A strain of Trichoderma viride and its application

Through the hyperparasitic effect of the MJ18 strain of Trichoderma viride and its combination with clothianidin, the problem of prevention and control of peanut white rot and insect pests has been solved, environmentally friendly joint prevention and control of diseases and pests has been achieved, and the emergence rate and seedling growth of peanuts have been improved.

CN120366084BActive Publication Date: 2025-09-26GUANGZHOU DR MIAO BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510840267.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-23
Publication Date
2025-09-26
Estimated Expiration
2045-06-23

AI Technical Summary

Technical Problem

The existing technology lacks effective biocontrol strains to control peanut white rot fungus, and chemical control leads to environmental pollution and drug resistance problems. There is also a lack of environmentally friendly solutions for peanut pest control.

Method used

A Trichoderma virens strain MJ18 is provided. It has a strong parasitic effect on peanut white rot and sclerotinia. It is combined with the neonicotinoid insecticide clothianidin for peanut seed treatment to improve the emergence rate and control peanut white rot and insect pests.

Benefits of technology

Trichoderma viride MJ18 can effectively prevent and control peanut white rot and sclerotinia, improve the peanut emergence rate, and be used in combination with clothianidin to achieve joint prevention and control of peanut white rot and insect pests, reducing the use of chemical agents.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366084B_ABST
    Figure CN120366084B_ABST
Patent Text Reader

Abstract

The present invention discloses a Trichoderma viride ( Trichoderma green ) and their applications. The present invention provides a strain of Trichoderma viride that has a strong parasitic effect on peanut Sclerotinia rolfsii and Sclerotinia sclerotiorum, designated MJ18. It was deposited with the China Center for Type Culture Collection (CCTCC) on January 15, 2025, with the deposit number CCTCC NO: M 2025149. In addition to being used to inhibit peanut Sclerotinia rolfsii and Sclerotinia sclerotiorum, Trichoderma viride MJ18 can also inhibit plant pathogenic fungi such as Pythium ultimum, Fusarium graminearum, Pseudofus graminearum, and Rhizoctonia solani, and can be used to prevent and control related plant diseases caused by these pathogenic fungi. Furthermore, Trichoderma viride MJ18 can increase the emergence rate of peanuts and promote seedling growth. It can be used in combination with chemical pesticides as a seed coating agent to promote peanut germination while simultaneously preventing and controlling peanut Sclerotinia rolfsii and peanut insect pests.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biological control of plant pathogenic fungi. More specifically, it relates to a Trichoderma viride ( Trichoderma virens ) and its applications. Background Art

[0002] Plant fungal diseases are a common type of plant disease caused by plant pathogenic fungi. Their occurrence will seriously affect the yield and quality of agricultural products and restrict the development of related agricultural industries. Peanut Linn.) is an important oil crop, and peanut white rot fungus ( Sclerotium rolfsii Sacc) can harm the rhizomes, fruit stalks and pods of peanut plants, causing brown rot of the rhizomes and rot of the pods, seriously affecting the yield and quality of peanuts and causing huge economic losses.

[0003] At present, the prevention and control of plant diseases is still mainly based on chemical agents. However, improper use of chemical agents can easily lead to drug resistance in plant pathogens, increasing the difficulty of prevention and control. Moreover, chemical agents can pollute and damage the environment, endanger the health of organisms, and disrupt the food chain. Therefore, there is an urgent need to find environmentally friendly and pollution-free prevention and control technologies. Biological control based on biocontrol bacteria is one of the effective prevention and control methods for plant fungal diseases, with the advantages of being green and safe. Trichoderma spp.) are a class of saprophytic fungi widely distributed in nature, among which the most common Trichoderma is Trichoderma harzianum ( T. harzianum )、Trichoderma viride( T.viride ) and Trichoderma longibrachiata ( T. Longibrachiatum Since the discovery of Trichoderma's antagonistic effects against plant pathogenic fungi, numerous Trichoderma biocontrol strains have been reported. However, different Trichoderma strains control different plant fungal diseases. Even different Trichoderma strains of the same species can exhibit significant differences in their efficacy against the same plant fungal disease.

[0004] For example, the green mold isolated from the cultivation material of Pleurotus ostreatus by Gao Wei et al. Trichoderma green ) TH4 against Fusarium oxysporum ( Fusarium oxysporum ) and Rhizoctonia solani ( Rhizoctonia solani ) have a strong inhibitory effect on these two pathogens (Gao Wei, Li Baoju, Sun Junde, et al. Antagonistic effect of Trichoderma viride on Rhizoctonia solani and Fusarium oxysporum of cucumber [J]. Chinese Vegetables, 2008(6):4.), while Trichoderma viride TV41 screened by An Xia has an inhibitory effect on the growth of pepper phytophthora, pepper wilt and pepper anthracnose, but has no inhibitory effect on the growth of cucumber Rhizoctonia solani (An Xia. Study on the control effect of Trichoderma viride TV41 on pepper blight [D]. Jiangsu: Nanjing Agricultural University, 2014.). Therefore, only by continuously exploring strains with good biocontrol effects and continuously enriching the biocontrol bacteria library can it be more beneficial to the biological control of plant fungal diseases.

[0005] Although the pathogens that cause white rot in different plants all belong to the group of Sclerotium rufin ( Sclerotium rolfsii Sacc), but the biological characteristics of the white rot fungi isolated from different plants are not the same. The biological characteristics of the white rot fungi isolated from the same plants in different regions are also significantly different, including the strain growth rate, hyphal width, number of sclerotia produced and sclerotia size. (Xiao Xiang, Chen Xiaolan, Deng Mingguang, et al. A preliminary report on the distribution and biological characteristics of peanut white rot fungi in Guangdong Province [J]. Guangdong Agricultural Sciences, 2012, 39(17):4.) It has also been reported that the white rot fungi collected from different regions have obvious differences in drug resistance, indicating that different pesticides should be used to control the white rot fungi in different cultivation areas in production (Xiao Zhongjiu, Li Xiaoxia, Tian Maojie. Study on the toxicity differences of fungicides against white rot fungi in different planting areas [J]. Jiangsu Agricultural Sciences, 2012, 40(4):3.) Although there are reports of Trichoderma viride strains that can effectively control jasmine white rot, they are not necessarily effective in controlling peanut white rot. Because jasmine and peanuts differ significantly, the pathogens that infect and cause white rot in both crops also differ significantly. Currently, there is no effective biocontrol strain for white rot in peanuts.

[0006] Furthermore, peanut pests are a key disease affecting yield and quality. Providing biocontrol bacteria that can be used in conjunction with chemical agents for controlling peanut pests would help ensure peanut yield and quality, and promote the development of the peanut industry. Summary of the Invention

[0007] In view of the above-mentioned deficiencies in the prior art, the present invention provides a Trichoderma viride ( Trichoderma virens ) strain, which can be used to effectively prevent and control peanut white rot, and the green Trichoderma strain can be used in combination with neonicotinoid insecticides to achieve the joint prevention and control of peanut white rot and peanut pests.

[0008] The first object of the present invention is to provide a Trichoderma viride strain.

[0009] The second object of the present invention is to provide a preparation containing the Trichoderma viride.

[0010] The third object of the present invention is to provide use of the Trichoderma viride or the preparation in inhibiting plant pathogenic fungi.

[0011] The fourth object of the present invention is to provide use of the Trichoderma viride or the preparation in preparing a product for inhibiting plant pathogenic fungi.

[0012] The fifth object of the present invention is to provide the use of the Trichoderma viride or the preparation in preventing and controlling plant fungal diseases.

[0013] The sixth object of the present invention is to provide a use of the Trichoderma viride or the preparation in preparing a product for preventing and controlling plant fungal diseases.

[0014] The seventh object of the present invention is to provide the use of the Trichoderma viride or the preparation in improving the emergence rate of peanuts and / or promoting the growth of peanuts in the seedling stage.

[0015] The eighth object of the present invention is to provide the use of the Trichoderma viride or the preparation in preparing a product for improving the emergence rate of peanuts and / or promoting the growth of peanuts in the seedling stage.

[0016] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0017] The present invention obtains a strain of Trichoderma viride ( Trichoderma virens ), named MJ18 (hereinafter referred to as Trichoderma viride MJ18 or strain MJ18). The Trichoderma viride MJ18 has a strong parasitic effect on peanut white rot fungus and sclerotinia sclerotiorum, and can effectively prevent and control white rot caused by peanut white rot fungus and sclerotinia sclerotiorum caused by sclerotinia sclerotiorum. In addition, the Trichoderma viride MJ18 can also inhibit the growth of plant pathogenic fungi such as Fusarium ulminate, Fusarium graminearum, Pseudomonas graminearum and Rhizoctonia solani, and can be used to prevent and control related plant diseases caused by the above-mentioned pathogenic fungi. In addition, the present invention compounded Trichoderma viride MJ18 with the neonicotinoid insecticide clothianidin and treated peanut seeds, and found that it can effectively increase the emergence rate of peanuts and promote the growth of peanuts in the seedling stage. Therefore, the present invention requests protection of the Trichoderma viride MJ18 and its related products and applications.

[0018] The present invention provides a Trichoderma viride strain, named MJ18, which was deposited in the China Center for Type Culture Collection on January 15, 2025, with a deposit number of CCTCC NO: M 2025149.

[0019] The present invention also sequenced and analyzed the specific sequences contained in the Trichoderma viride MJ18, and found four specific genes, which were named specific genes 1 to 4. The nucleotide sequences of the genes are shown in SEQ ID NOs. 4 to 7, respectively.

[0020] In addition to the deposited Trichoderma viride MJ18 of the present invention, other Trichoderma viride strains containing one or more of the specific genes 1-4 described herein also have the same effects as the Trichoderma viride MJ18 described herein. Therefore, Trichoderma viride strains containing one or more of the specific genes 1-4 should also be within the scope of protection of the present invention.

[0021] The present invention also provides a preparation containing the Trichoderma viride MJ18 and / or its culture.

[0022] Optionally, the preparation further contains a neonicotinoid insecticide.

[0023] Optionally, the neonicotinoid insecticide includes imidacloprid, acetamiprid, thiamethoxam, clothianidin, thiacloprid, dinotefuran, nitenpyram, chlorothiazolin, cycloheximide and / or flupyradan.

[0024] Specifically, the neonicotinoid insecticide is thiamethoxam, clothianidin or thiacloprid.

[0025] In a specific embodiment of the present invention, the neonicotinoid insecticide is clothianidin.

[0026] Since Trichoderma viride MJ18 has an inhibitory effect on plant pathogenic fungi such as Sclerotium rolfsii, the present invention seeks to protect the use of Trichoderma viride MJ18 or the preparation in inhibiting plant pathogenic fungi.

[0027] The present invention also claims protection for the use of the Trichoderma viride MJ18 or the preparation in preparing a product for inhibiting plant pathogenic fungi.

[0028] Specifically, the plant pathogenic fungus is Sclerotium rolfsii ( Sclerotium rolfsii Sacc), Sclerotinia sclerotiorum ( Sclerotinia sclerotiorum ultimum ( The last Pythium ), Fusarium graminearum ( Fusarium grasses ), Pseudomonas graminearum ( Fusarium pseudogramineum ) and / or Rhizoctonia solani ( Rhizoctonia solani ).

[0029] Among them, the green mold MJ18 effectively inhibits peanut white rot fungus through heavy parasitism, and prevents and controls peanut white rot caused by peanut white rot fungus; the green mold MJ18 can also effectively inhibit sclerotinia sclerotiorum through heavy parasitism, and prevent and control sclerotinia disease caused by sclerotinia sclerotiorum.

[0030] Trichoderma viride MJ18 can inhibit pathogenic fungi such as peanut Sclerotium rolfsii and can be used to prevent and control related plant diseases. Therefore, the present invention also claims the use of Trichoderma viride MJ18 or the preparation in preventing and controlling plant fungal diseases.

[0031] The present invention also claims protection for the use of the Trichoderma viride MJ18 or the preparation in preparing products for preventing and controlling plant fungal diseases.

[0032] Specifically, the plant fungal disease is caused by Sclerotinia rolfsii, Sclerotinia sclerotiorum, Pythium ultimum, Fusarium graminearum, Pseudofusarium graminearum and / or Rhizoctonia solani.

[0033] The present invention combines Trichoderma viride MJ18 with the neonicotinoid insecticide clothianidin and treats peanut seeds, finding that the compound effectively increases the emergence rate of peanuts and promotes their seedling growth. Therefore, the present invention also claims the use of Trichoderma viride MJ18 or the formulation for increasing the emergence rate and / or promoting the growth of peanuts.

[0034] The use of the Trichoderma viride MJ18 or the preparation in the preparation of a product for improving the emergence rate of peanuts and / or promoting the growth of peanut seedlings should also be within the scope of protection of the present invention.

[0035] Specifically, the use of Trichoderma viride MJ18 and neonicotinoid insecticides in controlling pests should also be within the scope of protection of the present invention.

[0036] The present invention has the following beneficial effects:

[0037] The present invention isolated and purified a strain of Trichoderma viride, designated MJ18, that exhibits a strong parasitic effect against peanut Sclerotinia rolfsii and Sclerotinia sclerotiorum. MJ18 was deposited with the China Center for Type Culture Collection (CCTCC) on January 15, 2025, with the deposit number CCTCC NO: M 2025149. In addition to inhibiting peanut Sclerotinia rolfsii and Sclerotinia sclerotiorum, MJ18 also inhibits plant pathogenic fungi such as Pythium ultimum, Fusarium graminearum, Pseudomonas graminearum, and Rhizoctonia solani, and can be used to prevent and control related plant diseases caused by these pathogens.

[0038] In addition, the green mold MJ18 can increase the emergence rate of peanuts and promote the growth of peanut seedlings. It can be used in combination with chemical pesticides as a seed coating agent to promote peanut germination while achieving joint prevention and control of peanut white rot and peanut pests. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 This is the growth of strains MJ18, Trichoderma harzianum and Trichoderma acanthosporium on the confrontation plate with peanut Sclerotium rolfsii.

[0040] Figure 2 The growth of strain MJ18 on the confrontation plates with Fusarium graminearum, Pseudomonas graminearum, Rhizoctonia solani and Pythium ultimum, as well as the growth of strains on the control plates with various pathogenic fungi.

[0041] Figure 3 These are the results of the heavy parasitism test of strain MJ18 on peanut Sclerotium rolfsii.

[0042] Figure 4 These are the results of the MJ18 strain's parasitism test on Sclerotinia sclerotiorum.

[0043] Figure 5This is the effect of the combined use of strain MJ18 and 18% clothianidin on peanut emergence.

[0044] Figure 6 The effect of different concentrations of clothianidin on the growth of strain MJ18. DETAILED DESCRIPTION

[0045] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0046] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0047] The taxonomic name of the strain MJ18 described in the embodiment of the present invention is Trichoderma virens ( Trichoderma virens ), deposited in the China Center for Type Culture Collection (CCTCC) on January 15, 2025, with the deposit number CCTCC NO: M2025149, and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0048] Example 1 Isolation and molecular identification of strain MJ18

[0049] 1. Isolation and purification of strains

[0050] The strain MJ18 of the present invention was isolated from a green parasitic fungus in white silky hyphae on peanuts grown in pots. The isolation and purification process was as follows:

[0051] Use a sterile cotton swab to pick up the spores of the green fungus from the white silky hyphae on the pot-grown peanuts, dissolve the spores in sterile water, dilute them to an appropriate multiple, and then apply them to PDA plates for culture; after culturing for 24 to 48 hours, pick up a single colony on the plate and transfer it to a blank PDA plate for subculture; after 24 to 48 hours of subculture, use sterile tweezers to pick up the hyphae from the colony and transfer them to a blank plate for secondary isolation and culture. The colony obtained from the secondary isolation and culture was considered a pure culture colony and named MJ18.

[0052] Take the culture of pure culture colonies for bacterial species identification.

[0053] 2. Molecular identification of strains

[0054] Genomic DNA of strain MJ18 was extracted using a bacterial DNA extraction kit, and its ITS sequence was amplified by PCR using the extracted genomic DNA as a template. The amplified product was detected by electrophoresis and sent to a sequencing company for sequencing, resulting in the ITS sequence of strain MJ18 (shown in SEQ ID NO. 1). Blast analysis was performed on the ITS sequence in the NCBI database.

[0055] The primers used for PCR amplification of the ITS sequence of strain MJ18 are as follows:

[0056] ITS1-F:TCCGTAGGTGAACCTGCGG (SEQ ID NO.2);

[0057] ITS4-R:TCCTCCGCTTATTGATATGC (SEQ ID NO. 3).

[0058] The PCR amplification system was as follows: 12.5 μL of PCR reaction mixture (containing 10 × PCR Buffer, dNTPs (each 10 mM), TaqPlus DNA Polymerase (5 U / μL) and 50 mM MgSO4), 1 μL of primer ITS1-F (10 μM), 1 μL of primer ITS1-R (10 μM), 1 μL of template DNA, and ddH2O to 25 μL.

[0059] The PCR amplification program was as follows: 95°C for 5 min; 94°C for 30 s, 57°C for 30 s, and 72°C for 90 s, for 30 cycles; and 72°C for 10 min.

[0060] The sequencing results show that the ITS sequence of strain MJ18 is shown in SEQ ID NO. 1. It was compared and analyzed in the NCBI database, with the 100% matching strain with a longer Acc. Len as a reference. Combined with the physiological characteristics of strain MJ18, it was found that strain MJ18 is a Trichoderma viride ( Trichoderma virens ).

[0061] 3. Analysis of strain-specific sequences (specific genes)

[0062] In addition, the present invention also commissioned Sangon Biotech (Shanghai) Co., Ltd. to analyze the specific sequence of strain MJ18.

[0063] The genomic DNA of strain MJ18 was extracted and sequenced using an ABI 3730 DNA sequencer. Sequencing analysis revealed the presence of four specific sequences in strain MJ18, the nucleotide sequences of which are shown in SEQ ID NOs. 4 to 7, respectively.

[0064] During the sequencing process, the primers used for PCR amplification are shown below (SEQ ID NOs. 8 to 17):

[0065] AF395754.1-F:GATCCAATGCCACCGTATGCTCA (SEQ ID NO.8);

[0066] AF395754.1-R: CACATCATGGCACCGGCAAA (SEQ ID NO.9);

[0067] AF395756.1-F: ATGCCCAGGTTTGTTTATATCCCT (SEQ ID NO.10);

[0068] AF395756.1-R: CCACCGGGAGCTAGACCACT (SEQ ID NO.11);

[0069] AF397019.1-F: CTGCCTATCGATCTACCGCCTA (SEQ ID NO.12);

[0070] AF397019.1-R: CCACGGTATTCGTCCAAAGCTC (SEQ ID NO.13);

[0071] AF397020.1-F: TACCCTCAGCCTCTGCAAGCCCTC (SEQ ID NO.14);

[0072] AF397020.1-R: CACCGCCACCTCCAACTCCG (SEQ ID NO.15);

[0073] EF534378.1-F: TGCCTTCGTTGACTGCTCTCG (SEQ ID NO. 16);

[0074] EF534378.1-R: GACCTGTGCCTCAAAACCAGTG (SEQ ID NO. 17).

[0075] The present invention also preserved the strain MJ18, which was deposited in the China Center for Type Culture Collection (CCTCC) on January 15, 2025, with a deposit number of CCTCC NO: M 2025149, and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0076] Example 2 Inhibition of strain MJ18 against different pathogenic fungi

[0077] 1. Plate confrontation method to test the inhibitory effect of strain MJ18 on peanut white rot fungus

[0078] Take freshly cultured strain MJ18 and peanut Sclerotium rolfsii ( Sclerotium rolfsii Sacc..) plate, punch out a peanut white rot fungus cake with a 6 mm diameter punch and place it in the center of a blank PDA plate, and punch out strain MJ18 cakes with a 6 mm diameter punch and place them on both sides, keeping the distance between them and the peanut white rot fungus cakes at 20 mm; place the opposing plates inoculated with cakes in a 30°C constant temperature incubator, and observe the inhibitory effect of strain MJ18 on peanut white rot fungus after 11 days of incubation. Separately, obtain a laboratory-stored Trichoderma harzianum ( Trichoderma harzianum Rifai ) and Trichoderma aspergillus ( Trichoderma rough ) strains, and obtained confrontation plates of Trichoderma harzianum / Trichoderma acanthosporium and S. rolfsii according to the same method as above, placed them in a constant temperature incubator at 30℃, and observed after culturing for 11 days.

[0079] The growth of strains MJ18, Trichoderma harzianum and Trichoderma acanthosporium against Sclerotium rolfsii on the plate is shown in Figure 2. Figure 1 As shown. Figure 1 The strain MJ18 showed significant hyperparasitism against S. rolfsii, as evidenced by MJ18 hyphae adsorbing and entwining with the surface of the mycelium, and the S. rolfsii fungus plaques covered with a large amount of green spores. While the inoculated Trichoderma harzianum and Trichoderma acanthosporum strains showed some inhibitory effects against the fungus, they did not exhibit significant hyperparasitism.

[0080] 2. Inhibition rate of strain MJ18 against other pathogenic fungi

[0081] In addition to peanut Sclerotium rolfsii, the present invention also tested the strain MJ18 against Fusarium graminearum collected from different regions and / or host crops ( Fusarium gramineae ), Pseudomonas graminearum ( Fusarium pseudograsses ), Rhizoctonia solani ( Rhizoctonia solani ) and Pythium ultimum ( The last Pythium ) inhibition rate.

[0082] The inhibition rate test method is as follows: take freshly cultured strain MJ18 and the pathogenic fungus plate, use a 6 mm diameter puncher to punch out pathogenic fungus cakes and MJ18 cakes respectively, and place them on both sides of the plate as opposing plates. At the same time, set up a pathogenic fungus plate with only pathogenic fungus cakes on one end. After incubating the plate inoculated with the cakes in a constant temperature incubator for 3 days, measure the radius R1 of the pathogenic fungus cake on the pathogenic fungus plate toward the center of the plate, and simultaneously measure the radius R2 of the pathogenic fungus cake on the opposing plate toward the center of the plate. The inhibition rate is calculated according to the following formula;

[0083] .

[0084] The inhibition rates of strain MJ18 against pathogenic fungi collected from different regions and / or host plants are shown in Table 1. Figure 2 shown.

[0085] Table 1 Inhibition rate of strain MJ18 against pathogenic fungi collected from different regions and / or host plants

[0086]

[0087] Combine Figure 2 As shown in Table 1, strain MJ18 can effectively inhibit the growth of Pythium ultimum, with an inhibition rate of more than 75%. Strain MJ18 can also inhibit the growth of Fusarium graminearum, Pseudomonas graminearum and Rhizoctonia solani to a certain extent, and there are certain differences in the inhibitory effect on Fusarium graminearum collected from different regions and different host crops.

[0088] Example 3 Test of the efficacy of strain MJ18 against peanut white rot

[0089] 1. Test of the heavy parasitic effect of strain MJ18 on peanut Sclerotium rolfsii

[0090] 30 g of wheat grains were placed in a 500 mL Erlenmeyer flask, mixed with 70 mL of water, and sterilized at 121°C for 30 min to obtain sterile wheat grains. An appropriate amount of bacterial cake was scraped from a plate of peanut S. rutaecarpa using an inoculation spatula and inoculated into the sterile wheat grains. After mixing evenly, the mixture was propagated in a 30°C incubator for 7 days to obtain a large amount of peanut S. rutaecarpa mycelium. 200 g of organic soil was added to a clean disposable lunch box, and 10 g of peanut S. rutaecarpa mycelium was mixed evenly to obtain diseased soil. A concentration of 1 × 10 9 1 mL of MJ18 spore solution with a concentration of 100 cfu / mL was evenly dropped on the surface of the obtained diseased soil as the experimental group, and a blank control group with 1 mL of water was set up. The experimental group and the blank control group were cultured at room temperature of 20-35℃ for 11 days.

[0091] The results of the heavy parasitism test of strain MJ18 on peanut Sclerotium rolfsii are as follows Figure 3 As shown. Figure 3 It can be seen that after 11 days of cultivation, the mycelia of peanut S. rolf- iae pathogen in the blank control group grew rapidly, while the mycelia of peanut S. rolf-iae pathogen in the experimental group were parasitized and killed by strain MJ18 after growth.

[0092] Furthermore, the peanut white rot colonies from the blank control group and the experimental group were taken on plates for passage test to verify the control effect of strain MJ18 on peanut white rot. The specific method is as follows: use tweezers to pick up the mycelia of peanut white rot fungus in the blank control group and place them in the center of the PDA plate, set up 10 parallel passages for subculture, and serve as the mycelium blank control group; use tweezers to pick up the sclerotia of peanut white rot fungus in the blank control group and place them in the center of the PDA plate, set up 10 parallel passages for subculture, and serve as the sclerotium blank control group; pick up the mycelia of peanut white rot fungus inoculated with MJ18 spore solution group and rinse them under sterile water three times, pick up the mycelia without MJ18 mycelia and spores attached under a microscope and place them on the PDA plate, set up 10 parallel passages for subculture, and serve as the mycelium experimental group; pick up the sclerotia of peanut white rot fungus inoculated with MJ18 spore solution group and rinse them under sterile water three times, pick up the sclerotia without MJ18 mycelia and spores attached under a stereoscope and place them on the PDA plate, set up 10 parallel passages for subculture, and serve as the sclerotium experimental group; place the above-mentioned passaged plates in a 30°C constant temperature incubator in the dark for 5 minutes. After 14 days, the hyphae and sclerotia of peanut white rot fungus were observed to see whether they grew normally. The results are shown in Table 2.

[0093] Table 2 Test of the heavy parasitic effect of strain MJ18 on peanut Sclerotium rolfsii

[0094]

[0095] The results shown in Table 2 show that strain MJ18 has a strong parasitic effect on peanut white rot fungus and can kill 100% of the parasitic peanut white rot fungus hyphae and sclerotia, which has a good application prospect for the treatment of peanut white rot.

[0096] 2. Test on the efficacy of strain MJ18 against peanut white rot

[0097] The present invention takes peanut as an example to test the control effect of strain MJ18 on peanut white rot.

[0098] Peanut seeds (Yuanhua 308) were sown in medium-sized flower pots, with 2 seeds per pot. After sowing, they were cultured in a greenhouse at 28°C, 75% humidity, and a photoperiod of 14 h light / 10 h dark. Watering was done every 3-5 days. 10 days after sowing, the potted plants were thinned out, leaving only one plant per tray. The plants that grew too weak or too vigorously in each tray were cut off from the hypocotyl with scissors and the aboveground parts were removed. After 15 days of planting, the hypocotyls of the peanuts were pierced 5 times with a syringe needle to injure the roots, and the experimental treatments were started: Treatment 1: 20 grains of peanut white rot fungus were placed on the hypocotyls of the peanut plants. After culturing for 2 days, 1 mL of 2×10 8cfu / mL of MJ18 spore solution, set up 20 replicates; treatment 2 used 20 grains of peanut Sclerotium rolfsii placed on the hypocotyl of peanut plants, cultured for 2 days, and dripped 1 mL of 2×10 8 cfu / mL of Trichoderma viride ( Trichoderma green ) MJ20 spore solution (Trichoderma viride strain MJ20 is a strain preserved in the applicant's laboratory, which has an inhibition rate of about 75% on peanut Sclerotinia rolfsii colonies on the plate, but has no heavy parasitism ability on peanut Sclerotinia rolfsii), with 20 parallels set; Treatment 3 used 20 grains of peanut Sclerotinia rolfsii wheat placed on the hypocotyl of the peanut plant, and after culturing for 2 days, 1 mL of high-temperature sterilized MJ18 spore solution (this spore solution is exactly the same as that of Treatment 1 before sterilization) was added dropwise near the hypocotyl, with 20 parallels set; Treatment 4 used 20 sterilized grains placed on the hypocotyl of the peanut plant, and after culturing for 2 days, 1 mL of a 2×10 8 cfu / mL of MJ18 spore solution, set up 20 replicates.

[0099] After the above four treatments were completed, the plants were placed in a greenhouse with a temperature of 28°C, a relative humidity of 90%, and a 14-h light / 10-h dark treatment for cultivation; the disease index and incidence rate were investigated once every three days. After 10 consecutive investigations, the disease index and incidence rate of the plants were calculated, and the control effect was statistically analyzed.

[0100] Disease grading standards: Level 0 means no yellowing of leaves or diseased branches, Level 1 means less than 25% of the plant is wilted or dead, Level 3 means 25-50% of the plant is wilted or dead, Level 5 means more than 50% of the plant is wilted but not dead; Level 7 means the entire plant is dead.

[0101] Incidence rate = number of diseased plants × 100% / number of surveyed plants;

[0102] Disease index = Σ (number of diseased plants at each level × corresponding disease level value) × 100 / (total number of surveyed plants × highest disease level);

[0103] The control effect = (disease index of the control group - disease index of the treatment group) × 100% / disease index of the control group.

[0104] In the above treatment, the preparation method of wheat grains infected with peanut white rot was as follows: 100 g of wheat grains were added with 100 mL of water and placed in a 500 mL Erlenmeyer flask for mixing and sterilization (sterilization at 121°C for 30 min). After cooling, the wheat grains were inoculated with the preserved mycelium of peanut white rot, and then cultured in a constant temperature box at 28°C and 80% humidity for 5 to 8 days to obtain wheat grains infected with peanut white rot.

[0105] Table 3 shows the statistical results of peanut morbidity, disease index, and control efficacy for each treatment group. As shown in Table 3, strain MJ18 demonstrated excellent control efficacy against peanut S. rot, exceeding 95%. This is likely due to strain MJ18's strong hyperparasitic ability against S. rot. Once introduced into the soil, its hyperparasitic nature allows for better colonization and control. In contrast, strain MJ20, lacking hyperparasitic ability, exhibits poor soil growth, resulting in poorer control efficacy against S. rot.

[0106] Table 3 Statistical results of peanut incidence, disease index and control effect in each treatment group

[0107]

[0108] Example 4 Test of the parasitic effect of strain MJ18 on Sclerotinia sclerotiorum

[0109] 30 g of wheat grains were placed in a 500 mL triangular flask, 70 mL of water was added, and the mixture was sterilized at 121 °C for 30 min to obtain sterile wheat grains; Sclerotinia sclerotiorum ) Use an inoculation spatula to scrape an appropriate amount of bacterial cake from the plate and inoculate it into sterile wheat grains. Mix well and then place in a 30°C incubator for 7 days to obtain a large amount of Sclerotinia mycelium. Add 200 g of organic soil to a clean disposable lunch box, take 10 g of Sclerotinia mycelium and mix evenly to obtain diseased soil; take a concentration of 1×10 9 1 mL of MJ18 spore solution with a concentration of 100 cfu / mL was evenly dropped on the surface of the diseased soil as the experimental group, and a blank control group with 1 mL of water was set up. Both the experimental group and the blank control group were cultured at room temperature of 20-35℃ for 11 days.

[0110] The results of the MJ18 strain's parasitism test on Sclerotinia sclerotiorum are as follows: Figure 4 As shown. Figure 4 It can be seen that after 11 days of culture, the mycelia of Sclerotinia sclerotiorum in the blank control group grew rapidly, while the mycelia of Sclerotinia sclerotiorum in the experimental group were parasitized by MJ18 after growth. The results showed that MJ18 had a strong parasitic effect on Sclerotinia sclerotiorum.

[0111] Furthermore, the Sclerotinia sclerotiorum colonies from the blank control group and the experimental group were cultured on plates to verify the control effect of the strain MJ18 on Sclerotinia sclerotiorum. The specific method is as follows: use tweezers to pick up the blank control group sclerotial disc hyphae and place them in the center of the PDA plate, set up 10 parallel passages for subculture, and ... culture the blank control group sclerotial disc hyphae and place them in the center of the PDA plate, set up 10 parallel passages for subculture, and use tweezers to culture the blank control group sclerotial disc hyphae and place them in the center of the PDA plate, set up 10 parallel passages for subculture, and use tweezers to culture the blank control group sclerotial disc hyphae and place them in the center of the PDA plate, set up d later, the normal growth of S. sclerotiorum was observed. The results are shown in Table 4.

[0112] Table 4 Test of the parasitic effect of strain MJ18 on Sclerotinia sclerotiorum

[0113]

[0114] The results shown in Table 4 show that strain MJ18 has a strong parasitic effect on Sclerotinia sclerotiorum and can kill 100% of the parasitic Sclerotinia sclerotiorum hyphae and sclerotia, and can be used for the prevention and control of Sclerotinia sclerotiorum and the plant diseases caused by it.

[0115] Example 5 Effect of strain MJ18 on peanut emergence

[0116] In addition to diseases such as peanut white rot, the prevention and control of peanut pests is also an issue that needs to be focused on during peanut cultivation. Most of the preparations used to prevent and control peanut pests are chemical reagents. When they are used in conjunction with biocontrol bacteria, the function of the biocontrol bacteria may be affected. As reported, imidacloprid, thiamethoxam, and difenoconazole have no significant effect on the diversity of endophytic bacterial communities in rice roots and leaves, but can reduce the richness of root communities. The present invention uses clothianidin as an example, and tests its effect on the growth of strain MJ18, as well as its effect on peanut germination rate and germination potential when used in conjunction with strain MJ18, to test whether the two can be used in conjunction to prevent and control peanut fungal diseases and insect pests.

[0117] 1. Effects of the combined use of clothianidin and strain MJ18 on peanut germination rate and germination potential

[0118] The experimental groups were set up as shown in Table 5. The concentration was 1×10 9MJ18 spore suspension containing 50, 100, 200, and 400 cfu / mL of MJ18 seed was coated with 800 g of 18% clothianidin per 100 kg of seed. During coating, the spore suspension, 18% clothianidin, and a film-forming agent were uniformly mixed to form a seed coating agent. The seed coating agent was then mixed with peanut seeds in a coating machine and thoroughly mixed to obtain coated peanut seeds. Organic and inorganic soil were mixed in a mass ratio of 1:2 and placed in small flower pots. The coated peanut seeds were sown at a rate of 5 seeds per pot. Growth of each treatment was observed 14 to 21 days after sowing. A control group without MJ18 was also established.

[0119] Table 5

[0120]

[0121] The results of the combined use of strain MJ18 and 18% clothianidin on peanut emergence are as follows: Figure 5 As shown. Figure 5 It can be seen that the growth rate of the treatment with strain MJ18 added was higher than that of the treatment with clothianidin alone, and with the increase of the dosage of strain MJ18 spore solution, its growth rate also continued to improve, reaching the highest level when the dosage of MJ18 spore solution was 400 g / 100 kg of seeds.

[0122] 2. Effect of clothianidin on the growth of strain MJ18

[0123] Prepare PDA plates containing 0.1, 1, 10, and 50 ppm of clothianidin, respectively, and use a PDA plate without clothianidin as a control. Take a freshly cultured strain MJ18 plate, use a 6 mm diameter puncher to punch out bacterial cakes, and place them in the center of the PDA plates containing different concentrations of clothianidin. After incubating in a constant temperature incubator for the same time, observe the growth of strain MJ18. The results are as follows: Figure 6 As shown. Figure 6 It can be seen that clothianidin has no inhibitory effect on the growth of strain MJ18.

[0124] Combined with the above results, it can be seen that strain MJ18 can be used in combination with clothianidin to better control peanut diseases and pests. The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to these examples. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principles of the present invention are considered equivalent replacements and are included within the scope of protection of the present invention.

Claims

1. A strain of Trichoderma viride ( Trichoderma virens ), characterized in that, The Trichoderma viride was deposited in the China Center for Type Culture Collection on January 15, 2025, with the deposit number being CCTCC NO: M 2025149.

2. A preparation, characterized in that Containing the Trichoderma viride according to claim 1 and / or the spore liquid of the Trichoderma viride.

3. The preparation according to claim 2, characterized in that It also contains neonicotinoid insecticide; the neonicotinoid insecticide is clothianidin.

4. Use of the Trichoderma viride according to claim 1 or the preparation according to claim 2 or 3 in inhibiting plant pathogenic fungi, characterized in that: The plant pathogenic fungi are Sclerotinia rolfsii, Sclerotinia sclerotiorum, Pythium ultimum, Fusarium graminearum, Pseudofusarium graminearum and / or Rhizoctonia solani.

5. Use of the Trichoderma viride according to claim 1 or the preparation according to claim 2 or 3 in preparing a product for inhibiting plant pathogenic fungi, characterized in that: The plant pathogenic fungi are Sclerotinia rolfsii, Sclerotinia sclerotiorum, Pythium ultimum, Fusarium graminearum, Pseudofusarium graminearum and / or Rhizoctonia solani.

6. Use of the Trichoderma viride according to claim 1 or the preparation according to claim 2 or 3 in preventing and controlling plant fungal diseases, characterized in that: The plant fungal diseases are caused by Sclerotinia rolfsii, Sclerotinia sclerotiorum, Pythium ultimum, Fusarium graminearum, Pseudofusarium graminearum and / or Rhizoctonia solani.

7. Use of the Trichoderma viride according to claim 1 or the preparation according to claim 2 or 3 in preparing a product for preventing and controlling plant fungal diseases, characterized in that: The plant fungal diseases are caused by Sclerotinia rolfsii, Sclerotinia sclerotiorum, Pythium ultimum, Fusarium graminearum, Pseudofusarium graminearum and / or Rhizoctonia solani.

8. Use of the preparation according to claim 3 in increasing the emergence rate of peanuts and / or promoting the growth of peanuts at the seedling stage.

9. Use of the preparation according to claim 3 in preparing a product for increasing the emergence rate of peanuts and / or promoting the growth of peanuts at the seedling stage.

Citation Information

Patent Citations

  • Trichoderma aureoviride strain and application thereof

    CN103320330A

  • Trichoderma citrinoviride and application thereof

    CN105039168A