3D printed double-layer cell skin model as well as preparation method and application thereof

The construction of a double-layer cell skin model through 3D volume printing technology and modified bioinks has solved the problem of standardization and high-throughput screening of existing 3D skin models, achieved efficient and accurate testing of cosmetic raw materials, reduced animal experiments, and improved the biocompatibility and cell activity of the model.

CN120366191APending Publication Date: 2025-07-25GUANGDONG MARUBI BIOLOGICAL TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510498110.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-18
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

The existing 3D skin models have many challenges in technology, application and industrialization, including the lack of standardized processes, high production costs, shortage of interdisciplinary talents, and complex supervision, difficulty in achieving high-throughput screening and large differences from real skin, limiting their wide application in drug development and cosmetic testing.

Method used

Using 3D volume printing technology combined with modified bioinks, a bilayer cell skin model was constructed, including epidermal cell layer and dermal cell layer, and rapid curing was achieved through multidirectional light projection, and modified gelatin and extracellular matrix proteins were used to enhance biocompatibility and structural stability, and retinol, vitamin E, EGF and bFGF/TGF-β were added to the culture medium to promote cell growth.

Benefits of technology

It has achieved high-throughput screening of cosmetic raw materials, simulated the complex physiological functions of the skin, provided an accurate platform for cosmetic testing, reduced animal experiment dependence, improved cell survival rate and model stability, and can evaluate the dual effects of cosmetics on the skin.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366191A_ABST
    Figure CN120366191A_ABST
Patent Text Reader

Abstract

The invention relates to a 3D printed double-layer cell skin model and a preparation method and application thereof. The double-layer cell skin model comprises an epidermal cell layer and a dermal cell layer which are arranged in a stacked mode. The epidermal cell layer is prepared by a method comprising the following steps: mixing bio-ink with a photoinitiator, then mixing with epidermal cells, and carrying out photocuring 3D volume printing to prepare the epidermal cell layer; the dermal cell layer is prepared by the following method: mixing bio-ink with a photoinitiator, then mixing with dermal cells, and carrying out photocuring 3D volume printing to obtain the dermal cell layer. The photocuring 3D volume printing technology is adopted, the liquid photopolymer is crosslinked at the deep position of the resin barrel through multidirectional light projection, rapid curing of the whole volume is achieved, the printing speed is remarkably increased, and a more accurate platform is provided for testing of cosmetic raw materials.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a 3D printed double-layer cell skin model, a preparation method thereof, and an application thereof. Background Art

[0002] The skin is an organ that wraps the body surface, directly contacts the external environment, and has functions such as protection, excretion, body temperature regulation, and sensing external stimuli. It is the largest organ in the human body. The basic principle of 3D skin model construction technology is to isolate cells from tissues, culture and expand them in vitro, and then mix the expanded cells with biomaterials in a certain proportion so that the cells adhere and grow on the biomaterials to form a 3D skin model.

[0003] If the research focus is on skin barrier function or the surface effects of cosmetics, an epidermal model is a more suitable choice to replace animal experiments and test the toxicity and efficacy of cosmetic ingredients on epidermal cells (such as verifying the effects of moisturizers and anti-aging ingredients). If it is necessary to study the extracellular matrix, mechanical properties, or wound healing in the deep layer of the skin, a dermal model may be more suitable. For research that requires simulating the structure and function of the complete skin, such as chronic disease models or the long-term effects of drugs, a full-thickness skin model is the best choice.

[0004] Currently, 3D skin models face many challenges and limitations in terms of technology, application, and industrialization. There are various construction methods for 3D skin models, lacking a unified standardized process, resulting in differences in the quality and performance of models produced by different laboratories or enterprises. Traditional construction methods are difficult to achieve high-throughput screening, limiting their large-scale application in drug development and cosmetic testing. In addition, although 3D skin models have made certain progress in simulating the in-vivo environment, there are still significant differences compared with real skin, especially in terms of cell-cell interactions, immune responses, and drug metabolism.

[0005] In terms of industrialization, the production cost of 3D skin models is relatively high, especially in terms of biomaterials, cell culture, and equipment, which limits their large-scale promotion. In addition, this field requires interdisciplinary professional knowledge, including biology, materials science, and engineering, and the shortage of relevant professional talents has become a major obstacle to the development of the industry. At the same time, the application of 3D skin models in drug and cosmetic testing needs to meet strict regulatory requirements, and the improvement of relevant regulations and the certification process are relatively complex.

[0006] Nevertheless, the development of 3D skin models still has broad prospects. The development of models containing multiple cell types and complex appendages, combined with biological 3D printing and high-throughput technology, and the use of artificial intelligence and machine learning to achieve dynamic monitoring and data analysis will become an important development direction. With the continuous advancement of technology, these problems are expected to be gradually solved, thereby promoting the widespread application of 3D skin models in more fields.

[0007] In summary, providing a new 3D full-thickness skin model has become one of the urgent issues to be solved in this field. Summary of the invention

[0008] In order to solve the above technical problems, the present invention provides a 3D-printed double-layer cell skin model and its preparation method and application. Combining 3D volume printing technology and modified biological ink, a skin model with a complex structure can be quickly constructed for high-throughput screening of cosmetic raw materials with whitening, anti-wrinkle, moisturizing and other effects.

[0009] To achieve this object, the present invention adopts the following technical solutions:

[0010] In a first aspect, the present invention provides a 3D-printed double-layer cell skin model, wherein the double-layer cell skin model comprises an epidermal cell layer and a dermal cell layer stacked in layers;

[0011] The epidermal cell layer is prepared by a method including: mixing biological ink with a photoinitiator, and then mixing with epidermal cells, and performing photocuring 3D volume printing to prepare the epidermal cell layer;

[0012] The dermal cell layer is prepared by the following method: mixing biological ink with a photoinitiator, then mixing with dermal cells, and performing photocuring 3D volume printing to prepare the dermal cell layer.

[0013] The photocuring 3D volume printing technology (deep barrel photocuring printing) adopted by the present invention abandons the traditional layer-by-layer printing method, and cross-links the liquid photopolymer deep in the resin barrel through multi-directional light projection, thereby realizing the rapid curing of the entire volume. This method not only significantly improves the printing speed (can be completed in a few seconds), but also provides high resolution and smoother surface effects, providing a more accurate platform for the testing of cosmetic raw materials. Different from single-layer structures, including skin models such as epidermis and dermis, the 3D skin model provided by the present invention can simulate the epidermis and dermis structure and reproduce the complex physiological functions of the skin.

[0014] Preferably, the bio-ink contains modified gelatin and extracellular matrix.

[0015] The modified gelatin used in the present invention can enhance cell adhesion and proliferation ability, improving the biocompatibility of the skin model. When using 3D printing technology to construct a 3D skin model with gelatin and skin cells, extracellular matrix proteins are additionally added to the extracellular matrix, including collagen that can form a stable physical support framework and maintain the overall shape of the model, elastin that endows the skin with elasticity and flexibility and intertwines with collagen to construct a network with appropriate mechanical properties, and fibronectin that can connect cells to the extracellular matrix network to stabilize the model structure, provide adhesion sites for cells, guide cell migration, influence cell differentiation, bind growth factors to regulate their activity and release rate, and also affect cell metabolic activities. These play a crucial role in model construction.

[0016] Preferably, the modified gelatin includes methacrylated gelatin and / or nanocellulose composite gelatin.

[0017] The methacrylated gelatin used in the present invention combines the characteristics of natural and synthetic biomaterials. It has a three-dimensional structure suitable for cell growth and differentiation, excellent biocompatibility and cell response characteristics, provides appropriate cell adhesion sites and proteolytic degradability, and can replace artificial basement membranes. In addition, methacrylated gelatin hydrogels have good mechanical properties, and the 3D microscaffolds constructed by them have adjustable mechanical and chemical properties.

[0018] Preferably, the extracellular matrix contains recombinant collagen, recombinant elastin, and recombinant fibronectin.

[0019] Preferably, the extracellular matrix contains 0.1 - 1 mg / mL (such as 0.1 mg / mL, 0.3 mg / mL, 0.5 mg / mL, 0.7 mg / mL, 0.9 mg / mL, or 1 mg / mL, etc.) recombinant collagen, 0.1 - 1 mg / mL (such as 0.1 mg / mL, 0.3 mg / mL, 0.5 mg / mL, 0.7 mg / mL, 0.9 mg / mL, or 1 mg / mL, etc.) recombinant elastin, and 0.1 - 1 mg / mL (such as 0.1 mg / mL, 0.3 mg / mL, 0.5 mg / mL, 0.7 mg / mL, 0.9 mg / mL, or 1 mg / mL, etc.) recombinant fibronectin.

[0020] In the present invention, an extracellular matrix containing composite components such as recombinant collagen, recombinant elastin, and recombinant fibronectin is used to prepare bioink. Compared with single-protein components, multiple components simulate the cell growth environment and improve cell survival rate.

[0021] Preferably, the bioink contains 1% - 4% (such as 1%, 1.5%, 2%, 2.5%, 3%, 3.5% or 4%, etc.) w / v modified gelatin and 0.1% - 0.3% (such as 0.1%, 0.15%, 0.2%, 0.25% or 0.3%, etc.) w / v extracellular matrix, with the balance being PBS buffer.

[0022] Preferably, the photoinitiator includes ruthenium initiator and / or sodium persulfate photoinitiator.

[0023] Preferably, after the bioink is mixed with the photoinitiator, the mixed solution contains 0.2 - 0.3 mM (such as 0.2 mM, 0.22 mM, 0.24 mM, 0.25 mM, 0.26 mM, 0.28 mM or 0.3 mM, etc.) ruthenium initiator and 1 - 4 mM (such as 1 mM, 1.5 mM, 2 mM, 2.5 mM, 3 mM, 3.5 mM or 4 mM, etc.) sodium persulfate photoinitiator.

[0024] Preferably, after being mixed with epidermal cells, the concentration of epidermal cells is 1×10 6 ~3×10 6 cells / mL (such as 1×10 6 cells / mL, 1.5×10 6 cells / mL, 2×10 6 cells / mL, 2.5×10 6 cells / mL or 3×10 6 cells / mL, etc.).

[0025] Preferably, the epidermal cells include human immortalized epidermal cells (HaCaT cells).

[0026] Preferably, after being mixed with dermal cells, the concentration of dermal cells is 1×10 6 ~3×10 6 cells / mL (such as 1×10 6 cells / mL, 1.5×10 6 cells / mL, 2×10 6 cells / mL, 2.5×10 6 cells / mL or 3×10 6 cells / mL, etc.).

[0027] Preferably, the dermal cells include human dermal fibroblasts (HDF cells).

[0028] Preferably, the printing time of the photocuring 3D volume printing is 50 - 70 s (e.g., it can be 50 s, 55 s, 60 s, 65 s, or 70 s, etc.), the printing light intensity is 1 - 2 (e.g., it can be 1, 1.2, 1.4, 1.5, 1.6, 1.8, or 2, etc.), the green light intensity is 50 - 70 (e.g., it can be 50, 55, 60, 65, or 70, etc.), and the model obtained by printing is a disc with a thickness of 1 - 2 cm (e.g., it can be 1 cm, 1.2 cm, 1.4 cm, 1.5 cm, 1.6 cm, 1.8 cm, or 2 cm, etc.) and a diameter of 7 - 9 cm (e.g., it can be 7 cm, 7.5 cm, 8 cm, 8.5 cm, or 9 cm, etc.).

[0029] In a second aspect, the present invention provides a method for preparing a double - layer cell skin model as described in the first aspect, and the preparation method includes the step of laminating an epidermal cell layer and a dermal cell layer.

[0030] Preferably, the preparation method further includes the step of culturing the double - layer cell skin model.

[0031] Preferably, the culturing method includes: culturing the double - layer cell skin model in a double - layer cell culture medium containing retinol, vitamin E, EGF, bFGF, and TGF - β.

[0032] Retinoic acid is a derivative of vitamin A. Retinol regulates gene expression by converting into retinoic acid - binding receptors, thereby promoting cell differentiation and proliferation, participating in inter - cellular signal transduction to improve epidermal cell activity, and having the effect of regulating the expression of keratinocyte differentiation markers (such as keratin K1 / K10). Vitamin E has an antioxidant effect, can protect cell membranes from free - radical damage, maintain cell integrity and stability, and can also regulate the cell signal transduction pathway to promote the proliferation and differentiation of epidermal cells. EGF (epidermal growth factor) can activate the EGFR receptor tyrosine kinase, promote the cell cycle to enter the S phase from the G1 phase through the RAS - MAPK pathway, activate the signal pathway by binding to the epidermal cell surface receptor, and promote cell proliferation, migration, and inhibit cell apoptosis to improve epidermal cell activity. Retinoic acid, vitamin E, and EGF have a synergistic effect in promoting the growth of epidermal cells in the double - layer cell skin model, and none of them can be lacking.

[0033] The bFGF (basic fibroblast growth factor) used in the present invention has the effect of activating the MAPK signal pathway and promoting the proliferation and migration of fibroblasts, and TGF - β (transforming growth factor - β) has the effect of promoting the synthesis of collagen (type I / III), elastin, and fibronectin and inhibiting the activity of matrix metalloproteinases (MMPs). bFGF and TGF - β synergistically promote the growth of dermal cells in the double - layer cell skin model.

[0034] Preferably, the double-layer cell culture medium contains 0.1-10 μM (such as 0.1 μM, 0.5 μM, 1 μM, 2 μM, 5 μM, 7 μM or 10 μM, etc.) retinol, 40-60 μM (such as 40 μM, 45 μM, 50 μM, 55 μM or 60 μM, etc.) vitamin E, 10-30 ng / mL EGF (such as 10 ng / mL, 15 ng / mL, 20 ng / mL, 25 ng / mL or 30 ng / mL, etc.), 5-20 ng / mL (such as 5 ng / mL, 7 ng / mL, 9 ng / mL, 10 ng / mL, 13 ng / mL, 15 ng / mL or 20 ng / mL, etc.) bFGF, and 1-10 ng / mL (such as 1 ng / mL, 3 ng / mL, 5 ng / mL, 7 ng / mL, 9 ng / mL, 10 ng / mL, etc.) TGF-β, and the balance is the cell basal medium.

[0035] Preferably, the cell basal medium comprises DMEM complete medium.

[0036] In a third aspect, the present invention provides an application of the double-layer cell skin model as described in the first aspect in the research and development of skin-contact products.

[0037] Preferably, the skin-contact products include cosmetics or skin care products.

[0038] In a fourth aspect, the present invention provides a method for evaluating the efficacy of raw materials of skin-contact products, and the evaluation method includes: using the double-layer cell skin model as described in the first aspect for evaluation and detection.

[0039] The present invention can utilize this double-layer cell skin model to evaluate the dual effects of anti-aging ingredients (such as tretinoin) on epidermal differentiation (Filaggrin expression) and dermal collagen degradation (MMP-1 inhibition rate).

[0040] Preferably, the skin-contact products include cosmetics or skin care products.

[0041] Preferably, the evaluation and detection include any one or a combination of at least two of skin gene expression analysis, cell viability detection or skin barrier function testing.

[0042] Other specific point values within the above numerical ranges can be selected, and will not be elaborated one by one here.

[0043] Compared with the prior art, the present invention has the following beneficial effects:

[0044] The present invention uses a bioink with a unique formulation, improves 3D printing technology, and prepares a bilayer cell skin model for high-throughput screening of cosmetic raw materials with functions such as whitening, anti-wrinkle, and moisturizing, providing an efficient, precise, and environmentally friendly innovative solution for the development of cosmetic raw materials. The present invention can use this skin model to construct disease-specific skin models (such as a photoaging repair defect model), simulate specific pathological processes, and be used to screen and evaluate cosmetics or drugs with repair functions. It can also use this skin model for safety testing, more efficiently evaluate the cytotoxicity of cosmetic raw materials, and reduce the dependence on animal experiments. The present invention further optimizes the cultivation method of the bilayer cell skin model, uses retinol and vitamin E to synergistically promote the growth of epidermal cells, and uses bFGF and TGF-β to synergistically promote the growth of dermal cells. Description of Drawings

[0045] Figure 1 It is a microscopic observation result diagram of the bilayer cell skin model for Test Example 2.

[0046] Figure 2 It is a gene transcription expression result diagram for Test Example 3. Detailed Embodiments

[0047] To further illustrate the technical means and effects adopted by the present invention, the present invention will be further described below in conjunction with embodiments and drawings. It can be understood that the specific embodiments described herein are only used to explain the present invention, rather than limiting the present invention.

[0048] For those without specific technical or conditions indicated in the embodiments, they shall be in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product specifications. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through regular channels.

[0049] The reagents used in the following examples:

[0050] A photocurable 3D volume printer: purchased from Green Key Biotechnology Co., Ltd., with the product number VBP-T200.

[0051] ECM (extracellular matrix): purchased from Best Pharmaceutical (Guangzhou) Co., Ltd., and its main components include 0.5 mg / mL recombinant collagen, 0.5 mg / mL recombinant elastin, and 0.5 mg / mL recombinant fibronectin.

[0052] GelMA (methacrylated gelatin): purchased from Green Key Biotechnology Co., Ltd., with the product number GK-GM-01.

[0053] Ruthenium initiator and sodium persulfate photoinitiator: purchased from Green Key Biotechnology Co., Ltd., with the product number GK-PI-01.

[0054] DMEM complete medium: Purchased from Gibco.

[0055] Example 1

[0056] This example provides a 3D printed double - layer cell skin model, and its preparation method includes the following steps:

[0057] (1) Prepare the bio - ink. The bio - ink contains 2.5% w / v GelMA and 0.2% w / v ECM, and the balance is PBS buffer. Add ruthenium initiator and sodium persulfate photo - initiator. The final concentration of ruthenium initiator is 0.25 mM, and the final concentration of sodium persulfate photo - initiator is 2.5 mM. After fully mixing, filter and sterilize with a 10 mL syringe and a 0.22 μm filter membrane.

[0058] (2) Prepare HaCaT cell solution and HDF cell solution respectively.

[0059] (3) Pipette 1.5 mL of the filtered bio - ink to resuspend HaCaT cells and HDF cells respectively, and adjust the concentrations of HaCaT cell solution and HDF cell solution to 2×10 6 cells / mL. After fully mixing, transfer them to a sterilized printing bottle, cover the lid, and place the printing bottle on ice for 15 min of condensation.

[0060] (4) Set the printing parameters of the photocuring 3D volume printer. The printing time is 60 s, the printing light intensity is 1.5, and the green light intensity is 60. Take out the printing bottle from the ice, wipe the bottle body with an alcohol cotton sheet and put it on the turntable, and print the epidermal cell layer and the dermal cell layer respectively. Then, heat and melt at 37 °C, and use sterile PBS to wash away the uncrosslinked bio - ink and clean the printed model to obtain a disc - shaped model with a thickness of 1.5 cm and a diameter of 8 cm.

[0061] (5) Stack the epidermal cell layer and the dermal cell layer.

[0062] (6) Place it in a 6 - well plate for culture. The culture medium contains 5 μM retinol, 50 μM vitamin E, 20 ng / mL EGF, 10 ng / mL bFGF, and 5 ng / mL TGF - β, and the balance is DMEM complete medium.

[0063] Example 2

[0064] This example provides a 3D printed double - layer cell skin model, and its preparation method includes the following steps:

[0065] (1) Prepare the bioink, which contains 1% w / v GelMA and 0.3% w / v ECM, and the balance is PBS buffer. Add ruthenium initiator and sodium persulfate photoinitiator. The final concentration of ruthenium initiator is 0.2 mM, and the final concentration of sodium persulfate photoinitiator is 4 mM. After thorough mixing, filter and sterilize using a 10 mL syringe and a 0.22 μm filter membrane.

[0066] (2) Prepare HaCaT cell solution and HDF cell solution respectively.

[0067] (3) Pipette 1.5 mL of the filtered bioink to resuspend HaCaT cells and HDF cells respectively, adjust the concentration of HaCaT cells to 1×10 6 cells / mL, adjust the concentration of HDF cells to 3×10 6 cells / mL. After thorough mixing, transfer to a sterilized printing bottle, cover the lid, and place the printing bottle on ice for 15 min of condensation.

[0068] (4) Set the printing parameters of the photocuring 3D volume printer, with a printing time of 60 s, a printing light intensity of 1.5, and a green light intensity of 60. Take out the printing bottle from the ice, wipe the bottle body with an alcohol cotton sheet and place it on the turntable, and print the epidermal cell layer and the dermal cell layer respectively. Then, heat and melt at 37°C, and use sterile PBS to wash away the uncrosslinked bioink and clean the printing model to obtain a disc model with a thickness of 1.5 cm and a diameter of 8 cm.

[0069] (5) Stack the epidermal cell layer and the dermal cell layer.

[0070] (6) Place it in a 6-well plate for culture. The culture medium contains 1 μM retinol, 60 μM vitamin E, 10 ng / mL EGF, 5 ng / mL bFGF, and 10 ng / mL TGF-β, and the balance is DMEM complete medium.

[0071] Example 3

[0072] This example provides a 3D printed double-layer cell skin model, and its preparation method includes the following steps:

[0073] (1) Prepare the bioink, which contains 4% w / v GelMA and 0.1% w / v ECM, and the balance is PBS buffer. Add ruthenium initiator and sodium persulfate photoinitiator. The final concentration of ruthenium initiator is 0.3 mM, and the final concentration of sodium persulfate photoinitiator is 1 mM. After thorough mixing, filter and sterilize using a 10 mL syringe and a 0.22 μm filter membrane.

[0074] (2) Prepare HaCaT cell solution and HDF cell solution respectively.

[0075] (3) Resuspend HaCaT cells and HDF cells by aspirating 1.5 mL of the filtered bioink respectively, adjust the concentration of HaCaT cells to 3×10 6 cells / mL, adjust the concentration of HDF cells to 1×10 6 cells / mL. After thorough mixing, transfer to a sterilized printing bottle, cover the lid, and place the printing bottle on ice for 15 min of condensation.

[0076] (4) Set the printing parameters of the stereolithography 3D volume printer, with a printing time of 60 s, a printing light intensity of 1.5, and a green light intensity of 60. Take out the printing bottle from the ice, wipe the bottle body with an alcohol cotton sheet and place it on the turntable, and print the epidermal cell layer and the dermal cell layer respectively. Then, melt it at 37°C, and use sterile PBS to wash away the uncrosslinked bioink and clean the printed model to obtain a disc model with a thickness of 1.5 cm and a diameter of 8 cm.

[0077] (5) Stack the epidermal cell layer and the dermal cell layer.

[0078] (6) Place it in a 6-well plate for culture. The culture medium contains 10 μM retinol, 40 μM vitamin E, 30 ng / mL EGF, 20 ng / mL bFGF, and 1 ng / mL TGF-β, and the balance is DMEM complete medium.

[0079] Example 4

[0080] This example provides a 3D printed double-layer cell skin model, which is different from Example 1 only in that GelMA in the bioink is replaced with an equal amount of gelatin.

[0081] Example 5

[0082] This example provides a 3D printed double-layer cell skin model, which is different from Example 1 only in that GelMA in the bioink is replaced with an equal amount of nanocellulose composite gelatin.

[0083] Example 6

[0084] This example provides a 3D printed double-layer cell skin model, which is different from Example 1 only in that ECM in the bioink is replaced with an equal amount of collagen.

[0085] Example 7

[0086] This example provides a 3D printed double-layer cell skin model, which is different from Example 1 only in that retinol is not added to the culture medium, and the proportion of retinol is distributed to vitamin E and EGF proportionally.

[0087] Example 8

[0088] This embodiment provides a 3D-printed double-layer cell skin model, which is only different from Embodiment 1 in that vitamin E is not added to the culture medium, and the proportion of vitamin E is distributed to retinol and EGF proportionally.

[0089] Example 9

[0090] This embodiment provides a 3D-printed double-layer cell skin model, which is only different from Embodiment 1 in that EGF is not added to the culture medium, and the proportion of EGF is distributed to retinol and vitamin E proportionally.

[0091] Example 10

[0092] This embodiment provides a 3D-printed double-layer cell skin model, which is only different from Embodiment 1 in that retinol, vitamin E, and EGF are not added to the culture medium, and the proportions of retinol, vitamin E, and EGF are distributed to bFGF and TGF-β proportionally.

[0093] Example 11

[0094] This embodiment provides a 3D-printed double-layer cell skin model, which is only different from Embodiment 1 in that bFGF in the culture medium is replaced with an equal amount of TGF-β.

[0095] Example 12

[0096] This embodiment provides a 3D-printed double-layer cell skin model, which is only different from Embodiment 1 in that TGF-β in the culture medium is replaced with an equal amount of bFGF.

[0097] Example 13

[0098] This embodiment provides a 3D-printed double-layer cell skin model, which is only different from Embodiment 1 in that bFGF and TGF-β are not added to the culture medium, and the proportions of bFGF and TGF-β are distributed to retinol, vitamin E, and EGF proportionally.

[0099] Example 14

[0100] This embodiment provides a 3D-printed double-layer cell skin model, which is only different from Embodiment 1 in that the culture medium is DMEM complete medium without adding other components.

[0101] Comparative Example 1

[0102] This comparative example provides a 3D-printed double-layer cell skin model, which is only different from Embodiment 1 in that the 3D printing method is layer-by-layer 3D printing, specifically including the following steps:

[0103] Using a Stratasys J35 Pro bio - printer, set the printing speed to 3 - 8 mm / s to ensure smooth extrusion and model accuracy; adjust the extrusion pressure between 10 - 50 kPa according to the viscosity of the bio - ink, with higher viscosity corresponding to greater pressure; set the layer thickness to 80 - 150 μm to form a tightly - fitting and structurally stable layered model; set the row spacing to 0.8 - 1.2 times the layer thickness to ensure good fusion of each layer.

[0104] Import the 3D structure design file of the skin model into the printer software, and the software will parse the model into a layer - by - layer printing path. Start the printing program, and the printer nozzle moves along the preset path, extruding the cell - bio - ink composite layer by layer. During the printing process, monitor the printing status in real - time, observing whether the nozzle is blocked, whether the extrusion of the bio - ink is stable, and whether the model has deformation or displacement.

[0105] After printing is completed, carefully remove the printing platform from the printer. In a laminar flow hood, use sterile forceps and a scalpel to completely separate the support material with the skin model from the platform and transfer it to a cell culture dish.

[0106] Test Example 1

[0107] Cultivate the double - layer cell skin models provided in the examples and comparative examples until the third day, extract the RNA of the cells in the model, and use the qRT - PCR method to detect the transcriptional expression of key genes in the cells in the model. The specific steps are as follows:

[0108] (1) Sample preparation

[0109] 1. Take out the 3D - printed skin model from the culture environment and gently rinse it 2 - 3 times with pre - cooled PBS buffer to remove residual culture medium and other impurities on the surface.

[0110] 2. Transfer the rinsed model to a 1.5 mL RNase - free centrifuge tube containing 1 mL of TRIzol reagent. To ensure the lysis effect, the model can be cut into small pieces as much as possible before putting it into the centrifuge tube. Subsequently, add an appropriate amount of stainless steel beads treated with DEPC water (determined according to the size of the centrifuge tube and the sample volume, generally 2 - 3 beads) to the centrifuge tube.

[0111] 3. Place the centrifuge tube containing the sample, TRIzol reagent, and stainless steel beads into a tissue homogenizer. Set the parameters of the tissue homogenizer, generally with a frequency of 30 - 35 Hz and a running time of 2 - 3 minutes. Through high - speed vibration, the stainless steel beads impact the sample, quickly break the 3D - printed skin model and mix it fully with the TRIzol reagent to achieve cell lysis. If the lysis effect is not good in one time, the number of crushing times can be appropriately increased, but attention should be paid to controlling the total time to avoid overheating of the sample.

[0112] (2) RNA extraction (using the TRIzol method)

[0113] 1. After the disruption is completed, take out the centrifuge tube and let it stand at room temperature for 5 minutes to ensure that the cells are fully lysed and the nucleic acid-protein complexes are completely dissociated.

[0114] 2. Add 200 μL of chloroform to the centrifuge tube, tightly cap the tube, and shake vigorously for 15 seconds. Let it stand at room temperature for 2 - 3 minutes.

[0115] 3. Centrifuge at 12,000 rpm for 15 minutes at 4°C. At this time, the mixture will be separated into three layers: the upper layer is a colorless and transparent aqueous phase (containing RNA), the middle layer is a white protein layer, and the lower layer is a red organic phase.

[0116] 4. Transfer the upper aqueous phase to a new 1.5 mL RNase-free centrifuge tube, being careful not to aspirate the middle and lower layers of liquid. Add an equal volume (about 500 μL) of isopropanol, gently invert and mix well, and let it stand at room temperature for 10 minutes to precipitate the RNA.

[0117] 5. Centrifuge at 12,000 rpm for 10 minutes at 4°C. A white RNA precipitate will appear at the bottom of the centrifuge tube. Discard the supernatant, add 1 mL of 75% ethanol (prepared with DEPC water), and gently invert to wash the RNA precipitate 2 - 3 times.

[0118] 6. Centrifuge at 7,500 rpm for 5 minutes at 4°C, discard the supernatant, invert the centrifuge tube onto a clean filter paper, and let it air dry at room temperature for 5 - 10 minutes. Be careful not to let the RNA precipitate become too dry, as this may affect subsequent dissolution.

[0119] 7. Add an appropriate amount of DEPC water to the centrifuge tube (usually 20 - 50 μL, determined according to the amount of precipitate and subsequent experimental requirements), gently pipette to dissolve the RNA precipitate, and heat in a water bath at 55 - 60°C for 10 minutes to promote RNA dissolution.

[0120] 8. Use a spectrophotometer or a Nanodrop nucleic acid quantifier to measure the concentration and purity of the RNA. The A260 / A280 ratio should be between 1.8 - 2.0. If the ratio deviates from this range, the RNA needs to be further purified. At the same time, take a small amount of the RNA sample for agarose gel electrophoresis to detect the integrity of the RNA, and observe whether there are obvious 28S and 18S rRNA bands, and the brightness of the 28S band is approximately twice that of the 18S band.

[0121] (3) Reverse Transcription

[0122] According to the reverse transcription kit instructions, prepare the reverse transcription reaction system in a 0.2 mL RNase-free centrifuge tube as shown in Table 1 (taking a 20 μL system as an example). Gently mix the reaction system and briefly centrifuge to collect the liquid at the bottom of the tube. Place the centrifuge tube in a PCR instrument and perform the reverse transcription reaction according to the procedure recommended by the reverse transcription kit. The reaction procedure is shown in Table 2. After the reaction is completed, store the cDNA product on ice or at -20 °C for later use.

[0123] Table 1

[0124] Reagent Name Dosage 5× Reverse Transcription Buffer 4 μL dNTPs 2 μL Reverse Transcriptase 1 μL RNase Inhibitor 1 μL RNA Template X μL (Adjust the volume according to the RNA concentration, generally 1 - 2 μg RNA) DEPC Water Make up to 20 μL

[0125] Table 2

[0126] Procedure Temperature Time Primer Annealing 25℃ 5 minutes Reverse Transcription Reaction 37℃ 60 minutes Inactivate Reverse Transcriptase 85℃ 5 minutes

[0127] (4) Real-time fluorescence quantitative PCR (qPCR)

[0128] According to the SYBR Green PCR Master Mix instructions, prepare the qPCR reaction system in a 96-well PCR plate or an eight-strip tube. The reaction system is shown in Table 3 (taking a 20 μL system as an example).

[0129] Table 3

[0130] Reagent Name Dosage SYBR Green PCR Master Mix 10 μL Forward Primer (10 μM) 0.5 μL Reverse Primer (10 μM) 0.5 μL cDNA Template X μL (Adjust the dilution factor according to the pre - experiment results, generally 1 - 5 μL) ROX Reference Dye 0.4 μL (if required by the qPCR instrument) <![CDATA[ddH2O]]> Make up to 20 μL

[0131] Set up the reaction wells, including standard curve wells (usually set 5 - 6 standard products with different concentration gradients), sample wells (set at least 3 replicates for each sample), and negative control wells (using ddH2O instead of cDNA template).

[0132] Add the prepared reaction system to the corresponding reaction wells, seal the PCR plate or eight-strip tube with a sealing film, and gently centrifuge to collect the liquid at the bottom of the tube to avoid generating bubbles.

[0133] Place the PCR plate or eight-strip tube in a real-time fluorescence quantitative PCR instrument and perform amplification according to the procedure in Table 4 for a total of 40 cycles.

[0134] Table 4

[0135] Procedure Temperature Time Pre - denaturation 95℃ 30 seconds Denaturation 95℃ 5 seconds Annealing Extension and Collect Fluorescence Signal 60℃ 30 seconds

[0136] After the reaction was completed, the qPCR results were analyzed. The relative expression levels of target genes in the samples were calculated through the standard curve, and the data was processed using the 2^(-ΔΔCt) method. The transcriptional expression of TP63, ABCA12, KLF4, LAMB3, BMP4, and WNT5A was detected, and housekeeping genes such as GAPDH were used as internal reference genes to correct the differences in the loading amounts between different samples. TP63 is used to regulate tight junction proteins (such as Claudin-1), ABCA12 is used to affect the epidermal barrier function and maintain the epithelial layer structure, KLF4 is used to promote the maturation and differentiation of epidermal cells, LAMB3 is used to maintain the adhesion of dermal cells, BMP4 is used to regulate the activity of dermal fibroblasts and collagen synthesis, and WNT5A is used to participate in the development and homeostasis maintenance of the dermis. The primer sequences are shown in Table 5, and the relative transcriptional expression levels of the above genes are shown in Table 6.

[0137] Table 5

[0138]

[0139]

[0140] Table 6

[0141] Group TP63 ABCA12 KLF4 LAMB3 BMP4 WNT5A Example 1 1.00 1.00 1.00 1.00 1.00 1.00 Example 2 0.93 0.97 1.01 0.92 0.91 1.02 Example 3 0.98 0.94 0.97 0.89 0.98 1.03 Example 4 0.82 0.74 0.85 0.71 0.68 0.63 Example 5 0.85 0.76 0.84 0.78 0.82 0.74 Example 6 0.96 0.99 0.93 0.79 0.94 0.91 Example 7 0.95 0.93 0.91 0.87 0.98 0.89 Example 8 0.92 0.95 0.84 0.93 0.97 0.76 Example 9 0.98 0.92 0.87 1.03 0.89 0.92 Example 10 0.84 0.79 0.76 0.76 0.81 0.82 Example 11 0.93 1.01 0.79 0.94 0.97 0.86 Example 12 0.87 0.91 0.96 0.92 0.93 0.97 Example 13 0.68 0.74 0.86 0.81 0.89 0.78 Example 14 0.65 0.70 0.87 0.75 0.82 0.74 Control Example 1 0.73 0.56 0.61 0.65 0.67 0.56

[0142] It can be seen from Table 6 that:

[0143] (1) By comparing Example 1 with Comparative Example 1, it can be seen that the cell survival rate of the photocurable 3D volumetric printing technology used in the present invention is high, and the effect is significantly better than that of the ordinary 3D layer-by-layer printing method.

[0144] (2) By comparing Example 1 with Examples 4-5, it can be seen that the modified gelatin GelMA has a three-dimensional structure more suitable for cell growth and differentiation, and the effect is better than that of unmodified gelatin and other types of modified gelatin.

[0145] (3) By comparing Example 1 with Example 6, it can be seen that the ECM contains multiple components, providing a good growth environment for the bilayer cells, and the effect is better than adding a single component.

[0146] (4) By comparing Example 1 with Examples 7-10 and 14, it can be seen that by adding retinol, vitamin E, and EGF to the culture medium when culturing the bilayer cell model, the transcriptional expression levels of the TP63, ABCA12, and KLF4 genes in the cells are all increased, and retinol, vitamin E, and EGF have a synergistic effect.

[0147] (5) By comparing Example 1 with Examples 11 - 14, it can be seen that by adding bFGF and TGF-β to the culture medium when culturing the double-layer cell model, the transcriptional expression levels of the LAMB3, BMP4, and WNT5A genes in the cells are all increased, and bFGF and TGF-β have a synergistic effect.

[0148] Test Example 2

[0149] In this test example, the cell morphology of the double-layer cell skin models prepared in Example 1 and Example 14 was observed under a microscope on the third day of culture, as Figure 1 shown. Most of the cells in Example 1 were normally unfolded, while only a few cells in Example 14 were unfolded, indicating that under the culture conditions of Example 1, the cell state of the skin model was better and the skin model was more stable.

[0150] Test Example 3

[0151] The present invention can use this double-layer cell skin model to evaluate the dual effects of the anti-aging ingredient - retinoic acid on epidermal differentiation (Filaggrin expression level) and dermal collagen degradation (MMP-1 expression level). Retinoic acid has obvious effects in improving skin texture and reducing wrinkles, can effectively promote the production of collagen, and enhance the elasticity of the skin. The double-layer cell skin model provided in Example 1 was treated with 0.05% concentration of retinoic acid for 24 hours, and then RNA was extracted to detect the transcriptional expression levels of Filaggrin and MMP-1. The specific steps refer to Test Example 1. The primer sequences are shown in Table 7, and the relative transcriptional expression levels of Filaggrin and MMP-1 are as Figure 2 shown.

[0152] Table 7

[0153] SEQ ID NO. Primer Name Primer Sequence 15 Filaggrin - F ATGCGTACGTCGATCGATCG 16 Filaggrin - R CGATCGTAGCTAGCTAGCTA 17 MMP - 1 - F GCTACGCTACGCTACGCTAC 18 MMP - 1 - R CTACGCTACGCTACGCTACG

[0154] It was found that retinoic acid significantly promoted the transcriptional expression of Filaggrin in the skin model, and its mRNA level was significantly increased compared with the control group, and the difference was statistically significant (P < 0.05). At the same time, retinoic acid showed an obvious inhibitory effect on MMP-1 transcription, and the difference was also statistically significant (P < 0.05). This indicates that at this concentration, retinoic acid can effectively improve the skin barrier function and exert the anti-skin aging effect by up-regulating Filaggrin transcription and down-regulating MMP-1 transcription.

[0155] In summary, the present invention uses a bioink with a unique formula, improves the 3D printing technology, and prepares a double-layer cell skin model, providing an efficient, accurate and environmentally friendly innovative solution for the development of cosmetic raw materials.

[0156] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by any person skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. A 3D printed double-layer cell skin model, characterized in that, The double-layer cell skin model includes an epidermis cell layer and a dermis cell layer which are stacked; The epidermis cell layer is prepared by the following method: mixing a bioink with a photoinitiator, then mixing with epidermis cells, and performing photocuring 3D volumetric printing to obtain the epidermis cell layer; The dermis cell layer is prepared by the following method: mixing a bioink with a photoinitiator, then mixing with dermis cells, and performing photocuring 3D volumetric printing to obtain the dermis cell layer.

2. The double-layer cell skin model according to claim 1, characterized in that, The bioink contains modified gelatin and extracellular matrix; Preferably, the modified gelatin includes methacrylated gelatin and / or nanocellulose composite gelatin; Preferably, the extracellular matrix contains recombinant collagen, recombinant elastin, and recombinant fibronectin; Preferably, the extracellular matrix contains 0.1 - 1 mg / mL recombinant collagen, 0.1 - 1 mg / mL recombinant elastin, and 0.1 - 1 mg / mL recombinant fibronectin.

3. The double-layer cell skin model according to claim 1 or 2, characterized in that, The bioink contains 1% - 4% w / v modified gelatin and 0.1% - 0.3% w / v extracellular matrix, and the balance is PBS buffer.

4. The double-layer cell skin model according to any one of claims 1 to 3, characterized in that, The photoinitiator includes ruthenium initiator and / or sodium persulfate photoinitiator; Preferably, after the bioink and the photoinitiator are mixed, the mixed solution contains 0.2 - 0.3 mM ruthenium initiator and 1 - 4 mM sodium persulfate photoinitiator.

5. The double-layer cell skin model according to any one of claims 1 to 4, characterized in that, After mixing with epidermal cells, the concentration of epidermal cells is 1×10 6 ~3×10 6 cells / mL; Preferably, the epidermis cells include human immortalized epidermal cells; Preferably, after being mixed with dermal cells, the concentration of dermal cells is 1×10 6 ~3×10 6 cells / mL; Preferably, the dermis cells include human dermal fibroblasts.

6. A method for preparing a bilayer cell skin model according to any one of claims 1 to 5, characterized in that, The preparation method includes the step of stacking the epidermis cell layer and the dermis cell layer.

7. The preparation method according to claim 6, characterized in that, The preparation method further includes the step of culturing the double-layer cell skin model.

8. The preparation method according to claim 7, characterized in that, The culturing method includes: culturing the double-layer cell skin model in a double-layer cell culture medium containing retinol, vitamin E, EGF, bFGF, and TGF-β; Preferably, the double-layer cell culture medium contains 0.1 - 10 μM retinol, 40 - 60 μM vitamin E, 10 - 30 ng / mL EGF, 5 - 20 ng / mL bFGF, and 1 - 10 ng / mL TGF-β, and the balance is cell basal medium; Preferably, the cell basal medium includes DMEM complete medium.

9. The application of the double-layer cell skin model according to any one of claims 1 - 5 in the research and development of skin-contact products; Preferably, the skin-contact products include cosmetics or skin care products.

10. An evaluation method for the efficacy of raw materials of skin-contact products, characterized in that, The evaluation method includes: using the double-layer cell skin model according to any one of claims 1 - 5 for evaluation and detection; Preferably, the evaluation and detection include any one or a combination of at least two of skin gene expression analysis, cell viability detection, or skin barrier function testing.