple

[0043] Protective effect: Select Gala apple fruits of the same size and health, rinse them with clean water, dry them, and set aside. Uniformly spray the fermentation broth of strain 6-5 on the surface of the apple fruits, and spray PDB medium as a control. Each treatment is repeated 10 times. Place the treated apple fruits in a humid inoculation box, and after incubating at a constant temperature of 25°C for 24 h, uniformly spray the spore suspension of the pathogen of apple bitter rot (10 6 CFU / mL) on the surface of the apple fruits, and continue to incubate at a constant temperature and humidity. When the control fruits show lesions, observe and photograph the disease incidence of each treatment of apple fruits, and count the number and size of the lesions.

[0044] Therapeutic effect: Uniformly spray the spore suspension of the pathogen of apple bitter rot (10 6 CFU / mL) on the surface of the apple fruits. Place the treated apple fruits in a humid inoculation box, and after incubating at a constant temperature of 25°C for 24 h, uniformly spray the fermentation broth of strain 6-5 on the surface of the apple fruits, and spray PDB medium as a control. Each treatment is repeated 10 times. Continue to incubate at a constant temperature and humidity. When the control fruits show lesions, observe and photograph the disease incidence of each treatment of apple fruits, and count the number and size of the lesions.

[0045] According to the lesion diameter, the disease severity is divided into 5 grades: 0-2 mm (grade 1), 2-4 mm (grade 2), 4-6 mm (grade 3), 6-8 mm (grade 4), and above 8 mm (grade 5) to estimate the disease area of each treatment.

[0046] Figure 6 The results showed that 6 days after inoculation, obvious lesions appeared on the surface of the control group of apple fruits. At this time, the number of infection points of each treatment was counted, the disease area of each treatment was estimated, and the proportion of different lesion grades was counted. Compared with the number of infection points in the control group (128.7), the number of infection points in the treatment group pre-sprayed with the fermentation broth of strain 6-5 (30.5) was significantly reduced, indicating that the fermentation broth of strain 6-5 could effectively inhibit the initial infection of the pathogen; compared with the disease area in the control group (335.7 mm 2 ²), the disease area in the treatment group pre-sprayed with the fermentation broth of strain 6-5 (44.1 mm 2 ²) was significantly reduced, indicating that the fermentation broth of the antagonistic bacterium could inhibit the expansion of the lesions; compared with the proportion of high-grade lesions (diameter ≥ 6 mm) in the control group (10.72%), the proportion of high-grade lesions in the treatment group pre-sprayed with the fermentation broth of strain 6-5 (0) was significantly reduced, indicating that the fermentation broth of the antagonistic bacterium could delay the expansion of the lesions. Based on the above experimental results, it shows that the fermentation broth of strain 6-5 has a significant protective effect against apple bitter rot.

[0047] Figure 7 The results showed that after 6 days of inoculation, obvious lesions appeared on the surface of apple fruits in the control group. At this time, the number of infection points in each treatment was counted, the diseased area of each treatment was estimated, and the proportion of different lesion grades was counted. Compared with the number of infection points in the control group (116.7), the number of infection points in the treatment group sprayed with the fermentation broth of strain 6-5 (22.7) was significantly reduced, indicating that the fermentation broth of the antagonistic bacterium could effectively inhibit the initial infection of the pathogen; compared with the diseased area of the control group (266.7 mm 2 ), the diseased area of the treatment group sprayed with the fermentation broth of strain 6-5 (38.3 mm 2 ) was significantly reduced, indicating that the fermentation broth of the antagonistic bacterium could inhibit the expansion of lesions; compared with the proportion of lesions with a high disease grade in the control group (6.77%), the proportion of lesions with a high disease grade in the treatment group pre-sprayed with the fermentation broth of strain 6-5 (1.32%) was significantly reduced, indicating that the fermentation broth of strain 6-5 could delay the expansion of lesions. Based on the above experimental results, it was shown that the fermentation broth of strain 6-5 had a significant therapeutic effect on apple bitter rot disease.

[0048] Example 5: Biocontrol effect of Trichoderma harzianum 6-5 of the present invention on apple tree canker

[0049] Select two-year-old lateral branches of apple trees with the same thickness, cut them into sections of the same length, wash them with clean water and dry them for later use. Use a punch to make a circular wound in the center of the apple tree branch section to expose the xylem. Spray the fermentation broth of strain 6-5 evenly on the branch sections, and spray PDB medium as a control. Each treatment was repeated 10 times. Moisturize both ends of the branch sections with absorbent absorbent cotton, place them in a moisturizing inoculation box and incubate at a constant temperature of 25°C for 24 hours. Then inoculate apple shell saccharomycete cakes on the wounds of the apple tree branch sections, and moisturize the wounds with absorbent absorbent cotton, wrap and fix them with plastic wrap, and continue to incubate at a constant temperature and humidity. After the control group became diseased, count the length of the lesions in each treatment and take pictures for record.

[0050] Figure 8 The results showed that when obvious lesions appeared on the apple tree branches in the control group after 10 days, the bark of the apple tree branches in each treatment group was scraped to expose the xylem, and the length of the lesions in each treatment was measured and counted. Compared with the lesion length of the control group (7.15 cm), the lesion length of the treatment group sprayed with the fermentation broth of strain 6-5 (1.63 cm) was significantly reduced, indicating that the fermentation broth of the antagonistic bacterium could effectively inhibit the infection and expansion of the pathogen. This indicated that the fermentation broth of strain 6-5 had a significant protective effect on apple tree canker.

[0051] Specification Nucleotide Sequence Listing

[0052] SIQ ID No.1: (RPB2 sequence of strain 6-5)

[0053] GAGTTGGCCAACTACCTGAGACGATGCGTTGAGGGCAACCGACACTTC

[0054] AACCTGGCTGTTGGTATCAAGCCCGGCACGCTTTCAAACGGACTGAAG

[0055] TATTCGCTTGCCACAGGAAACTGGGGTGATCAGAAGAAGGCCATGAGC

[0056] TCAACTGCCGGTGTGTCCCAGGTGCTTAACCGTTACACGTTTGCTTCGA

[0057] CCTTGTCACATTTGCGTCGTACCAACACTCCTATCGGGAGAGATGGTAA

[0058] GCTGGCGAAGCCTCGACAGCTTCACAACACGCATTGGGGCTTGGTCTG

[0059] CCCAGCCGAGACACCCGAAGGACAGGCCTGTGGTCTGGTCAAGAACT

[0060] TGTCTTTGATGTGTTACGTCAGTGTCGGTTCTCCCTCCGAGCCTCTGAT

[0061] TGAGTTCATGATCAACAGAGGTATGGAAGTCGTCGAAGAGTACGAGCC

[0062] GCTGCGGTATCCTCATGCTACAAAGATTTTTGTGAACGGTGTCTGGGTT

[0063] GGAGTTCACCAAGACCCTAAGCACTTGGTGAACCAGGTTCTGGATACT

[0064] CGTCGCAAGTCCTATCTGCAATACGAAGTCTCTCTCGTGAGAGAAATTC

[0065] GAGACCAGGAATTCAAAATCTTTTCCGATGCAGGTCGTGTCATGCGAC

[0066] CAGTCTTTACCGTTCAGCAGGAAGATGATCCGGAAACGGGCATCAACA

[0067] AGGGCCACCTGGTATTGACCAAGGAGCTCGTCAATAGATTGGCCAAGG

[0068] AGCAGGCTGAGCCTCCGGAAGACCCCAGCATGAAGATTGGATGGGAG

[0069] GGATTGATCAGGGCTGGTGCGGTTGAATATCTCGACGCCGAGGAAGAG

[0070] GAGACGGCCATGATCTGCATGACACCAGAGGATCTCGAGCTGTATCGT

[0071] CTTCAGAAGGCCGGTATCAACACTGAGGAAGACATGGGAGATGATCCG

[0072] AACAAGCGACTCAAGACCAAGACGAACCCGACAACTCACATGTACAC

[0073] CCATTGCGAGATTCACCCAAGTATGATCTTAGGTATCTGTGCTAGTATCA

[0074] TTCCTTTCCCCGATCACAACCAGGTATGTSIQ ID No.2:(6-5 strain TEF1-α sequence)

[0075] GCTAACCACTTTTCCATCAATAGGAAGCCGCCGAACTCGGCAAGGGTT

[0076] CCTTCAAGTACGCTTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGC

[0077] GTGGTATCACCATTGACATTGCTCTGTGGAAGTTCGAGACTCCCAAGTA

[0078] CTATGTCACCGTCATTGGTAAGTCTTCACTAAGTTCATGCTGCAATTGC

[0079] GGACCAGTGCTAACAGGCAATTCACAGACGCTCCCGGCCACCGTGATT

[0080] TCATCAAGAACATGATCACTGGTACTTCCCAGGCCGATTGCGCTATCCT

[0081] CATCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGAT

[0082] GGCCAGACCCGTGAGCACGCTCTGCTCGCCTACACCCTGGGTGTTAAG

[0083] CAGCTCATCGTTGCCATCAACAAGATGGACACTGCCAACTGGGCCGAG

[0084] GCTCGTTACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAGAAG

[0085] GTCGGCTTCAACCCCAAGGCTGTTGCTTTCGTCCCCATCTCCGGTTTCA

[0086] ACGGTGACAACATGCTCCAGCCCTCCACCAACTGCCCCTGGTACAAGG

[0087] GCTGGGAGAAGGAGACCAAGGCTGGCAAGTTCACCGGCAAGACCCTC

[0088] CTTGAGGCCATCGACTCCATCGAGCCCCCCAAGCGTCCCACGGACAAG

[0089] CCCCTCCGTCTTCCCCTCCAGGATGTCTACAAGATCGGTGGTATTGGAA

[0090] CAGTTCCCGTCGGCCGTATCGAGACTGGTGTCCTCAAGCCCGGTATGG

[0091] TTGTCACTTTCGCTCCCTCCAACGTCACCACTGAAGTCAAGTCCGTCG

[0092] AGATGCACCACGAGCAGCTCGTCGAGGGTGTTCCCGGTGACAACGTT

[0093] GGTTTCAACGTCAAGAACGTTTCCGTTAAGGAAATTCGCCGTGGTAAC

[0094] GTTGCCGGTGACTCCAAGAACGACCCCCCCATGGGTGCCGCTTCTTTC

[0095] ACCGCTCAGGTCATCGTCATGAACCACCCTGGCCAGGTCGGTGCCGGC

[0096] TACGCCCCC

Claims

1. A strain of Trichoderma afroharzianum 6-5, named Trichoderma afroharzianum, with a preservation number of CGMCC No. 41930.

2. A fermentation product, characterized in that, The fermentation product is produced by fermenting with Trichoderma afroharzianum 6-5 described in claim 1.

3. The fermentation product according to claim 2, wherein, The culture medium for fermentation is selected from PDB medium.

4. The application of Trichoderma afroharzianum 6-5 or its fermentation product described in claim 1 in the preparation of an antibacterial agent against plant pathogens.

5. The application according to claim 3, wherein, The plant pathogens are Colletotrichum fructicola, Cytospora mali, Botrytis cinerea, Alternaria longipes, and / or Phytophthora capsici.

6. The application of Trichoderma afroharzianum 6-5 or its fermentation product described in claim 1 in the preparation of drugs for preventing and treating apple anthracnose leaf blight, apple bitter rot, and apple tree canker.

Images