Protein for regulating and controlling iron poison stress resistance of ginseng, coding gene of protein and application of protein in transgenic ginseng

Abstract

The invention provides a protein for regulating and controlling the iron toxicity stress resistance of ginseng, a coding gene of the protein and application of the protein in transgenic ginseng, and relates to the technical field of biology, and the amino acid sequence of the protein is shown as SEQ ID NO.1. Researches find that the over-expressed ginseng protein kinase STPK1 gene can enhance the activity of ginseng-related antioxidant enzymes so as to improve the tolerance of ginseng to iron toxicity stress and prevent or relieve red skin symptoms caused by iron toxicity stress, and can be used for regulating the iron toxicity stress resistance of ginseng or breeding ginseng with high iron toxicity stress resistance.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a protein for regulating the iron toxicity stress tolerance of ginseng, its coding gene, and its application in transgenic ginseng. Background Art

[0002] Iron (Fe) is an essential element for plant growth and development, but excessive iron can be toxic to plants. It has been found that under iron toxicity stress, iron accumulates in ginseng, and ginseng produces oxidative substances and phenolic substances to oxidize and chelate iron. The formation of red roots is a stress response after excessive iron accumulates in ginseng, which will seriously affect the quality and economic benefits of ginseng. Exploring the key genes that regulate the iron toxicity stress tolerance of ginseng provides new ideas for precisely regulating and genetically improving the iron toxicity stress tolerance of ginseng, and is the basis of molecular breeding.

[0003] In view of this, the present invention is specifically proposed. Summary of the Invention

[0004] One of the purposes of the present invention is to provide a protein to solve the technical problem in the prior art that there is a lack of a protein capable of regulating the iron toxicity stress tolerance of ginseng.

[0005] Another purpose of the present invention is a nucleic acid molecule encoding the above-mentioned protein.

[0006] Another purpose of the present invention is to provide a vector containing the above-mentioned nucleic acid molecule.

[0007] Another purpose of the present invention is to provide a recombinant cell.

[0008] Another purpose of the present invention is to provide the application of the above-mentioned protein, and / or, the above-mentioned nucleic acid molecule, and / or, the above-mentioned vector, and / or, the above-mentioned recombinant cell.

[0009] Another purpose of the present invention is to provide a method for improving the iron toxicity stress tolerance of ginseng.

[0010] Another purpose of the present invention is to provide a product for improving the iron toxicity stress tolerance of ginseng.

[0011] In order to achieve the above purposes of the present invention, the following technical solutions are specifically adopted:

[0012] In the first aspect, the present invention provides a protein, and the amino acid sequence of the protein is as shown in SEQ ID NO.1.

[0013] Furthermore, the protein is derived from ginseng.

[0014] In the second aspect, the present invention provides a nucleic acid molecule encoding the above-mentioned protein;

[0015] Preferably, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO.2.

[0016] In a third aspect, the present invention provides a vector containing the above nucleic acid molecule.

[0017] In a fourth aspect, the present invention provides a recombinant cell containing the above vector.

[0018] In a fifth aspect, the present invention provides the application of the above protein, and / or the above nucleic acid molecule, and / or the above vector, and / or the above recombinant cell in any one of the following:

[0019] A. Improving the iron toxicity stress tolerance of ginseng;

[0020] B. Preparing a product for improving the iron toxicity stress tolerance of ginseng;

[0021] C. Cultivating ginseng with high iron toxicity stress tolerance;

[0022] D. Preparing a product for cultivating ginseng with high iron toxicity stress tolerance;

[0023] E. Ginseng breeding.

[0024] In a sixth aspect, the present invention provides a method for improving the iron toxicity stress tolerance of ginseng, including enhancing the activity of the above protein in ginseng, and / or increasing the expression level of the above nucleic acid molecule in ginseng.

[0025] Furthermore, enhancing the activity of the above protein in ginseng, and / or increasing the expression level of the above nucleic acid molecule in ginseng includes introducing the vector or recombinant cell into the ginseng.

[0026] Furthermore, the vector includes a plant transformation vector;

[0027] Preferably, the plant transformation vector includes pCAMBIA2300;

[0028] Preferably, the recombinant cell includes an Agrobacterium cell.

[0029] In a seventh aspect, the present invention provides a product for improving the iron toxicity stress tolerance of ginseng, the product includes a primer pair for amplifying the STPK1 gene, and the nucleotide sequences of the primer pair are as shown in SEQ ID NO.3 and SEQ ID NO.4;

[0030] Preferably, the product includes a reagent or a kit.

[0031] The present invention provides the application of the STPK1 gene in regulating the iron toxicity stress tolerance of ginseng. The research of the present invention finds that overexpressing the ginseng protein kinase STPK1 gene can enhance the activity of antioxidant enzymes related to ginseng, thereby improving the tolerance of ginseng to iron toxicity stress, preventing or alleviating the red skin symptoms caused by iron toxicity stress, and can be used to regulate the iron toxicity stress tolerance of ginseng or breed ginseng with high iron toxicity stress tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0033] Figure 1 It is the PCR identification electrophoresis result diagram of the STPK1 gene cloning and its expression vector provided by the present invention;

[0034] Figure 2 It is the map of the expression vector pCAMBIA2300 provided by the present invention;

[0035] Figure 3 It is the schematic diagram of the formation mode of the ginseng root scar provided by the present invention;

[0036] Figure 4 It is the phenotype and genetic transformation verification results of the transgenic ginseng provided by the present invention under different treatments;

[0037] Figure 5 It is the detection results of physiological indexes in the leaf tissues of the transgenic ginseng provided by the present invention under different treatments;

[0038] Figure 6 It is the detection results of physiological indexes in the root tissues of the transgenic ginseng provided by the present invention under different treatments. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0039] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present invention shall have the meanings commonly understood by those of ordinary skill in the art. The meanings and scopes of the terms should be clear. However, in any case of potential ambiguity, the definitions provided herein shall prevail over any dictionary or extrinsic definition. In this application, unless otherwise specified, the use of "or" means "and / or". In addition, the use of the term "comprising" and other forms is non-restrictive.

[0040] In general, the nomenclature and the techniques used in connection with the cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly used in the art. Unless otherwise indicated, the methods and techniques of the present invention generally are carried out according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout this specification. Enzymatic reactions and purification techniques are performed according to the manufacturer's specifications, as commonly accomplished in the art or as described herein. The nomenclature, as well as laboratory procedures and techniques, used in connection with the analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry described herein are those well known and commonly used in the art.

[0041] The technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without making creative efforts shall fall within the protection scope of the present invention.

[0042] On the one hand, the present invention provides a protein, and the amino acid sequence of the protein is as shown in SEQ ID NO.1.

[0043] The amino acid sequence of the ginseng protein kinase STPK1 gene is as follows:

[0044] MRDTKQMGMLSPCGKPELKKRKQKDPDCRTNVTSAIPDLNGNASEPRLQGNQLPEMNCIPPEGKPQRKRRRKKAAAGLLDINLSYGEVQTNGEALGTALLLKFASELPMPSKENLVSTFCAFGALKESETQVLNDSGSAHVVFTSSSDARNAFRSLEKSSPFGPALVNYRLQILLAASGASEADGNLNMQQAWPADKVKSPSRRRNSKKPKTPGGKPCGLKPREAPDLQFVKQNLQMMTSMLVNAGNNLSAEMRAKLESEIKSLLKKVSSMVGSSSSS (SEQ ID NO.1).

[0045] The present invention has found through research that overexpression of the ginseng protein kinase STPK1 gene can enhance the activities of ginseng-related antioxidant enzymes, thereby improving the tolerance of ginseng to iron toxicity stress, preventing or alleviating the red skin symptoms caused by iron toxicity stress, and can be used to regulate the iron toxicity stress tolerance ability of ginseng or ginseng molecular breeding.

[0046] In some specific embodiments, the protein is derived from ginseng.

[0047] According to another aspect of the present invention, there is also provided a nucleic acid molecule encoding the above-mentioned protein.

[0048] In some specific embodiments, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO.2.

[0049] The nucleotide sequence of the ginseng protein kinase STPK1 gene is as follows:

[0050] ATGAGAGATACGAAGCAGATGGGCATGCTCTCTCCATGTGGTAAGCCTGAGCTCAAGAAGAGAAAGCAGAAAGATCCAGATTGTCGGACTAATGTTACTTCTGCCATACCAGACTTGAATGGAAATGCATCTGAACCTCGCTTGCAAGGAAACCAACTGCCTGAGATGAATTGCATTCCACCTGAAGGTAAACCCCAGAGAAAGAGGAGGAGAAAGAAAGCTGCTGCAGGGTTATTGGATATAAATCTAAGTTATGGTGAGGTACAGACTAATGGAGAAGCTTTGGGGACCGCTCTTCTCTTGAAATTTGCTTCAGAACTTCCCATGCCTTCGAAGGAAAACCTGGTTTCAACATTTTGTGCGTTTGGGGCATTGAAGGAATCTGAGACTCAGGTTTTGAATGATTCTGGTAGTGCCCATGTTGTTTTCACGAGTTCTTCTGATGCTAGAAATGCCTTTCGGAGTTTAGAAAAGAGCAGTCCATTTGGGCCAGCCCTTGTAAACTACCGACTCCAAATTCTGTTAGCTGCTTCTGGAGCTTCAGAAGCAGATGGTAATCTGAACATGCAGCAGGCTTGGCCAGCTGACAAAGTCAAGAGCCCTTCGAGGCGTAGGAACTCAAAGAAGCCTAAAACCCCAGGTGGGAAGCCTTGTGGCTTGAAACCCCGTGAGGCACCTGATCTTCAGTTTGTAAAACAGAATCTTCAGATGATGACATCAATGCTGGTGAATGCGGGCAATAATCTGTCAGCAGAGATGAGAGCCAAATTGGAGAGCGAGATTAAATCTCTCCTGAAGAAGGTGAGCAGCATGGTCGGGTCTTCTTCCTCCTCTTAG(SEQ ID NO.2).

[0051] According to another aspect of the present invention, there is also provided a vector containing the above nucleic acid molecule.

[0052] When the vector is introduced into recipient cells, it can express the ginseng protein kinase STPK1 gene. According to another aspect of the present invention, there is also provided a recombinant cell containing the above vector. For example, the above vector is introduced into Agrobacterium tumefaciens, and then the target gene is inserted into the plant genome using Agrobacterium tumefaciens as a medium.

[0053] By using any vector that can direct the expression of foreign genes in ginseng, the STPK1 gene provided by the present invention is introduced into ginseng plant cells or ginseng plants, and transgenic cell lines or transgenic plants with high tolerance to iron toxicity stress can be obtained.

[0054] According to another aspect of the present invention, there is also provided the use of the above protein, and / or the above nucleic acid molecule, and / or the above vector, and / or the above recombinant cell in any one of the following:

[0055] A. Improving the iron toxicity stress tolerance of ginseng;

[0056] B. Preparing a product for improving the iron toxicity stress tolerance of ginseng;

[0057] C. Cultivating ginseng with high iron toxicity stress tolerance;

[0058] D. Preparing a product for cultivating ginseng with high iron toxicity stress tolerance;

[0059] E. Ginseng breeding.

[0060] According to another aspect of the present invention, there is also provided a method for improving the iron toxicity stress tolerance of ginseng, including increasing the activity of the above protein in ginseng, and / or increasing the expression level of the above nucleic acid molecule in ginseng.

[0061] In some specific embodiments, increasing the activity of the above protein in ginseng, and / or increasing the expression level of the above nucleic acid molecule in ginseng includes introducing the vector or recombinant cell into the ginseng.

[0062] In some specific embodiments, the vector includes a plant transformation vector. In some specific embodiments, the plant transformation vector includes pCAMBIA2300. In some specific embodiments, the recombinant cell includes Agrobacterium tumefaciens cells.

[0063] According to another aspect of the present invention, there is also provided a product for improving the iron toxicity stress tolerance of ginseng, the product includes a primer pair for amplifying the STPK1 gene, and the nucleotide sequences of the primer pair are as shown in SEQ ID NO.3 and SEQ ID NO.4;

[0064] Wherein, the product includes a reagent or a kit.

[0065] The present invention will be further described by way of examples. Unless otherwise specified, the materials in the examples are prepared according to existing methods or directly purchased from the market.

[0066] Example 1 Cloning of the ginseng protein kinase STPK1 gene

[0067] In this example, the leaves of one-year-old ginseng were used as experimental materials, and total RNA in the ginseng samples was extracted using a Trizol extraction kit (Sangon Biotech); the first-strand cDNA was reversely synthesized using MightyScript First Strand cDNA Synthesis Master Mix.

[0068] Based on the gene sequences related to the ginseng transcriptome data, primers for 3' RACE and 5' RACE amplification were designed. Among them, the primers required for amplification are shown in Table 1.

[0069] Table 1

[0070]

[0071] The PCR reaction system is as follows: 13.5 μL of Taq enzyme, 0.5 μL of forward primer, 0.5 μL of reverse primer, 0.5 μL of template cDNA, and made up to 20 μL with sterile ddH2O; the reaction program: pre-denaturation at 95 °C for 5 min; 94 °C for 30 s; 55 °C for 30 s; 72 °C for 60 s, 35 cycles; 72 °C for 10 min. Finally, the gene fragments obtained by 3' RACE and 5' RACE were ligated to the pMD18-T vector, transformed into SK2301 competent cells, and sequenced after colony PCR, and the gene sequence was spliced. Finally, the full-length cDNA sequence of the gene was obtained as 1124 bp, tentatively named the STPK1 gene.

[0072] Example 2 Construction of a plant expression vector for the ginseng protein kinase STPK1 gene

[0073] In this example, a cloning technique was used to construct an overexpression vector for the STPK1 gene. Using the specific PCR primers shown in Table 2 and ginseng cDNA as a template, PCR amplification was carried out. Gel electrophoresis, the results are as Figure 1As shown in A, the cloning result of the STPK1 gene (837 bp) was obtained, and the target gene fragment was recovered by gel extraction. The vector pCAMBIA2300-GFP was digested with SacI and XbaI. The reaction system was as follows: Quick SacI 1.0 μL; Quick XbaI 1.0 μL; 10×Q cut Buffer 4.0 μL; 2300-eGFP 5.5 μL; ddH2O 28.5 μL. The reaction conditions were: 37 °C for 15 min; 70 °C for 15 min. After the digestion reaction was completed, electrophoresis was performed for detection, and the large fragment was recovered by gel extraction. The homologous recombination system was: linearized vector 1.0 μL; gene fragment 3.0 μL; 5× reaction buffer 2.0 μL; plus recombinase 1.0 μL; ddH2O 3.0 μL. The reaction conditions were: 50 °C for 20 min. Among them, the map of the vector pCAMBIA2300 is as shown in Figure 2 shown.

[0074] Table 2

[0075]

[0076] After the reaction was completed, the reaction solution was added to 100 μL of Escherichia coli DH5α competent cells, and heat shock transformation was performed. Then, it was spread on a solid LB plate containing kanamycin and cultured overnight at 37 °C for 16 h. Single colonies were picked and detected by colony PCR. The reaction system was: 2×Easy PCR Super Mix 10.0 μL; STPK1-2300-F 1.0 μL; STPK1-2300-R 1.0 μL; bacterial solution 1.0 μL; ddH2O 7.0 μL. The PCR amplification program was: 95 °C for 3 min; 95 °C for 30 s; 58 °C for 30 s; 72 °C for 1.5 min; 30 cycles; 72 °C for 5 min. Gel electrophoresis detection was performed, and the results were as shown in Figure 1 B. In B, lanes 1-8 (837 bp) were the PCR identification results of the recombinant vector-transformed Escherichia coli bacterial solution. It can be seen that the recombinant vector was successfully transformed into Escherichia coli.

[0077] The expression vector contains a GFP fluorescent marker, which can be used as a screening marker for transgenic ginseng. Through PCR detection and sequencing verification, it was confirmed that the overexpression vector was successfully constructed and named pCAMBIA2300-STPK1.

[0078] Example 3 Genetic transformation of ginseng protein kinase STPK1 gene

[0079] By the freeze-thaw method, the STPK1 overexpression vector constructed in Example 2 was transferred into Agrobacterium rhizogenes K599. By the Agrobacterium-mediated infection method, as shown in Figure 3The ways of ginseng root scar formation shown are scratch (upper) and root cutting (lower). Transfer pCAMBIA2300-STPK1 into ginseng plants, and the transformation steps are as follows: Select three-year-old ginseng seedlings with plump buds, strong plants, no scars and broken roots for genetic transformation. Wash them clean with tap water and distilled water respectively, soak them in a 250 ppm gibberellin solution for 1 h, and then dry them with sterile filter paper. Make scars and directly cut the roots (upper middle part of the roots) of ginseng with a sterile scalpel near the buds. The Agrobacterium tumefaciens containing the STPK1 expression vector is cultured until OD 600 = 0.6 - 0.8, and then infect at the wound. Use the empty vector pCAMBIA2300 as a control and culture under the conditions of 25℃ / 18℃ (day / night), 16 h / 8 h of day / night, light intensity of 3000 lx, and relative humidity of 70%. After one month, extract the DNA of ginseng leaves and verify by PCR. And finally obtain STPK1 overexpressing transgenic ginseng.

[0080] Example 4 verifies the effect of the STPK1 gene on improving the iron toxicity stress tolerance of ginseng

[0081] Select the STPK1 overexpressing transgenic ginseng and the empty vector transgenic ginseng obtained in Example 3. After 22 days of acclimatization, they are respectively divided into a control group (Control: 0.05 mM Fe 2+ ) and an iron toxicity stress group (+Fe: 0.40 mM Fe 2+ ) for treatment. After one month of treatment, sample the roots and leaves and store them at -80℃. The results are as Figure 4 shown. A is the phenotypic diagram of transgenic ginseng, B is the PCR verification result of transgenic ginseng genetic transformation, EV is the empty vector transgenic ginseng (transformed with the empty vector), and STPK1 is the STPK1 overexpressing transgenic ginseng.

[0082] It can be seen that by subjecting the empty vector-transformed and transgenic ginseng materials to iron toxicity stress treatment, it is found that compared with the empty vector-transformed ginseng plants, the STPK1 transgenic ginseng plants have lighter red skin symptoms at the roots, more fibrous roots, and fewer broken roots; compared with the control treatment group, the STPK1 transgenic ginseng plants in the iron toxicity stress treatment group have more obvious red skin symptoms at the roots and obvious broken root phenomena.

[0083] At the same time, measure the relevant physiological indexes of the leaves and roots of the empty vector-transformed and STPK1 transgenic ginseng plants in different treatment groups. The results are as Figure 5 and Figure 6 shown. Among them, A is ascorbate peroxidase (APX), B is catalase (CAT), C is malondialdehyde (MDA), D is peroxidase (POD), E is superoxide anion (OFR), and F is reactive oxygen species (ROS).

[0084] It can be seen that the activities of APX, CAT, and POD in the leaves and root tissues of STPK1 transgenic ginseng in the iron toxicity stress treatment group are all higher than those of the empty vector control. Among them, the APX activity in the roots of STPK1 transgenic plants is significantly higher than that of the empty vector control plants; the MDA and OFR contents in the leaves and root tissues of STPK1 transgenic ginseng are lower than those of the empty vector control plants. Among them, the OFR content and the production rate of ROS in the roots of STPK1 transgenic ginseng are significantly lower than those of the empty vector control plants. Therefore, it shows that ginseng responds to iron toxicity stress by triggering an oxidative response, which requires the participation of antioxidant enzymes to maintain the intracellular reactive oxygen species homeostasis. This further indicates that STPK1 transgenic ginseng plants improve their tolerance to iron toxicity stress by enhancing the activities of relevant antioxidant enzymes.

[0085] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A protein, the amino acid sequence of which is shown in SEQ ID NO.

1.

2. The protein according to claim 1, wherein The protein is derived from ginseng.

3. A nucleic acid molecule encoding the protein according to claim 1 or 2; Preferably, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

2.

4. A vector containing the nucleic acid molecule according to claim 3.

5. A recombinant cell, characterized in that, Containing the vector according to claim 4.

6. Use of the protein according to claim 1 or 2, and / or the nucleic acid molecule according to claim 3, and / or the vector according to claim 4, and / or the recombinant cell according to claim 5 in any one of the following: A. Improving the iron toxicity stress tolerance of ginseng; B. Preparing a product for improving the iron toxicity stress tolerance of ginseng; C. Cultivating ginseng with high iron toxicity stress tolerance; D. Preparing a product for cultivating ginseng with high iron toxicity stress tolerance; E. Ginseng breeding.

7. A method for improving the iron toxicity stress tolerance of ginseng, characterized in that, Including increasing the activity of the protein according to claim 1 or 2 in ginseng, and / or increasing the expression level of the nucleic acid molecule according to claim 3 in ginseng.

8. The method according to claim 7, wherein Increasing the activity of the protein according to claim 1 or 2 in ginseng, and / or increasing the expression level of the nucleic acid molecule according to claim 3 in ginseng includes introducing the vector or recombinant cell into the ginseng.

9. The method according to claim 8, wherein The vector includes a plant transformation vector; Preferably, the plant transformation vector includes pCAMBIA2300; Preferably, the recombinant cell includes an Agrobacterium cell.

10. A product for improving the iron toxicity stress tolerance of ginseng, characterized in that, The product includes a primer pair for amplifying the STPK1 gene, the nucleotide sequences of the primer pair are shown in SEQ ID NO.3 and SEQ ID NO.4; Preferably, the product includes a reagent or a kit.

Images