Phytobacterium plantarum BD7807 and application thereof in treatment of lipid metabolism disorder

By preparing the BD7807 product of Lactobacillus plantarum, it uses its powerful lipid-lowering, antioxidant and antibacterial ability to solve the problem of major side effects of existing drugs in treating lipid metabolism disorders, and achieves safe and effective improvement of lipid metabolism disorders.

CN120366108APending Publication Date: 2025-07-25BRIGHT DAIRY & FOOD CO LTD
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202510396017.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-31
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

Existing drugs have great side effects in the treatment of lipid metabolic disorders, which limits the scope of use and patient compliance. It is urgent to find safe and effective alternative or auxiliary treatment methods.

Method used

The products were prepared by fermentation, centrifugation, coating and lyophilization, and their significant lipid-lowering, antioxidant and antibacterial abilities were used to improve lipid metabolism disorders.

Benefits of technology

The Cytobacterium Lactobacillus BD7807 has a cholesterol clearance of 78.88%, a triglyceride clearance of 66.21%, an ABTS clearance of 81.91%, a DPPH clearance of 80.51%, and an O2- clearance of 58.24%, effectively inhibits Enterobacterium Sakazaki and Salmonella, reduces weight without damaging the organs, and is safe.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention relates to the technical field of microorganisms, in particular to a plant lactobacillus BD7807 and application thereof in treating lipid metabolism disorder, and particularly discloses a plant lactobacillus BD7807 with the preservation number of CGMCC (China General Microbiological Culture Collection Center) NO.33630. The invention further discloses a preparation method of the plant lactobacillus BD7807. The plant lactobacillus BD7807 has obvious lipid-lowering, anti-oxidation and adhesion capabilities, is bacteriostatic, has no multiple drug resistance, can play a role in lowering lipid without damaging other organs, and can be widely used for preventing and treating related symptoms caused by lipid metabolism disorder.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and particularly to a Lactiplantibacillus plantarum BD7807 and its application in the treatment of lipid metabolism disorders. Background Art

[0002] Lipid metabolism disorders have become a global health problem of widespread concern, and the incidence rate has risen rapidly with the transformation of modern lifestyles. Factors such as poor eating habits (excessive intake of high-saturated fat and high-cholesterol foods), lack of exercise, and increased life stress have promoted its spread in the population, especially among the middle-aged and elderly groups and obese people.

[0003] Lipid metabolism disorders are not isolated problems, and they are closely related to many serious chronic diseases. Abnormal elevation of lipids such as cholesterol and triglycerides in the blood will deposit on the blood vessel wall, leading to atherosclerosis and greatly increasing the risk of cardiovascular diseases such as coronary heart disease, myocardial infarction, and stroke. At the same time, it interacts with diabetes and forms a vicious cycle, exacerbating the complexity of the disease and the difficulty of treatment. For example, high blood sugar interferes with lipid metabolism, and abnormal lipid levels affect insulin sensitivity, making it difficult to control blood sugar.

[0004] Currently, the clinical treatment of lipid metabolism disorders mainly relies on drugs, and statins and fibrates are more commonly used. However, with long-term use, the disadvantages of these drugs are prominent. Symptoms such as muscle pain and weakness affect the patient's life and even lead to drug discontinuation. Abnormal liver function may also cause serious liver problems such as liver injury and liver failure. Patients need to frequently monitor liver function, increasing the medical cost and psychological burden. These side effects greatly limit the scope of drug use and patient compliance, and it is urgent to find safe and effective alternative or adjuvant treatment methods. Summary of the Invention

[0005] In view of the above-mentioned disadvantages of the prior art, the purpose of the present invention is to provide a Lactiplantibacillus plantarum BD7807 and its application in the treatment of lipid metabolism disorders to solve the problems in the prior art.

[0006] To achieve the above object and other related objects, the present invention first provides a Lactiplantibacillus plantarum BD7807 with a preservation number of CGMCC NO.33630.

[0007] The present invention also provides the use of Lactiplantibacillus plantarum BD7807 with a preservation number of CGMCC NO.33630 in the preparation of a product for treating lipid metabolism disorders.

[0008] The present invention also provides the use of Lactiplantibacillus plantarum BD7807 with a preservation number of CGMCC NO.33630 in the preparation of an antibacterial product.

[0009] The present invention also provides a product for inhibiting bacteria or improving lipid metabolism disorders, and the product necessarily includes the Lactiplantibacillus plantarum BD7807, and uses the Lactiplantibacillus plantarum BD7807 as an active ingredient for the foregoing effects.

[0010] The present invention also provides a preparation method of a product for inhibiting bacteria or improving lipid metabolism disorders, and the preparation method includes the following steps:

[0011] 1) Ferment the Lactiplantibacillus plantarum BD7807 to obtain a fermentation broth;

[0012] 2) Centrifuge the fermentation broth, take the bacterial sludge for coating, freeze-drying and pulverizing to obtain the product.

[0013] As described above, a Lactiplantibacillus plantarum BD7807 of the present invention and its application in treating lipid metabolism disorders have the following beneficial effects:

[0014] 1) The Lactiplantibacillus plantarum BD7807 has strong lipid-lowering ability and antioxidant ability. Among them, in the simulated gastrointestinal fluid environment, its cholesterol clearance rate is 78.88% and triglyceride clearance rate is 66.21% at 18 h. In addition, the clearance rate of the Lactiplantibacillus plantarum BD7807 for ABTS is 81.91%, the clearance rate for DPPH is 80.51%, the clearance rate for O2- is 58.24%, and the clearance rate for ·OH free radicals is 79.27%. In summary, the Lactiplantibacillus plantarum BD7807 has a high clearance rate and strong antioxidant activity; it helps to protect host cells from oxidative stress damage, and thus may have a positive impact on maintaining intestinal health and promoting overall health.

[0015] 2) The surface hydrophobicity of the Lactiplantibacillus plantarum BD7807 is up to 63.54% under the condition of chloroform as an organic solvent and up to 39.78% under the condition of xylene as an organic solvent, and its autoagglutination ability is 69.33%. In summary, the Lactiplantibacillus plantarum BD7807 has good adhesion ability and the ability to enter the body and colonize in the body.

[0016] 3) The Lactiplantibacillus plantarum BD7807 can effectively inhibit the sensitivity to antibiotics and the ability of pathogenic bacteria. The Lactiplantibacillus plantarum BD7807 has no multi-drug resistance, is sensitive to chloramphenicol, tetracycline, amoxicillin, and gentamicin, and has safety;

[0017] 4) The Lactiplantibacillus plantarum BD7807 has the ability to inhibit Enterobacter sakazakii and Salmonella, and the sizes of the inhibition zones are 12.87 ± 0.47 mm and 21.53 ± 1.25 mm respectively. It has the strongest antibacterial ability among the screened Lactiplantibacillus plantarum, can effectively inhibit Enterobacter sakazakii and Salmonella, and has a strong ability to inhibit intestinal pathogenic bacteria;

[0018] 5) Lactiplantibacillus plantarum BD7807 is safe for the body and has a lipid-lowering effect in vivo; Lactiplantibacillus plantarum BD7807 can reduce the body weight of high-fat diet-fed mice without changing their food intake, and will not cause damage to other organs.

[0019] In summary, Lactiplantibacillus plantarum BD7807 provided by the present invention has significant lipid-lowering, antioxidant, adhesion ability, antibacterial, and no multi-drug resistance. It can play a lipid-lowering role without damaging other organs, and can be widely used for the prevention and treatment of related symptoms caused by lipid metabolism disorders, with broad market prospects.

[0020] Deposit number: CGMCC N. 33630;

[0021] Classification and naming: Lactiplantibacillus plantarum

[0022] Depositary institution: China General Microbiological Culture Collection Center;

[0023] Address of the depositary institution: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing;

[0024] Deposit date: February 24, 2025. Description of the drawings

[0025] Figure 1 It shows a schematic diagram of the cholesterol removal rate of Lactiplantibacillus plantarum BD7807 in a simulated gastrointestinal fluid environment in Example 1 of the present invention. In the figure, the "letter marking method" is used to represent the significant differences statistically. Different letters (a, b, c, d, e) between groups represent significant differences between groups.

[0026] Figure 2 It shows a schematic diagram of the triglyceride degradation rate of Lactiplantibacillus plantarum BD7807 in a simulated gastrointestinal fluid environment in Example 1 of the present invention.

[0027] Figure 3 It shows a schematic diagram of the free radical scavenging rate of Lactiplantibacillus plantarum BD7807 in Example 1 of the present invention.

[0028] Figure 4 It shows a schematic diagram of the growth curve of Lactiplantibacillus plantarum BD7807 in Example 1 of the present invention.

[0029] Figure 5 (A) shows the cell morphology of Lactiplantibacillus plantarum stained by Gram staining in Example 1 of the present invention; (B) shows the phylogenetic tree diagram of the strain.

[0030] Figure 6Schematic diagram showing the surface hydrophobicity and auto - aggregation ability of Lactiplantibacillus plantarum BD7807 in Example 2 of the present invention.

[0031] Figure 7 Schematic diagram showing the changes in body weight of each group of mice during the experimental period in Example 4 of the present invention.

[0032] Figure 8 Schematic diagram showing the effect of Lactiplantibacillus plantarum BD7807 on the food intake of each group of mice in Example 4 of the present invention.

[0033] Figure 9 Schematic diagram showing the H&E staining of adipose tissue and Oil Red O staining of liver in each group of mice in Example 4 of the present invention.

[0034] Figure 10 Schematic diagram showing the epididymal fat coefficient (A) and serum fat level (B) of each group of mice in Example 4 of the present invention.

[0035] Figure 11 Schematic diagram showing the levels of ALT (left) and AST (right) in the serum of each group of mice in Example 4 of the present invention. Detailed implementation manners

[0036] The present invention first provides a Lactiplantibacillus plantarum BD7807, with the deposit number CGMCC NO.33630; the taxonomic name is Lactiplantibacillus plantarum; the deposit date is February 24, 2025; it is deposited in the China General Microbiological Culture Collection Center; the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0037] The Lactiplantibacillus plantarum BD7807 is isolated from pickles.

[0038] The Lactiplantibacillus plantarum BD7807 is a Gram - positive bacterium, and its cells are rod - shaped.

[0039] The sequence of the 16S rDNA of the Lactiplantibacillus plantarum BD7807 is as follows:

[0040] GGTCATGGACGAAGTCTGATGGAGCACGCCGCGTGAGTGAAGAAGGGTTTCGGCT CGTAAAACTCTGTTGTTAAAGAAGAACATATCTGAGAGTAACTGTTCAGGTATTGACGGT ATTTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTAATAA.

[0041] In certain embodiments of the present invention, the Lactiplantibacillus plantarum BD7807 has any one or more of the following effects:

[0042] 1) The cholesterol clearance rate is above 78%;

[0043] 2) The triglyceride clearance rate is above 60%;

[0044] 3) The clearance rate of ABTS is above 80%;

[0045] 4) The clearance rate of DPPH is above 80%;

[0046] 5) The clearance rate of O2- is above 58%;

[0047] 6) The clearance rate of ·OH free radicals is above 79%.

[0048] The present invention also provides the use of Lactiplantibacillus plantarum BD7807 with the preservation number of CGMCC NO. 33630 in the preparation of products for treating lipid metabolism disorders.

[0049] The "lipid metabolism disorder" refers to the abnormality of the quantity and quality of lipids (lipids) and their metabolites in the blood and other tissues and organs caused by congenital or acquired factors. The metabolism of lipids includes the digestion and absorption of lipids in the small intestine, entry into the blood circulation through the lymphatic system (transported by lipoproteins), transformation by the liver, storage in adipose tissue, and utilization by tissues when needed.

[0050] In the present invention, the treatment refers to exerting a series of positive effects after the disease has already started to develop. Specifically, it can slow down the progression speed of the disease, control the originally rapid development trend; can interrupt the process of continuous deterioration of the disease, and prevent the disease from further evolving in a serious direction; effectively control the severity of the disease and avoid it exceeding the body's tolerance range; stop the adverse development trend of the disease and prevent it from deteriorating further; relieve various discomfort symptoms brought by the disease and alleviate the pain of the patient; and even reverse the progression direction or severity of a specific sign, symptom, disorder, disease to a certain extent. However, it should be clear that this treatment does not necessarily mean that it can involve the complete elimination of all signs, symptoms, diseases or disorders related to the disease, but rather improve the state of the disease and slow down the signs, symptoms, diseases or disorders related to the disease.

[0051] In certain embodiments of the present invention, the product for treating lipid metabolism disorders treats lipid metabolism disorders through any one or more of the following:

[0052] 1) Reducing the content of cholesterol;

[0053] 2) Reducing the content of triglycerides;

[0054] 3) Reduce the levels of transaminases in the blood; specifically, the transaminases are alanine aminotransferase (ALT) and / or aspartate aminotransferase (AST);

[0055] 4) Alleviate the oxidative stress state.

[0056] In certain embodiments of the present invention, the product for treating lipid metabolism disorders has any one or more of the following effects:

[0057] 1) Reduce the cholesterol content;

[0058] 2) Reduce the triglyceride content;

[0059] 3) Reduce the levels of transaminases in the blood; specifically, the transaminases are alanine aminotransferase (ALT) and / or aspartate aminotransferase (AST);

[0060] 4) Alleviate the oxidative stress state; specifically, the alleviation of the oxidative stress state is achieved by scavenging ABTS radicals, DPPH radicals, superoxide anion radicals and / or hydroxyl radicals to alleviate the oxidative stress state.

[0061] In certain embodiments of the present invention, the reduction of the cholesterol content in the body as described above means that the cholesterol content in the subject's body approaches or reaches that of a healthy individual. For example, based on the cholesterol content in a healthy individual, the product can restore the cholesterol content in the subject's body to at least 10%, preferably at least 30%, more preferably at least 50%, still more preferably at least 70%, and most preferably at least 90% of that of a healthy individual;

[0062] In certain embodiments of the present invention, the reduction of the triglyceride content in the body as described above means that the triglyceride content in the subject's body approaches or reaches that of a healthy individual. For example, based on the triglyceride content in a healthy individual, the product can restore the triglyceride content in the subject's body to at least 10%, preferably at least 30%, more preferably at least 50%, still more preferably at least 70%, and most preferably at least 90% of that of a healthy individual;

[0063] In certain embodiments of the present invention, the reduction of the ALT level in the liver as described above means that the ALT level in the subject's liver approaches or reaches that of a healthy individual. For example, based on the ALT level in a healthy individual's liver, the product can restore the ALT level in the subject's liver to at least 10%, preferably at least 30%, more preferably at least 50%, still more preferably at least 70%, and most preferably at least 90% of that of a healthy individual;

[0064] In certain embodiments of the present invention, reducing the level of AST in the liver means making the level of AST in the liver of the subject close to or reach the content of a healthy individual. For example, based on the level of AST in the liver of a healthy individual, the product can restore the level of AST in the liver of the subject to at least 10%, preferably at least 30%, more preferably at least 50%, even more preferably at least 70%, and most preferably at least 90% of that of a healthy individual.

[0065] The viable count of the live bacteria in the product for treating lipid metabolism disorders is 10 8 ~10 9 cfu / mL.

[0066] The present invention also provides the use of Lactiplantibacillus plantarum BD7807 with the preservation number of CGMCC NO. 33630 in the preparation of an antibacterial product.

[0067] In certain embodiments of the present invention, the antibacterial product inhibits intestinal pathogenic bacteria. The intestinal pathogenic bacteria are Enterobacter sakazakii or Salmonella.

[0068] The viable count of the live bacteria in the antibacterial product is 10 8 ~10 9 cfu / mL.

[0069] The term "inhibit" refers to the process of inhibiting bacteria or interfering with the growth, reproduction, and activity of bacteria. Therefore, in this application, the inhibition can be the inhibition of the growth of intestinal pathogenic bacteria, the inhibition of the reproduction of intestinal pathogenic bacteria, or the inhibition of the activity of intestinal pathogenic bacteria. Further, the "inhibition" can be achieved by Lactiplantibacillus plantarum BD7807, the culture solution of Lactiplantibacillus plantarum BD7807, the fermentation broth of Lactiplantibacillus plantarum BD7807, the fermentation product of Lactiplantibacillus plantarum BD7807, the asexual progeny of Lactiplantibacillus plantarum BD7807, etc. on intestinal pathogenic bacteria.

[0070] The term "fermentation product" refers to the product produced by microorganisms through fermentation technology, which is a process of converting substrates into products required by humans through specific metabolic pathways under suitable conditions. Different types of microorganisms have different abilities to produce metabolic products. Therefore, various products required by people can be produced using different microorganisms.

[0071] In a specific embodiment of the present invention, the diameter of the antibacterial zone of Lactiplantibacillus plantarum BD7807 against the intestinal pathogenic bacteria is greater than 12 - 22 mm. Specifically, the diameter of the antibacterial zone of Lactiplantibacillus plantarum BD7807 against Enterobacter sakazakii is 12 mm; the diameter of the antibacterial zone of Lactiplantibacillus plantarum BD7807 against Salmonella is 21 mm.

[0072] The "bacteriostatic circle" is a method of determining the bacteriostatic titer of a test substance based on the size of a transparent circle formed by the inhibition of bacterial growth around the test substance as it diffuses in an agar plate. Among the methods for evaluating bacteriostatic ability using the bacteriostatic circle, the most commonly used are the K-B method (Kirby-Bauer test), the Oxford cup method, and the punching method. The K-B method, also known as the filter paper method, involves selecting filter paper with uniform texture, punching out round pieces of the same diameter using a punching machine, sterilizing and drying them, soaking them in the test sample, and then placing them in a test plate and culturing for a period of time to measure the size of the bacteriostatic circle. The Oxford cup method, also known as the cup plate method, involves placing a sterilized Oxford cup in a test plate and injecting a certain amount of the test sample into the cup, and then culturing for a period of time to measure the size of the bacteriostatic circle. The punching method refers to using a sterilized punch or steel pipe to punch holes in a test plate, injecting a certain amount of the test sample into the holes, and then culturing for a period of time to measure the size of the bacteriostatic circle. Using the bacteriostatic circle to evaluate bacteriostatic ability is an existing technology, and those skilled in the art can select and adjust a suitable method according to the actual situation. For example, the K-B method in the present application can be used, or other methods can be used to replace the K-B method to achieve the purpose of forming a bacteriostatic circle.

[0073] In certain embodiments of the present invention, the bacteriostatic product may further include other conventional bacteriostatic components to play a synergistic bacteriostatic role, such as chitosan, protamine, lysozyme, tea polyphenols, sodium alginate, spice extracts, plant essential oils, nisin, natamycin, polylysine, etc.

[0074] The present invention also provides a bacteriostatic or lipid metabolism disorder-improving product, which necessarily includes the Lactiplantibacillus plantarum BD7807, and uses the Lactiplantibacillus plantarum BD7807 as the active ingredient for the aforementioned effects.

[0075] In the product, the active ingredient that plays a role may be only the Lactiplantibacillus plantarum BD7807, or may also include other substances.

[0076] That is, the Lactiplantibacillus plantarum BD7807 is the sole active ingredient or one of the active ingredients of the product.

[0077] The product can be a single-component substance or a multi-component substance.

[0078] There is no special limitation on the dosage form of the product, and it can be various forms such as solid, liquid, gel, semi-liquid, aerosol, powder, etc. In certain embodiments of the present invention, the dosage form of the product for treating lipid metabolism disorder is powder, that is, bacterial powder, and the concentration of Lactiplantibacillus plantarum BD7807 in the bacterial powder is 10 8 cfu / mL to 10 9 cfu / mL.

[0079] The main target of the said product is mammals. The mammals are preferably rodents, artiodactyls, perissodactyls, lagomorphs, primates, etc. The rodents are preferably mice. The primates are preferably monkeys, apes or humans.

[0080] The product includes but is not limited to drugs, health products, foods, etc.

[0081] In certain embodiments of the present invention, the product is a drug, and the drug further includes a pharmaceutically acceptable carrier or excipient.

[0082] "Pharmaceutically acceptable" means that when the drug is properly administered to animals or humans, they do not produce adverse, allergic or other adverse reactions.

[0083] "Pharmaceutically acceptable carrier or excipient" should be compatible with the active ingredient, that is, it can be blended with it without significantly reducing the effect of the drug under normal circumstances. Specific examples of some substances that can be used as pharmaceutically acceptable carriers or excipients are sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium methylcellulose, ethyl cellulose and methyl cellulose; tragacanth powder; malt; gelatin; talc; solid lubricants, such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils, such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and cocoa oil; polyols, such as propylene glycol, glycerol, sorbitol, mannitol and polyethylene glycol; alginic acid; emulsifiers, such as Tween; wetting agents, such as sodium lauryl sulfate; coloring agents; flavoring agents; tabletting agents, stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic saline solutions; and phosphate buffer solutions, etc. These substances are used as needed to help the stability of the formulation or to help improve the activity or its bioavailability or to produce an acceptable taste or odor in the case of oral administration.

[0084] The product in the present invention can also be used in combination with other methods for improving lipid metabolism disorders. The combined use can be simultaneous use or sequential use. Other methods for treating lipid metabolism disorders include but are not limited to other drug treatments or non-drug treatments, such as diet adjustment, weight control, regular exercise, smoking cessation and alcohol restriction, stress management, and sufficient sleep.

[0085] The present invention also provides a preparation method of the above-mentioned antibacterial or lipid metabolism disorder-improving product, and the preparation method includes the following steps:

[0086] 1) Ferment Lactiplantibacillus plantarum BD7807 to obtain a fermentation broth;

[0087] 2) Centrifuge the fermentation broth, take the bacterial sludge for coating, freeze-drying and pulverization to obtain the product.

[0088] The following describes the embodiments of the present invention through specific examples. Those skilled in the art can easily understand the other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0089] Before further describing the specific embodiments of the present invention, it should be understood that the protection scope of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are for describing specific embodiments, rather than for limiting the protection scope of the present invention; in the specification and claims of the present invention, unless otherwise clearly indicated in the text, the singular forms "a", "an", and "the" include the plural forms.

[0090] When the embodiments give a numerical range, it should be understood that unless otherwise specified in the present invention, both endpoints of each numerical range and any value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the art of this technology. In addition to the specific methods, devices, and materials used in the embodiments, according to the knowledge of those skilled in the art of this technology and the description of the present invention, any methods, devices, and materials similar or equivalent to the methods, devices, and materials described in the embodiments of the present invention can also be used to implement the present invention.

[0091] For the technologies not specifically disclosed in the embodiments, the prior art can be adopted.

[0092] Example 1 Isolation, Screening, Identification and Performance Determination of Lactiplantibacillus plantarum BD7807

[0093] 1.1 Isolation and Screening of Strains

[0094] Collect fermented potherb mustard samples, take 0.5 g into 4.5 mL of sterile physiological saline, fully shake and disperse the samples, take 100 μL of the samples for gradient dilution, select a suitable gradient and evenly coat it on MRS agar plates, place it under anaerobic conditions, and culture at 37 °C for 36 - 48 h. Then pick single colonies, perform Gram staining, and observe the colony morphological characteristics under a microscope to preliminarily screen the strains suspected of being Lactobacillus. The strains are repeatedly streaked and purified on MRS solid medium to obtain purified Lactobacillus strains, and the purified strains are stored in a -80 °C glycerol tube.

[0095] MRS medium formula: 10 g of peptone, 5 g of beef extract powder, 5 g of yeast powder, 20 g of glucose, 5 g of anhydrous sodium acetate, 2 g of diammonium hydrogen citrate, 1 mL of Tween 80, 2 g of K2HPO4, 0.2 g of MgSO4, 0.05 g of MnSO4, 1000 mL of distilled water, pH = 6.5, autoclaved at 121 °C for 20 min. 1.5 g of agar powder is added to the solid MRS medium.

[0096] 1.2 Identification of strains

[0097] 1) Template preparation: Using the single colony of BD7807 as a template, extract its genomic DNA as the template for PCR amplification.

[0098] 2) RCR amplification: Use the universal bacterial primers 27F and 1492R as primers, and add a certain amount of 2×Taq PCRmix for 16S rDNA PCR amplification.

[0099] PCR reaction system: 10×buffer 10 uL, 10 mM dNTP 2 μL, 1 μL of each upstream and downstream primer, 2 μL of DNA template, 0.5 μL of Taq enzyme, 34.5 μL of ddH2O.

[0100] Set the PCR reaction conditions as follows: Initial denaturation: 98 °C for 5 min; Cycle amplification: 94 °C for 30 s, 55 °C for 30 s, 72 °C for 90 s, for a total of 30 cycles; Final extension: 72 °C for 5 min.

[0101] 3) Verification of PCR products: Use agarose gel electrophoresis to verify the PCR products.

[0102] 4) Sequence analysis: After verification by agarose gel electrophoresis, send the PCR products to Shanghai Bioengineering Co., Ltd. for sequence analysis; BLAST align the measured 16S rDNA sequences in the National Center for Biotechnology Information (NCBI) database to determine the similarity with known species.

[0103] 1.2 Determination of the lipid-lowering ability of Lactiplantibacillus plantarum BD7807

[0104] (1) Cholesterol-lowering ability test

[0105] 1) Strain culture and preparation: Continuously passage Lactiplantibacillus plantarum BD7807 in the prepared MRS liquid medium for 3 times, and centrifuge at 4 °C and 4000 r / min for 10 min to collect the bacterial cells; Wash the bacterial cells continuously with PBS buffer 3 times, and then suspend the bacterial cells in an appropriate amount of PBS, and adjust the bacterial cell concentration to 1.0×10 9cfu / mL to prepare a bacterial suspension;

[0106] 2) Cholesterol degradation ability test: Add the bacterial suspension prepared in step 1) to the basal MRS medium and add 100 μg / L cholesterol. After mixing, incubate at 37 °C for 24 h;

[0107] 3) Determination of cholesterol content: Take the mixture in step 2) and use a cholesterol kit for determination.

[0108] In the experiment, the control group was set as the one without adding Lactiplantibacillus plantarum; in addition, to ensure the reliability of the results, the whole experiment was carried out 3 times independently.

[0109] The calculation formula is as follows:

[0110] Cholesterol degradation rate (%) = (B - A) / B × 100%

[0111] In the formula: A represents the cholesterol content of the experimental group with Lactiplantibacillus plantarum BD7807 added; B represents the cholesterol content of the control group without Lactiplantibacillus plantarum BD7807 added.

[0112] The results of the cholesterol-lowering ability of Lactiplantibacillus plantarum BD7807 are as Figure 1 shown. With the increase of the incubation time, the cholesterol clearance rate of Lactiplantibacillus plantarum BD7807 showed an obvious upward trend. Especially when the incubation time was 18 h, the cholesterol degradation rate of Lactiplantibacillus plantarum BD7807 reached 78.88%, indicating that Lactiplantibacillus plantarum BD7807 had the strongest cholesterol-lowering ability within 18 h of incubation; although the clearance rate at 24 h was slightly lower than that at 18 h, it still remained at a relatively high level, showing the ability of this strain to maintain cholesterol-lowering activity for a long time.

[0113] (2) Triglyceride-lowering ability test

[0114] 1) Preparation of bacterial suspension: The bacterial suspension of Lactiplantibacillus plantarum BD7807 prepared in step 1) of 1.1(1);

[0115] 2) Determination of triglyceride content: According to the instructions of the triglyceride kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), the triglyceride-lowering ability of Lactiplantibacillus plantarum BD7807 was determined.

[0116] In the experiment, the control group was set as the one without adding Lactiplantibacillus plantarum BD7807; in addition, to ensure the reliability of the results, the whole experiment was carried out 3 times independently.

[0117] The calculation formula is as follows:

[0118] Triglyceride degradation rate (%) = (B - A) / B × 100%

[0119] Where: A represents the triglyceride content with the addition of Lactiplantibacillus plantarum in the experimental group; B represents the triglyceride content without the addition of Lactiplantibacillus plantarum in the control group.

[0120] The ability of Lactiplantibacillus plantarum BD7807 to degrade triglycerides, and the results are as Figure 2 shown. As time extends, the degradation rate gradually increases, rising from approximately 25% at 6 hours to the highest point of 66.21% at 18 hours, and slightly decreasing to approximately 60% at 24 hours. This indicates that the strain has the best degradation effect on triglycerides at 18 hours, showing strong metabolic activity. Although the degradation rate at 24 hours has decreased, the overall performance is still good, indicating that Lactiplantibacillus plantarum BD7807 can effectively reduce the triglyceride level within a certain period of time and has potential probiotic functions.

[0121] 1.3 Determination of the tolerance ability of Lactiplantibacillus plantarum BD7807 to artificial simulated gastrointestinal fluids

[0122] 1) Take 0.5 mL of the bacterial suspension and add 4.5 mL of the pre-prepared simulated gastric juice; place the mixture in an incubator at 37 °C for 2 h; after the incubation, centrifuge the mixture for 8 min (10000 r / min at 4 °C), and discard the supernatant;

[0123] 2) Add 4.5 mL of the prepared intestinal juice to step 1), incubate at 37 °C for 10 h, and perform viable count at 0 h, 2 h, 4 h, 6 h, 8 h, 10 h, and 12 h respectively using the colony plate counting method. The viable count is determined by the plate counting method, and the survival rate is calculated according to the following formula.

[0124] Survival rate (%) = Number of viable bacteria after passing through intestinal juice / Number of viable bacteria before adding gastric juice × 100%

[0125] The determination of the tolerance ability of the strain to artificial simulated gastrointestinal fluids is shown in Table 1.

[0126] Table 1 Tolerance ability to artificial simulated gastrointestinal fluids

[0127] Time / h 0 2 4 6 8 10 12 Survival rate / % 100 84.52 80.69 78.8 74.74 72.62 70.4

[0128] In this experiment, the results of the tolerance ability of Lactiplantibacillus plantarum BD7807 to gastrointestinal fluids are shown in Table 1. It can be seen that the tolerance ability of the strain gradually decreases over time, but it can still maintain a survival rate of 70.4% within 12 hours, showing strong tolerance ability to gastrointestinal fluids. This indicates that Lactiplantibacillus plantarum BD7807 can better resist the digestive effects of gastric acid and intestinal juice when passing through the gastrointestinal tract, and thus may play the role of probiotics in the human body. It shows that Lactiplantibacillus plantarum BD7807 can resist gastrointestinal fluids and proliferate in the intestine.

[0129] 1.4 Determination of the antioxidant capacity of Lactiplantibacillus plantarum BD7807

[0130] (1) ABTS radical scavenging activity

[0131] Take 5 mL of ABTS solution (7.4 mmol / L) and mix it with 88 μL of potassium persulfate (2.6 mmol / L), and let it stand at room temperature for 12 hours; dilute the mixed solution with phosphate buffer (pH = 6.6) to adjust the absorbance value of the mixed solution at 734 nm to 0.70 ± 0.02. The resulting solution is the ABTS radical working solution; then, take 0.2 mL of the ABTS radical working solution and add 10 μL of the Lactiplantibacillus plantarum BD7807 bacterial suspension. After shaking well, let it stand in the dark at room temperature for 6 min, and then measure the absorbance value of the solution at 734 nm.

[0132] In this experiment, a negative control group was set up, which did not contain the ABTS solution; at the same time, a blank control group was set up, which did not contain the Lactiplantibacillus plantarum strain BD7807. All experiments were repeated 3 times.

[0133] The calculation formula for the scavenging rate of ABTS radicals is as follows:

[0134] ABTS scavenging rate (%) = [1 - (A1 - A2) / A0] × 100%

[0135] In the formula, A0 is the absorbance value of the blank control without Lactiplantibacillus plantarum BD7807; A1 is the absorbance value of the solution containing Lactiplantibacillus plantarum BD7807 and the ABTS radical working solution BD7807; A2 is the absorbance value without the ABTS radical working solution.

[0136] (2) DPPH radical scavenging activity

[0137] First, centrifuge the bacterial solution of Lactiplantibacillus plantarum BD7807 cultured at 37 °C for 18 h at 6000 r / min for 10 min to collect the bacterial cells; then, wash and resuspend the collected bacterial cells with a buffer solution with pH = 7.5; then, adjust its concentration to OD 600 = 1, and resuspend it in PBS buffer as intact bacterial cells; obtain the Lactiplantibacillus plantarum BD7807 bacterial suspension.

[0138] Take 1 ml of the suspension of Lactiplantibacillus plantarum BD7807, and add 1 ml of 0.2 mM DPPH anhydrous ethanol solution thereto to obtain a mixed solution; react the obtained mixed solution in the dark at room temperature for 30 min; after the reaction, centrifuge at 8000 r / min for 10 min; after centrifugation, take the supernatant and measure the absorbance of the supernatant at a wavelength of 517 nm.

[0139] The following control groups were set up in this experiment:

[0140] Blank control group: a solution containing only 0.2 mM DPPH anhydrous ethanol solution and no Lactiplantibacillus plantarum BD7807, used to measure the absorbance of DPPH free radicals themselves, denoted as A0;

[0141] Sample blank group: a solution containing only the sample solution and no DPPH free radicals, used to correct the influence of the absorbance of the sample itself on the experimental results, denoted as A2;

[0142] Experimental group: a mixed solution containing the suspension of Lactiplantibacillus plantarum BD7807 and DPPH free radicals, used to measure the scavenging effect of Lactiplantibacillus plantarum BD7807 on DPPH free radicals, denoted as A1;

[0143] All experiments were repeated 3 times.

[0144] The calculation formula is as follows:

[0145] DPPH scavenging rate (%) = [1 - (A1 - A0) / A2] × 100%

[0146] In the formula: A0 is the absorbance value of the blank control group; A1 is the absorbance value of the experimental group; A2 is the absorbance value of the sample blank group.

[0147] (3) Superoxide anion radical scavenging test

[0148] Take 4.5 mL of 50 mmol / L Tris-HCl buffer solution (pH = 8.2) in a test tube, and sequentially add 0.4 mL of 25 mmol / L pyrogallol and 1.0 mL of the suspension of Lactiplantibacillus plantarum BD7807, mix well and react in a water bath at 25 °C for 5 min; after the reaction, add 1.0 mL of 8.0 mmol / L HCl to terminate the reaction. Measure the absorbance at a wavelength of 320 nm. The above were all measured in parallel 3 times and the average value was taken, and the experiment was repeated 3 times.

[0149] The following control groups were set up in this experiment:

[0150] Blank control group: a solution without adding the suspension of Lactiplantibacillus plantarum BD7807, only containing Tris-HCl buffer solution, pyrogallol and HCl, denoted as A0;

[0151] Sample blank group: It only contains the suspension of Lactiplantibacillus plantarum BD7807 and Tris-HCl buffer solution, without pyrogallol, denoted as A2;

[0152] Pyrogallol blank group: It only contains pyrogallol, Tris-HCl buffer solution and HCl, without the suspension of Lactiplantibacillus plantarum BD7807, denoted as A3;

[0153] Experimental group: It is a solution containing the suspension of Lactiplantibacillus plantarum BD7807, Tris-HCl buffer solution, pyrogallol and HCl, denoted as A1.

[0154] The calculation formula for the scavenging rate of superoxide radicals is as follows:

[0155]

[0156] In the formula, A0 is the absorbance value of the blank control group; A1 is the absorbance value of the experimental group; A2 is the absorbance value of the sample blank group; A3 is the absorbance value of the pyrogallol blank group.

[0157] (4) Determination of hydroxyl radical scavenging rate

[0158] Prepare 9 mmol / L ferrous sulfate solution, 9 mmol / L ethanol-salicylic acid solution, and 8.8 mmol / L 30% hydrogen peroxide solution; Take 1 mL of ethanol-salicylic acid solution in a test tube, add 1 mL of ferrous sulfate solution, then add 1 mL of hydrogen peroxide solution and 1 mL of the suspension of Lactiplantibacillus plantarum BD7807, mix well and let it stand at 37 °C for 30 min, and measure the absorbance value of the above reaction system at a wavelength of 510 nm, denoted as A2.

[0159] The following control groups are set in this experiment:

[0160] Blank control group: Take 1 mL of ethanol-salicylic acid solution, add 1 mL of ferrous sulfate solution and 1 mL of hydrogen peroxide solution, mix well and let it stand at 37 °C for 30 minutes, measure the absorbance, denoted as A1;

[0161] Sample blank group: Take 1 mL of sample solution (suspension of Lactiplantibacillus plantarum BD7807), add 1 mL of ultrapure water, mix well and let it stand at 37 °C for 30 minutes, measure the absorbance, denoted as A3.

[0162] The calculation formula for the scavenging rate of hydroxyl radicals is as follows:

[0163]

[0164] A1 is the absorbance value of the blank control group; A2 is the absorbance value of the experimental group; A3 is the absorbance value of the sample blank group.

[0165] According to Figure 3 The determination results showed that Lactiplantibacillus plantarum BD7807 exhibited excellent antioxidant capacity. Specifically, the scavenging rates of this strain against ABTS radical, DPPH radical, superoxide anion (O2-) radical, and hydroxyl (·OH) radical were 81.91%, 80.51%, 58.24%, and 79.27%, respectively. These data indicate that Lactiplantibacillus plantarum BD7807 can effectively scavenge various types of free radicals and has significant antioxidant effects.

[0166] 1.5 Growth curve of the strain

[0167] 1) Cultivation and sampling: Inoculate Lactiplantibacillus plantarum BD7807 into MRS liquid medium for cultivation; sample from the medium every 2 h to measure the OD600 value of the bacterial solution to monitor the growth of the strain;

[0168] 2) Data analysis: Use the cultivation time (h) as the horizontal axis and the OD 600 value as the vertical axis to plot the growth curve graph to visually display the growth dynamics of the strain.

[0169] As can be seen from Figure 4 the results, Lactiplantibacillus plantarum BD7807 showed good growth characteristics in MRS liquid medium. After about 8 h, the strain entered the logarithmic growth phase, and the growth rate in this stage was relatively fast, indicating its strong reproductive ability. Subsequently, at about 16 h, the growth of the strain entered the stationary phase, and the growth rate began to slow down, which usually means that the strain has reached the maximum growth density. The above results indicate that Lactiplantibacillus plantarum BD7807 has a fast growth ability.

[0170] Example 2 Analysis of the adhesion ability of Lactiplantibacillus plantarum BD7807

[0171] 2.1 Determination of surface hydrophobicity

[0172] 1) Centrifuge the bacterial solution of Lactiplantibacillus plantarum BD7807 cultured to the stationary growth phase for 10 min (10000 r / min at 4 °C), and wash the bacterial cells 2 times with PBS solution (pH = 7.2);

[0173] 2) Resuspend the washed bacterial cells in PBS buffer and adjust the concentration of the bacterial suspension to 1×10 8 cfu / mL, and use a spectrophotometer to measure the absorbance of the bacterial suspension at 600 nm, denoted as A0;

[0174] 3) Mix the adjusted bacterial suspension with xylene and chloroform at a ratio of 1:3, incubate at room temperature for 10 min, vortex for 2 min, continue to incubate at room temperature for 30 min until stratification, carefully aspirate the aqueous phase, and measure the absorbance of the bacterial suspension at 600 nm, denoted as A1; calculate the surface hydrophobicity according to the following formula.

[0175] The calculation formula is as follows:

[0176] Surface hydrophobicity (%) = (1 - A1 / A0) × 100%

[0177] 2.2 Determination of self-aggregation ability

[0178] 1) Prepare the bacterial suspension: Prepare the test bacterial suspension of Lactiplantibacillus plantarum BD7807.

[0179] 2) Set up the control group and adjust the concentration: Use PBS buffer as the blank control; adjust the concentration of the bacterial suspension, and then measure the initial concentration of the bacterial suspension at 600 nm to make its absorbance about 0.6 ± 0.05, denoted as A0;

[0180] 3) Culture and measure the absorbance: Incubate the adjusted bacterial suspension at 37 °C for 24 h, measure its absorbance at 600 nm, denoted as A1, and calculate the self-aggregation ability of Lactiplantibacillus plantarum BD7807 according to the following formula.

[0181] The calculation formula is as follows:

[0182] Self-aggregation rate (%) = (1 - A1 / A0) × 100%

[0183] It can be seen from Figure 6 that the surface hydrophobicity and self-aggregation ability of Lactiplantibacillus plantarum BD7807 show significant differences under different organic solvent conditions. Under the condition of chloroform as the organic solvent, the surface hydrophobicity of the strain reaches the highest, which is 63.54%, while under the condition of xylene, the highest surface hydrophobicity is 39.78%. In addition, the self-aggregation ability is relatively high, reaching 69.33%. The above results indicate that Lactiplantibacillus plantarum BD7807 has strong surface hydrophobicity and self-aggregation ability, which is closely related to its good adhesion ability and intestinal colonization potential.

[0184] Example 3 Determination of antibiotic sensitivity and antibacterial ability of Lactiplantibacillus plantarum BD7807 strain

[0185] 3.1 Antibiotic sensitivity test

[0186] The drug resistance of Lactiplantibacillus plantarum BD7807 to 5 antibiotics was detected by the disk diffusion method (K-B disk). The determination of drug resistance results was carried out according to the latest version of the manual of the Clinical and Laboratory Standards Institute (CLSI) of the United States (see Table 2), and the determination of the sensitivity of the strain to antibiotics is shown in Table 3.

[0187] Table 2 Drug content and drug resistance judgment criteria of K-B disk

[0188]

[0189] Table 3 Drug content and drug resistance judgment results of K-B disk

[0190]

[0191] Note: The results are expressed as mean ± standard deviation. For the comparison of the antibiotic sensitivity of different strains in the same column, different letters indicate significant differences (p < 0.05). In the table, A represents ciprofloxacin, B represents chloramphenicol, C represents tetracycline, D represents amoxicillin, and E represents norfloxacin.

[0192] The drug resistance judgment results are shown in Table 3. Lactiplantibacillus plantarum BD7807 is resistant to ciprofloxacin (quinolones), chloramphenicol (chloramphenicols), and tetracycline (tetracyclines). The strain BD7807 has no multi-drug resistance in the common antibiotic detection.

[0193] 3.2 Bacteriostatic test

[0194] 1) Cultivate Lactiplantibacillus plantarum BD7807 to the logarithmic growth phase and prepare a fresh bacterial suspension.

[0195] 2) Centrifuge the fresh bacterial suspension (4 °C, 12000 rpm, 3 min) and collect the supernatant. The supernatant is filtered through a 0.22 μm filter, and the filtrate is collected.

[0196] 3) Use sterile PBS to adjust the concentration of the intestinal pathogenic strain used for bacteriostasis to 1×10 8 CFU / mL, and evenly spread the pathogenic bacterial suspension on the NA plate with a sterile spreading rod, and let it stand at room temperature for 10 - 20 min.

[0197] 4) Use a puncher to punch holes (aperture ±8 mm, depth ±4.5 mm) on the NA plate, and seal the bottom with 1% agar.

[0198] 5) Pipette 100 μL of the filtrate obtained in step 2) into the wells. Place the NA plates at room temperature for 2 h and then transfer them to 37 °C for incubation. Take them out when clear inhibition zones appear (about 18 h). Measure the diameter (mm) of the inhibition zones with a vernier caliper. The size of the inhibition zone diameter reflects the antibacterial activity of Lactiplantibacillus plantarum. The larger the diameter, the stronger the antibacterial activity. The antibacterial activity of Lactiplantibacillus plantarum BD7807 is shown in Table 4.

[0199] Table 4 Antibacterial activity of Lactiplantibacillus plantarum BD7807 against pathogenic bacteria

[0200] Strain name Enterobacter sakazakii (mm) Salmonella (mm) BD7807 12.87±0.47 21.53±1.25

[0201] As shown in Table 4, Lactiplantibacillus plantarum BD7807 has varying degrees of inhibitory effects on two intestinal pathogenic bacteria, Enterobacter sakazakii and Salmonella.

[0202] Example 4 Improvement effect of Lactiplantibacillus plantarum BD7807 on lipid metabolism disorder in high-fat diet mice

[0203] 4.1 Experimental animal grouping and model establishment

[0204] (1) Normal control group (NC): Fed with basal diet + sterile water (by gavage);

[0205] (2) High-fat model group (HFD): Fed with high-fat diet + sterile water (by gavage);

[0206] (3) Bacterial suspension intervention group (HFD+BD7807): Fed with high-fat diet + Lactiplantibacillus plantarum BD7807 bacterial suspension (1×10 10 cfu / mL) (by gavage).

[0207] 4.2 Sample collection

[0208] The mice were gavaged continuously for 8 weeks. After anesthetizing the mice with isoflurane, blood was collected from the eye socket and immediately placed in an empty enzyme-free centrifuge tube. The centrifuge tube containing the blood was left to stand at 4 °C for several hours, and then the centrifuge tube was centrifuged at 4000 r / min for 1 min to separate the upper serum. The separated serum was collected and stored at -80 °C.

[0209] The mice were sacrificed by cervical dislocation, dissected, and the tissues or organs required for the experiment were taken out for subsequent experiments.

[0210] 4.3 Mouse body weight measurement

[0211] After the start of the experiment, according to the experimental plan, the food intake of each group of mice was recorded daily, and the body weight of the mice was recorded once a week to calculate the body weight gain of each group of mice.

[0212] The test results are as follows Figure 7 During the test, the mice showed normal hair color, normal eating, shiny hair, normal defecation, and no abnormal conditions such as bloody stools or loss of appetite. At the same time, the weights of the mice in different groups were similar at the beginning of modeling. However, as the feeding time extended, the weights of the mice in each group showed an obvious increasing trend and increased rapidly. During the modeling period, the weight gain of the mice fed with a high-cholesterol diet was always higher than that of the control group fed with a basal diet. After the modeling ended, the weight gain trend of the mice in each group gradually slowed down. Compared with the mice fed only with a high-fat diet, the weights of the mice fed with a high-fat diet and gavaged with Lactiplantibacillus plantarum were significantly reduced, but their weights were significantly higher than those of the normal control group mice.

[0213] 4.4 Determination of food intake of mice

[0214] After the test started, according to the test plan, the food intake of the mice in each group was recorded every day

[0215] The food intake of the mice recorded weekly is as follows Figure 8 As shown, during the feeding process, it was found that the food intakes of the HFD group and the HFD+BD7807 group were almost the same but significantly different from those of the NC group (P<0.05). However, the body weights of the mice in the HFD+BD7807 group were lower than those in the HFD group, which may be due to the promotion of intestinal peristalsis and increased energy consumption after the intake of Lactiplantibacillus plantarum.

[0216] 4.5 Determination of organ index of mice

[0217] The organs (including the liver, kidney, spleen, pancreas, heart, etc.) were rinsed with physiological saline. Subsequently, the surface moisture of the organs was blotted dry with filter paper; then, the organ coefficient of each organ was calculated, and the organ coefficients of each organ are shown in Table 5.

[0218] The formula for calculating the organ coefficient is as follows

[0219] Organ index (%) = m1÷m×100%

[0220] In the formula, m represents the mass of the mouse before sacrifice / g, and m1 represents the mass of each fat / liver / g.

[0221] Table 5 Organ indices of mice in each group (mean ± standard deviation)

[0222] Index (%) NC HFD HFD + BD7807 Liver index <![CDATA[5.1177±0.5086 b > <![CDATA[6.0710±0.2163 a > <![CDATA[5.3667±0.2303 ab > Kidney index <![CDATA[1.4377±0.0146 c > <![CDATA[1.6680±0.0036 a > <![CDATA[1.5427±0.0222 b > Spleen index <![CDATA[0.2510±0.0020 b > <![CDATA[0.2659±0.00116 a > <![CDATA[0.2507±0.0035 b > Pancreas index <![CDATA[0.6653±0.0135 a > <![CDATA[0.6240±0.0061 a > <![CDATA[0.6567±0.0138 a > Heart index <![CDATA[0.5886±0.0135 a > <![CDATA[0.5544±0.0103 a > <![CDATA[0.5909±0.0307 a >

[0223] Note: Different letters indicate significant differences between groups (P<0.05).

[0224] As shown in Table 5, after 8 weeks of a high-fat diet, on the one hand, the liver index and kidney index of the mice in the HFD group both exceeded those of the mice in the NC group. This phenomenon may be due to the accumulation of cholesterol and other lipids in the liver caused by a high-fat and high-cholesterol diet, which increases the weight of the liver. In addition, the increase in the kidney index may be related to the increased burden on the kidneys caused by the high-fat diet. The above research results fully demonstrate that a high-fat diet successfully established a model of altered liver and kidney function in mice.

[0225] On the other hand, the experimental results showed that after gavage with Lactiplantibacillus plantarum BD7807, the liver index of the mice in the HFD+BD7807 group was close to that of the NC group, indicating that Lactiplantibacillus plantarum BD7807 helps to reduce the accumulation of lipids in the liver. During the dissection, no obvious differences were found in the position and shape of the liver, kidney, thymus, and spleen of the mice in each group, and there were also no significant differences in the organ coefficients of the heart and pancreas between the experimental group and the NC group (P>0.05). These results indicate that under the conditions of this experiment, gavage with Lactiplantibacillus plantarum did not have side effects on the physical health status of the mice.

[0226] 4.6 Histological analysis of mice

[0227] Liver tissue samples were freshly frozen in optimal cutting temperature (OCT) compound and sectioned at a thickness of 4 μm. The sections were fixed with 10% formalin and then stained with 0.3% Oil Red O solution and hematoxylin & eosin (H&E). Epididymal fat sections were paraffin-embedded and stained with H&E.

[0228] The results showed that the adipocytes in the white adipose tissue (WAT) of the Lactiplantibacillus plantarum BD7807 gavage group were significantly smaller, and the lipid droplet accumulation in the liver tissue was significantly reduced ( Figure 9 ).

[0229] 4.7 Detection of biochemical indicators

[0230] Serum total cholesterol (TC) (product number: A111-1-1), triglyceride (TG) (product number: A110-1-1), alanine aminotransferase (ALT) (product number C009-1-1), aspartate aminotransferase (AST) (product number C010-2-1) (Nanjing Jiancheng Bioengineering Co., Ltd., Nanjing, China) were used to measure the serum biochemical indicators of the mice.

[0231] After feeding the HFD for 8 weeks, the fat coefficient, serum and liver lipid levels in the HFD group were significantly higher than those in the ND group ( Figure 10 A-B). Supplementing BD7807 normalized the increase in blood lipid levels and fat index in mice fed the HFD. This indicates that Lactiplantibacillus plantarum BD7807 improved the lipid metabolism disorder caused by the HFD.

[0232] AsFigure 11 As shown, compared with the NC group, the ALT content in the serum of mice in the HFD group showed a significant increase (P<0.05), and the AST level also increased significantly (P<0.01), indicating that a high-fat diet can cause liver damage and fat accumulation in mice, leading to corresponding pathological changes. However, compared with the HFD group, the levels of ALT (P<0.001) and AST (P<0.05) in the serum of mice intervened with Lactiplantibacillus plantarum BD7807 decreased significantly, and the difference was highly statistically significant. This further indicates that Lactiplantibacillus plantarum BD7807 has a positive effect on alleviating liver damage.

[0233] The above embodiments are intended to illustrate the implementation schemes disclosed in the present invention and should not be construed as limiting the present invention. In addition, various modifications listed herein and changes in the methods of the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, all obvious modifications to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. A Lactiplantibacillus plantarum BD7807, with the preservation number of CGMCC NO. 33630.

2. The Lactiplantibacillus plantarum BD7807 according to claim 1, characterized in that, It has any one or more of the following effects: 1) Its cholesterol clearance rate is more than 78%; 2) Its triglyceride clearance rate is more than 60%; 3) Its clearance rate of ABTS is more than 80%; 4) Its clearance rate of DPPH is more than 80%; 5) Its clearance rate of O2- is more than 58%; 6) Its clearance rate of ·OH free radicals is more than 79%.

3. Use of the Lactiplantibacillus plantarum BD7807 according to any one of claims 1 to 2 in the preparation of a product for treating lipid metabolism disorders and / or an antibacterial product.

4. The use according to claim 3, characterized in that, The product for treating lipid metabolism disorders has any one or more of the following effects: 1) Reducing the content of cholesterol; 2) Reducing the content of triglyceride; 3) Reducing the level of transaminase in the blood; 4) Alleviating the oxidative stress state.

5. The use according to claim 4, wherein The transaminase is ALT and / or AST; And / or, the alleviating of the oxidative stress state is achieved by scavenging ABTS free radicals, DPPH free radicals, O2- free radicals and / or ·OH free radicals to alleviate the oxidative stress state.

6. The use according to claim 3, characterized in that, The antibacterial product is a product that inhibits intestinal pathogenic bacteria.

7. The use according to claim 6, characterized in that, The intestinal pathogenic bacteria are Enterobacter sakazakii or Salmonella.

8. An antibacterial or lipid metabolism disorder-improving product, characterized in that, The product contains the Lactiplantibacillus plantarum BD7807 according to claim 1.

9. The antibacterial or lipid metabolism disorder improving product according to claim 8, characterized in that, The viable count of the product is 10 8 ~10 9 cfu / mL.

10. The preparation method of the product according to any one of claims 8 to 9, characterized in that, It includes the following steps: 1) Fermenting the Lactiplantibacillus plantarum BD7807 to obtain a fermentation broth; 2) Centrifuging the fermentation broth, taking the bacterial sludge for coating, freeze-drying and pulverizing to obtain the product.

Citation Information

Cited By

  • Space lactobacillus plantarum microbial agent for losing weight, lowering lipid, improving GLP-1 level and regulating metabolism and application of space lactobacillus plantarum microbial agent

    CN121022637A

  • Lactobacillus plantarum as well as derivative, composition and application thereof

    CN121182723A