Application of wheat nitrogen response gene TaNIA1 in cultivation of high-yield wheat

Abstract

The invention discloses application of a wheat nitrogen response gene TaNIA1 in cultivation of high-yield wheat. The invention belongs to the technical field of biology, and particularly relates to application of a wheat nitrogen response gene TaNIA1 in cultivation of high-yield wheat. The protein TaNIA1 disclosed by the invention can be applied to the following aspects: 1) application to regulation and control of plant yield; 2) application in preparation of products for regulating and controlling plant yield; the invention relates to application of TaNIA1 in cultivation of plants with changed yield, application of TaNIA1 in preparation of products for cultivation of plants with changed yield, and application of TaNIA1 in plant breeding. TaNIA1 influences nitrogen absorption and utilization of wheat, so that agronomic traits such as wheat tiller number, grain number per ear, ear length, hundred-grain weight and the like are remarkably increased, and the yield of wheat is finally influenced.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and particularly relates to the application of the wheat nitrogen-responsive gene TaNIA1 in cultivating high-yield wheat. Background Art

[0002] As one of the world's three major food crops, wheat is widely distributed around the world, with a total output exceeding 750 million tons, accounting for more than 20% of the global food production. Improving wheat yield is of great strategic significance for ensuring food security. Nitrogen is the main nutrient element affecting wheat production. Applying nitrogen fertilizer can improve wheat yield and increase the protein content in grains. While high nitrogen application rates increase yield, they also bring a series of ecological, production, and social problems. To address these problems, we need to explore the nitrogen-efficient gene resources existing in wheat, improve the nitrogen use efficiency of wheat, and achieve the sustainable and healthy development of the wheat industry.

[0003] Nitrate reductase is the first enzyme in wheat to assimilate nitrate and finally produce glutamate, and it is also the rate-limiting enzyme in the entire assimilation process, playing a crucial role in the nitrogen utilization of wheat. By regulating the expression of nitrate reductase, the nitrogen utilization of wheat can be improved, thereby affecting the yield. Currently, the gene resources available in production that can improve wheat yield and nitrogen use efficiency are very limited. Therefore, exploring and utilizing the genes on the nitrogen utilization pathway provides a new method for cultivating new crop varieties with high quality, high yield, and efficient nutrient utilization. Summary of the Invention

[0004] The technical problem to be solved by the present invention is how to regulate plant yield, especially wheat.

[0005] To solve the above problems, the present invention provides the related applications of proteins, substances that regulate the expression of the coding genes of the proteins, or substances that regulate the activity or content of the proteins.

[0006] The applications of the proteins, substances that regulate the expression of the coding genes of the proteins, or substances that regulate the activity or content of the proteins provided by the present invention in any of the following: 1) Application in regulating plant yield; 2) Application in preparing products for regulating plant yield; 3) Application in cultivating plants with altered yield; 4) Application in preparing products for cultivating plants with altered yield; 5) Application in plant breeding.

[0007] The protein is any of the following proteins: a1) A protein with an amino acid sequence of SEQ ID No: 2; a2) A protein having the amino acid sequence shown in SEQ ID No:2, with one or several amino acid residue substitutions and / or deletions and / or additions and having the same function; a3) A protein having more than 80% identity with the amino acid sequence defined in any one of a1)-a2) and having the same function; a4) A fusion protein obtained by linking a tag to the end of the protein defined in any one of a1)-(a3).

[0008] Among the above-mentioned proteins, the protein tag refers to a polypeptide or protein that is fused and expressed together with the target protein by using in vitro DNA recombination technology for the purpose of facilitating the expression, detection, tracing, and / or purification of the target protein. The protein tag can be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0009] Among the above-mentioned proteins, identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using homology search sites on the Internet, such as the BLAST web page on the NCBI home page website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively and performing a search to calculate the identity of a pair of amino acid sequences, and then the identity value (%) can be obtained.

[0010] Among the above-mentioned proteins, the above-mentioned more than 80% identity can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.

[0011] Among the above-mentioned proteins, SEQ ID No:2 consists of 308 amino acid residues. It is named NIA1 protein, and its encoding gene is NIA1 gene.

[0012] In the above application, the protein is derived from wheat ( Triticum aestivum L).

[0013] In this article, the substance that regulates the activity and / or content of the protein can be a substance that regulates gene expression, and the gene encodes the protein NIA1.

[0014] In the above text, the substance for regulating gene expression may be a substance that performs at least one of the following six regulations: 1) regulation at the gene transcription level; 2) regulation after gene transcription (i.e., regulation of the splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of the transport of the gene's mRNA from the nucleus to the cytoplasm); 4) regulation of the translation of the gene; 5) regulation of the degradation of the gene's mRNA; 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0015] In the present invention, the regulation may be up-regulation or enhancement or increase; the regulation may also be down-regulation or attenuation or decrease.

[0016] In this text, enhancing, increasing or up-regulating the expression level of the coding gene of the protein described above in the receptor plant, and / or enhancing, increasing or up-regulating the activity and / or content of the coding gene of the above protein is achieved by introducing the coding gene of the above protein into the receptor plant.

[0017] In this text, regulating the expression of the coding gene of the protein may be inhibiting or reducing or down-regulating the expression of the coding gene. Inhibiting or reducing or down-regulating the expression of the coding gene can be achieved by gene knockout or gene silencing.

[0018] In the above application, the substance for regulating the expression of the coding gene of the protein or the substance for regulating the activity or content of the protein may be a biological material related to the protein described above, and the biological material may be any one of the following: c1) A nucleic acid molecule encoding the protein described above; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) A recombinant microorganism containing the nucleic acid molecule described in c1), or a recombinant microorganism containing the expression cassette described in c2), or a recombinant microorganism containing the recombinant vector described in c3); c5) A transgenic plant cell line containing the nucleic acid molecule described in c1), or a transgenic plant cell line containing the expression cassette described in c2); c6) A transgenic plant tissue containing the nucleic acid molecule described in c1), or a transgenic plant tissue containing the expression cassette described in c2); c7) A transgenic plant organ containing the nucleic acid molecule described in c1), or a transgenic plant organ containing the expression cassette described in c2); e1) A nucleic acid molecule that inhibits or reduces or silences the expression of the protein coding gene described above; e2) An expression cassette containing the nucleic acid molecule described in e1); e3) A recombinant vector containing the nucleic acid molecule described in e1), or a recombinant vector containing the expression cassette described in e2); e4) A recombinant microorganism containing the nucleic acid molecule described in e1), or a recombinant microorganism containing the expression cassette described in e2), or a recombinant microorganism containing the recombinant vector described in e3); e5) A transgenic plant cell line containing the nucleic acid molecule described in e1), or a transgenic plant cell line containing the expression cassette described in e2); e6) A transgenic plant tissue containing the nucleic acid molecule described in e1), or a transgenic plant tissue containing the expression cassette described in e2); e7) A transgenic plant organ containing the nucleic acid molecule described in e1), or a transgenic plant organ containing the expression cassette described in e2).

[0019] In the above applications, the nucleic acid molecule described in c1) may be any of the following DNA molecules: d1) A DNA molecule with a nucleotide sequence shown in SEQ ID No: 3; d2) A DNA molecule with a coding sequence shown in SEQ ID No: 1; d3) A DNA molecule having 90% or more identity with the nucleotide sequence defined in d1) or d2) and encoding the protein described above; d4) A DNA molecule that hybridizes with the nucleotide sequence defined in d1) or d2) under stringent conditions and encodes the protein described above.

[0020] In the above applications, the nucleic acid molecule described in c1) may be a DNA molecule with a nucleotide sequence shown in SEQ ID No: 2.

[0021] The nucleic acid molecules described herein may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecules may also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA or antisense RNA.

[0022] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, phages (such as λ phage or M13 filamentous phage, etc.), cosmids (i.e., cosmid plasmids), Ti plasmids or viral vectors. Specifically, it may be the vector pWMB110.

[0023] Existing plant expression vectors can be used to construct those containing NIA1Recombinant expression vector of a gene. The plant expression vector includes, but is not limited to, binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment, etc. The plant expression vector may further contain the 3'-untranslated region of the foreign gene, that is, it contains a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can direct the addition of polyadenylic acid to the 3' end of the mRNA precursor. For example, it includes, but is not limited to, the genes of the Agrobacterium tumefaciens Ti plasmid (such as the nopaline synthase Nos gene), and the 3'-untranslated regions transcribed from plant genes (such as soybean storage protein genes) all have similar functions.

[0024] When using NIA1 a gene to construct a recombinant plant expression vector, any enhancer promoter or constitutive promoter can be added before the transcription start nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin promoter of maize (ubiquitin), etc. They can be used alone or in combination with other plant promoters. In addition, when using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be the ATG start codon or the adjacent region start codon, etc., but must be in the same reading frame as the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation initiation region can come from the transcription initiation region or the structural gene.

[0025] In order to facilitate the identification and screening of transgenic plant cells or plants, the used plant expression vector can be processed, such as adding genes (such as GUS gene, luciferase gene, etc.) encoding enzymes or luminescent compounds that can produce color changes and can be expressed in plants, antibiotic markers with resistance (such as gentamicin marker, kanamycin marker, etc.) or anti-chemical reagent marker genes (such as herbicide-resistant genes). Considering the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened under stress.

[0026] In this article, the recombinant microorganism can be Agrobacterium EHA105.

[0027] The present invention also provides a method for changing plant yield. The method includes the following steps M or P: The step M is to enhance, increase or up-regulate the activity and / or content of the aforementioned protein in the target plant, and / or enhance, increase or up-regulate the expression level of the coding gene of the aforementioned protein to increase plant yield; The step P is to inhibit, reduce or silence the activity and / or content of the aforementioned protein in the target plant, and / or inhibit, reduce or silence the expression level of the coding gene of the aforementioned protein to reduce plant yield.

[0028] The present invention also provides a method for cultivating plants with increased yield, including upregulating, enhancing or increasing the expression level of the coding gene of the protein described above in the target plant, and / or obtaining plants with increased yield in which the activity and / or content of the protein are increased, and the yield of the plants with increased yield is higher than that of the target plant.

[0029] In a specific embodiment, the upregulation, enhancement or increase of the expression of the coding gene of the protein described above in the plant includes introducing the nucleic acid molecule, expression cassette or recombinant vector described above into the target plant to obtain plants with increased yield.

[0030] Herein, the purpose of breeding includes cultivating plants with increased yield; the purpose of breeding also includes cultivating plants with low yield.

[0031] Herein, the yield-related traits include the tiller number, the number of grains per spike, the spike length, the 100-grain weight and the yield per plant of wheat.

[0032] Compared with the target plant, the plants with increased yield have significantly increased tiller number, the number of grains per spike, the spike length, the 100-grain weight and the yield per plant.

[0033] Herein, the wheat may be wheat Fielder.

[0034] The protein described above and / or the biological material described above also belong to the scope protected by the present invention.

[0035] In the above application or method, the plant may be any one of the following: N1) Monocotyledonous plants: N2) Plants of the order Poales; N3) Plants of the family Poaceae; N4) Plants of the genus Triticum; N5) Wheat.

[0036] NIA1 As a nitrate reductase gene, the gene significantly increases agronomic traits such as the tiller number, the number of grains per spike, the spike length and the 100-grain weight of wheat by affecting the absorption and utilization of nitrogen by wheat, and ultimately affects the yield of wheat. At present, there are relatively few nitrogen-efficient genes available in production. As a nitrate reductase, this gene is of great significance for the research on the correlation between nitrogen utilization and yield of wheat. Description of the Drawings

[0037] Figure 1 is the phenotype of wild-type wheat Fielder and NIA1 wheat with overexpression of the gene. Among them, A is the plant type of wheat, B is the spike type of wheat, and C is the grain yield per plant of wheat.

[0038] Figure 2 For the plant type, spike type and yield of wild-type wheat Fielder and NIA1 wheat with overexpression of the gene. Among them, A is the tiller number, B is the number of grains per spike, C is the spike length, D is the 100-grain weight, and E is the yield per plant.

[0039] Figure 3 For the plant type, spike type and yield of wild-type wheat Fielder and NIA1 expression detection of wheat with overexpression of the gene.

[0040] Figure 4 For the nitrate reductase activity of wild-type wheat Fielder and NIA1 wheat with overexpression of the gene. Among them, the left figure is the detection of nitrate reductase activity during the vegetative growth period; the right figure is the detection of nitrate reductase activity during the reproductive growth period. Specific embodiments

[0041] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0042] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0043] The formula of the WLS-AS medium in the following embodiments is as follows: 1 / 100 volume of 10× LS major salts, 1 / 1000 volume of 100× FeEDTA, 1 / 1000 volume of 100× LS trace salts, 1 / 1000 volume of 100× MS vitamins, 8 g / L agarose, 10 mg / L glucose, 0.5 g / L MES, 0.85 mg / L AgNO3, 100 μM AS, 1.25 mg / L CuSO4·5H2O, and the rest is water.

[0044] The formula of the WLS-Res medium in the following examples is as follows: 1 / 10 volume of 10× LS major salts, 1 / 100 volume of 100× FeEDTA, 1 / 10 volume of 100× LS minor salts, 0.5 mg / L 2,4-D, 1 / 100 volume of 100× MS vitamins, 2.2 mg / L picloram, 0.75 g / L MgCl2·6H2O, 0.5 g / L glutamine, 0.1 g / L casein hydrolysate, 40 g / L maltose, 1.95 g / L MES, 5 g / L agarose, 250 mg / L carbenicillin, 100 mg / L ascorbic acid, 0.85 mg / L AgNO3, 100 mg / L cefotaxime, and the rest is water.

[0045] The formula of the WLS-P5 medium in the following examples is as follows: 1 / 10 volume of 10× LS major salts, 1 / 100 volume of 100× FeEDTA, 0.5 mg / L 2,4-D, 1 / 10 volume of 100× LS minor salts, 1 / 100 volume of 100× MS vitamins, 2.2 mg / L picloram, 0.1 g / L casein hydrolysate, 0.5 g / L glutamine, 0.75 g / L MgCl2·6H2O, 5 g / L agarose, 40 g / L maltose, 1.95 g / L MES, 100 mg / L ascorbic acid, 250 mg / L carbenicillin, 5 mg / L glufosinate, 0.85 mg / L AgNO3, and the rest is water.

[0046] The formula of the LSZ-P5 medium in the following examples is as follows: 1 / 10 volume of 10× LS major salts, 1 / 100 volume of 100× FeEDTA, 1 / 100 volume of 100× LS minor salts, 20 g / L sucrose, 1 / 100 volume of 100× modified LS vitamins, 5 mg / L zeatin, 0.5 g / L MES, 2.5 mg / L CuSO4·5H2O, 250 mg / L carbenicillin, 8 g / L agar, 100 mg / L cefotaxime, 5 mg / L glufosinate, and the rest is water.

[0047] The formula of the LSF-P5 medium in the following examples is as follows: 1 / 10 volume of 10× LS major salts, 1 / 100 volume of 100× FeEDTA, 1 / 100 volume of 100× LS minor salts, 0.5 g / L MES, 1 / 100 volume of 100× modified LS vitamins, 15 g / L sucrose, 3 g / L Gelrite, 0.2 mg / L IBA, 250 mg / L carbenicillin, 5 mg / L glufosinate, and the rest is water.

[0048] Unless otherwise specified, the antibiotics used in the following examples are at their common working concentrations: kanamycin at 50 μg / mL; rifampicin at 40 μg / mL; spectinomycin at 100 μg / mL.

[0049] Unless otherwise specified, the quantitative tests in the following examples were all set up with three replicate experiments, and the results were averaged.

[0050] The Fielder wheat material in the following examples was kindly provided by Professor Fudao Lin of Shandong Agricultural University and has been described in: Ni, F., Zheng, Y., Liu, X., et al. (2023). Sequencing trait-associated mutations to clone wheat rust-resistance gene YrNAM. Nature Communications, 14(1), 4353. The public can obtain this biological material from the applicant. This biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0051] Agrobacterium tumefaciens EHA105 ( Agrobacterium tumefaciens EHA105) has been described in: Hood, Elizabeth E; Gelvin, Stanton B; Melchers, Leo S; Hoekema, Andre. 1993. New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Research , 2(4): p. 208-218. The public can obtain it from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences or the College of Life Sciences, Shandong Agricultural University. This biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0052] The pWMB110 vector in the following examples was kindly provided by a professor from China Agricultural University and has been described in: Cheng, X., **n, M., Xu, R., Chen, Z., Cai, W., Chai, L., Xu, H., Jia, L., Feng, Z., Wang, Z. and Peng, H. (2020). A single amino acid substitution in STKc_GSK3 kinase conferring semispherical grains and its implications for the origin of Triticum sphaerococcum. The Plant Cell, 32(4), 923-934. The relevant biomaterials can be obtained from the applicant. These biomaterials are only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0053] In the following examples, the data was processed using GraphPad Prism statistical software. The experimental results are expressed as mean ± standard deviation. The t-test was used for analysis. P < 0.05 (*) indicates significant difference, and P < 0.01 (**) indicates extremely significant difference.

[0054] Example 1 NIA1 Obtaining of wheat plants with overexpressed gene NIA1 The coding sequence (CDS) of the gene in wheat variety Chinese Spring is SEQ ID No:1, encoding the NIA1 protein with the amino acid sequence of SEQ ID No:2. In the genomic DNA of wheat variety Chinese Spring, the genomic gene encoding the NIA1 protein is shown as SEQ ID No:3 in the sequence listing.

[0055] Using the cDNA of Chinese Spring wheat leaves as a template, the CDS sequence of TaNIA1-A was amplified using primers TaNIA1-A-F and TaNIA1-A-R to obtain a 2745 bp coding region sequence.

[0056] The primers are as follows: TaNIA1-A-F: 5’- CGACTCTAGAGGATCC TCAGTCCACTCGCGAGGTCGGCTT -3’ (the underlined sequence is the vector adapter sequence, and the primer position is shown as the box at the 5’ end in Sequence 3); TaNIA1-A-R: 5’- CGGTACCCGGGGATCCTCTAGGGAAGGAAGAGTACACATC - 3’ (The underlined sequence is the vector adapter sequence, and the primer position is shown by the box at the 3' end in Sequence 3).

[0057] 1. Construction of expression vector pWMB110 - NIA1 of Digest the pWMB110 vector with the restriction endonuclease BamHI, and recover the linear plasmid of about 10800 bp to obtain the large vector fragment. Use the in - fusion enzyme from Clontech (www.clontech.com, catalog number: ST0344) to ligate the 10800 bp linear plasmid with NIA1 the gene coding sequence to obtain the recombinant plasmid, denoted as pWMB110– NIA1 . (Note: When ligating the vector by the in - fusion method, the fragment is homologously recombined into the vector through the vector adapter sequences added at both ends, and the fragment does not need to be digested with enzymes).

[0058] pWMB110– NIA1 was sent for sequencing. The structure of the recombinant plasmid pWMB110– NIA1 is described as follows: It is a recombinant vector obtained by inserting the DNA fragment with the sequence of SEQ ID No:1 between the BamHI digestion sites of the starting vector pWMB110, while keeping other sequences of the vector pWMB110 unchanged. The pWMB110– NIA1 vector can express the NIA1 protein, and its amino acid sequence is SEQ IDNo:2.

[0059] 2. Obtaining of NIA1 transgenic wheat 1) Construction of recombinant bacteria Introduce the recombinant plasmid pWMB110– NIA1 into Agrobacterium tumefaciens EHA105 to obtain the recombinant Agrobacterium EHA105 / pWMB110– NIA1 .

[0060] 2) NIA1 Gene expression NIA1 Obtaining of transgenic wheat plants Transfer EHA105 / pWMB110– NIA1 into the callus of wheat Fielder (hereinafter referred to as wild - type wheat) embryos. The specific steps are as follows: Plant Fielder wheat, and take its young embryos for transformation 14 days after flowering. Suspend the recombinant Agrobacterium EHA105 / pWMB110– NIA1 with liquid LB medium containing 50 μmol / L kanamycin to obtain a bacterial suspension with an OD 600nm of 0.5. The one containing pWMB110–NIA1 The immature embryos of wheat were infected with the Agrobacterium strain, and then the immature embryos were cultured in WLS-AS medium for two days. After excising the upper and lower hypocotyls of the immature embryos, they were transferred to WLS-Res medium and cultured for another 5 days. Then the explants were transferred to WLS-P5 medium and cultured for 14 days. Subsequently, the explants were divided into two parts and transferred to WLS-P10 medium to induce callus formation for 21 days. Subsequently, the callus was transferred to LSZ-P5 medium to induce shoot regeneration, and the regenerated parts were transferred to LSF-P5 medium for rooting. The transformed wheat plants were planted in the greenhouse, which were the T0 generation plants. The T0 generation plants were self-crossed, and the seeds were harvested and cultivated into plants, which were the overexpressing plants of the T1 generation.

[0061] 3) Transformation NIA1 Detection of the expression level of TaNIA1-A in wheat RNA was extracted from the leaves of the obtained overexpressing plants, and cDNA was obtained by reverse transcription. The fluorescence quantitative PCR experiment was used to verify whether TaNIA1-A in the overexpressing plants was up-regulated. The obtained overexpressing plants were named TaNIA1-A-OE.

[0062] Fluorescence quantitative PCR reaction system: ArtiCan ATM SYBR qPCR Mix 5 μL, TaNIA1-A-qF 0.5 μL, TaNIA1-A-qR 0.5 μL, H2O 3 μL, cDNA 3 μL.

[0063] Fluorescence quantitative PCR reaction program: 95 °C for 1 min, 95 °C for 10 s, 60 °C for 20 s, for 40 cycles.

[0064] The sequence information of the quantitative primers is as follows: TaNIA1-A-qF: 5’-TGCCATCGCACGTGGACGCC-3’; TaNIA1-A-qR: 5’-ATGGGGAGGATCTCGTCGTGG-3’.

[0065] Some of the results are as Figure 3 shown: Compared with wild-type wheat, the gene expression level in the T0 generation transgenic NIA1 wheat lines was significantly increased. NIA1 gene expression level was significantly increased.

[0066] Example 2, Phenotypic study of transgenic NIA1 wheat and statistics of agronomic traits 1. Phenotypic observation The T2 generation transgenic NIA1 wheat was planted in the experimental field. Wait for the T2 generation transgenic NIA1After wheat and wild wheat entered heading and filled with grain, the agronomic traits of wheat plant type, ear type and yield were analyzed and statistically analyzed.

[0067] The results are as follows Figure 1 AC: Compared with wild-type wheat, the T2 transgenic NIA1 The number of effective tillers of wheat increased significantly; the ear length became significantly longer than that of wild-type wheat, and the number of grains per ear increased.

[0068] 2. Statistics of agronomic traits When T2 generation NIA1 After the wheat and wild-type wheat grains matured, all the ears of each individual plant were harvested, dried and stored at room temperature, and the main ears of each individual plant were selected to count the number of grains per ear and the ear length. Finally, all the ears of the whole plant were threshed to complete the determination of 100-grain weight and single-plant yield.

[0069] The results are as follows Figure 2 Medium AE: T2 generation transfer NIA1 The number of tillers of wheat increased significantly compared with wild-type wheat, the number of grains per ear increased significantly compared with wild-type wheat, and the ear length became significantly longer than that of wild-type wheat; the 100-grain weight and single-plant yield increased significantly compared with the wild type.

[0070] In summary: Compared with wild-type wheat, the T2 transgenic NIA1 The number of tillers, number of grains per ear, ear length, 100-grain weight and yield per plant of wheat increased significantly, indicating that wheat NIA1 Genes are regulating wheat yield.

[0071] 3. TaNIA1-A-OE Nitrate reductase activity in overexpressed plants The nitrate reductase activity assay kit (Suzhou Grace Biotechnology Co., Ltd., catalog number: G0402F) was used to TaNIA1-A-OE Detect the nitrate reductase activity in the overexpressed plants. Weigh about 0.1g of plant leaf tissue, add 1mL of extract, and homogenize in an ice bath. Centrifuge at 12000rpm, 4℃ for 10min, take the supernatant, and place on ice for testing. Preheat the microplate reader for more than 30min, adjust the wavelength to 530nm, and zero with distilled water. Then use the reagents in the kit to mix the reagents with the sample supernatant solution, and then perform the microplate reader test. Calculate the enzyme activity based on the data measured by the microplate reader.

[0072] The determination of nitrate reductase enzyme activity is to judge the enzyme activity by measuring the content of the nitrate reductase substrate. First, a standard curve is plotted according to the absorbance values at 530 nm at different substrate concentrations, and then the absorbance value of the sample to be measured at 530 nm is detected to calculate its enzyme activity. The specific standard curve is: y = 0.7244x - 0.0002; where x is the molar concentration of the standard product (μmol / mL) and y is the absorbance value at 530 nm.

[0073] The results are as Figure 4 shown: Compared with wild-type wheat, the nitrate reductase activity in the leaves of T2 transgenic NIA1 wheat plants increased significantly, indicating that wheat NIA1 may regulate nitrogen utilization by participating in the nitrogen assimilation process of wheat, thereby affecting wheat yield, and has good application potential in improving wheat nitrogen use efficiency and yield.

[0074] The above has described the present invention in detail. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any changes, uses or improvements of the present invention, including changes made by using conventional techniques known in the art that are outside the scope disclosed in this application.

Claims

1. Use of a protein, or a substance that regulates the expression of the encoding gene of said protein, or a substance that regulates the activity or content of said protein, in any of the following: 1) Use in regulating plant yield; 2) Use in preparing a product for regulating plant yield; 3) Use in cultivating plants with altered yield; 4) Use in preparing a product for cultivating plants with altered yield; 5) Use in plant breeding; The protein is any of the following proteins: a1) A protein with an amino acid sequence of SEQ ID No: 2; a2) A protein with the amino acid sequence shown in SEQ ID No: 2 having one or several amino acid residue substitutions and / or deletions and / or additions and having the same function; a3) A protein having more than 80% identity with the amino acid sequence defined in a1) or a2) and having the same function; a4) A fusion protein obtained by linking a tag to the end of the protein defined in any of a1)-a3).

2. The application according to claim 1, wherein The protein is derived from wheat.

3. The application according to claim 1 or 2, characterized in that, The substance that regulates the expression of the encoding gene of said protein, or the substance that regulates the activity or content of said protein, is a biological material related to the protein in the use described in claim 1 or 2, and the biological material is any of the following: c1) A nucleic acid molecule encoding said protein; c2) An expression cassette containing the nucleic acid molecule described in c1); c3) A recombinant vector containing the nucleic acid molecule described in c1), or a recombinant vector containing the expression cassette described in c2); c4) A recombinant microorganism containing the nucleic acid molecule described in c1), or a recombinant microorganism containing the expression cassette described in c2), or a recombinant microorganism containing the recombinant vector described in c3); c5) A transgenic plant cell line containing the nucleic acid molecule described in c1), or a transgenic plant cell line containing the expression cassette described in c2); c6) A transgenic plant tissue containing the nucleic acid molecule described in c1), or a transgenic plant tissue containing the expression cassette described in c2); c7) A transgenic plant organ containing the nucleic acid molecule described in c1), or a transgenic plant organ containing the expression cassette described in c2).

4. The application according to claim 3, wherein The nucleic acid molecule described in c1) is any of the following DNA molecules: d1) A DNA molecule with a nucleotide sequence shown in SEQ ID No: 3; d2) A DNA molecule with a coding sequence shown in SEQ ID No: 1; d3) A DNA molecule having 90% or more identity with the nucleotide sequence defined in d1) or d2) and encoding the protein described in claim 1; d4) A DNA molecule that hybridizes with the nucleotide sequence defined in d1) or d2) under stringent conditions and encodes the protein described in claim 1.

5. A method for increasing plant yield, characterized in that, The method is to enhance, increase or up-regulate the activity and / or content of the protein described in claim 1 or 2 in the target plant, and / or, enhance, increase or up-regulate the expression level of the encoding gene of the protein described in claim 1 or 2 to increase plant yield.

6. The method according to claim 5, characterized in that, The plant is any of the following: N1) Monocotyledonous plants: N2) Plants of the order Poales; N3) Gramineous plants; N4) Plants of the genus Triticum; N5) Wheat.

7. A method for cultivating a plant with high yield, characterized in that, Including enhancing, increasing or up-regulating the expression level of the coding gene of the protein described in claim 1 or 2 in the target plant, and / or the activity and / or content of the protein, to obtain a plant with high yield, and the yield of the plant with high yield is higher than that of the target plant.

8. The method according to claim 7, wherein The enhancement, increase or up-regulation of the expression of the coding gene of the protein described in claim 1 or 2 in the plant includes introducing the nucleic acid molecule described in c1) of claim 4, the expression cassette described in c2) or the recombinant vector described in c3) into the target plant to obtain a plant with increased yield.

9. The method according to claim 7 or 8, characterized in that The plant is any one of the following: N1) Monocotyledonous plants: N2) Plants of the order Poales; N3) Gramineous plants; N4) Plants of the genus Triticum; N5) Wheat.

10. The biological material in the application described in claim 3 or 4.

Images