Method for increasing stalk diameter, stalk strength or / and stalk lignin content of plant

Abstract

The invention discloses a method for increasing the diameter, the strength or / and the lignin content of a plant stalk, and belongs to the technical field of biology. The method comprises the step of increasing the stem diameter, the stem strength or / and the lignin content of the stem of a target plant by increasing or increasing a substance expressed by a coding gene of a protein in the target plant. The protein is ZmPER64, and the nucleotide sequence of the protein is shown as SEQ ID NO: 1. Experiments show that overexpression of the ZmPER64 gene can increase the diameter of a stem, improve the puncture force of the corn stem and increase the synthesis of lignin. The method can be used for cultivation of new lodging-resistant corn varieties and utilization in biological energy application, and is beneficial to high and stable yield of corn, improvement of corn harvest index, improvement of lodging-resistant capability and enlargement of application in biochemical engineering materials.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a method for increasing the diameter, strength, and / or lignin content of plant stems. Background Art

[0002] As a key food crop, the yield of maize has always attracted much attention. The agronomic traits of the stem are one of the key factors affecting the plant type of maize and also the main factors affecting the yield, playing a crucial role in crop improvement. The Green Revolution in the 1960s achieved dwarf breeding of rice and wheat by using the SD1 gene in rice and the RHT1 gene in wheat, greatly increasing the yield.

[0003] However, so far, while maintaining high yields, there have been no successful cases of achieving breeding goals by regulating the stem diameter except for the regulation of plant height. Especially in maize, there are very few genes that have been discovered to effectively increase the stem diameter and enhance the lodging resistance. Therefore, exploring genes related to the maize stem diameter not only has important theoretical value but also great practical significance. This has a profound impact on promoting the progress of maize breeding technology and increasing maize yield.

[0004] The structure of the maize stem has a decisive impact on its diameter and lodging resistance, and the composition of the cell wall is the key factor shaping the stem characteristics. The main components of the cell wall include cellulose, hemicellulose, lignin, etc., among which lignin is closely related to the synthesis of the secondary wall and affects the thickening process of the cell wall. For the maize stem, lignin not only provides support but also helps to resist the invasion of pathogens and transport nutrients and water. Existing studies have shown that mutants with defective lignin synthesis will change the composition of the cell wall, thereby affecting the plant height.

[0005] Therefore, if it is possible to change the composition of the stem cell wall by regulating genes related to lignin synthesis without sacrificing yield, thereby increasing the stem diameter and lodging resistance, this will be an extremely important breakthrough. Such research can not only enhance the stress resistance of maize but also may open up new ways to improve crop yield and stability.

[0006] Transgenic technology has been widely applied in the field of crop improvement and has shown great potential in endowing crops with various excellent traits, including pest and disease resistance, salt tolerance, and high yield. In the breeding process of maize, the application of transgenic technology is also crucial, which can effectively regulate the diameter of the maize stem, enhance its lodging resistance, and improve the stem strength by regulating gene expression.

[0007] The third class of peroxidase family is a plant-specific secreted peroxidase. Peroxidases obtain electrons from various electron donor molecules such as phenolic compounds, lignin monomers, auxin, or other secondary metabolites to catalyze the reduction reaction of H2O2. The diversity of catalytic substrates indicates that the peroxidase protein family is involved in a wide range of physiological and biological processes, such as the formation of lignin and suberin, cross-linking of cell walls, resistance to pathogen invasion, auxin metabolism, and cell elongation.

[0008] After lignin monomers are transported outside the cell, they form lignin polymers under the catalysis of peroxidase and participate in the formation of cell walls.

[0009] In maize, there are few genes involved in lignin synthesis that affect the agronomic traits of the stem. Applying these genes to crop improvement in terms of increasing stem strength and changing cell wall synthesis will be of great significance. Summary of the Invention

[0010] The technical problem to be solved by the present invention is ZmPER64 The application of genes in regulating the stem diameter, puncture force of plants, and promoting lignin synthesis. The technical problems to be solved are not limited to the described technical topics, and those skilled in the art can clearly understand other technical topics not mentioned herein through the following description.

[0011] To solve the above technical problems, the present invention provides the following technical solutions: In a first aspect, the present invention also provides a method for increasing the stem diameter, stem strength, and / or lignin content of a stem of a plant. The method includes introducing a coding gene of a protein or a substance that upregulates or increases the expression of the coding gene into a target plant, so as to increase the stem diameter, stem strength, and / or lignin content of the stem of the target plant.

[0012] In the above method, the substance is any one of the following: B1), a nucleic acid molecule encoding the aforementioned protein; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2).

[0013] The method includes, but is not limited to, transgenic, hybridization, backcross, self-cross, or asexual reproduction.

[0014] The protein is ZmPER64 and is derived from maize.

[0015] The breeding purposes include increasing the stem diameter, strength (increasing the ability of the stem to resist puncture), and promoting lignin synthesis (increasing the lignin content of the stem).

[0016] The objectives of the breeding include obtaining plants with increased stem diameter, increased stem strength, and / or increased synthesis of lignin content.

[0017] In the above application, the protein is any one of the following: A1) A protein with an amino acid sequence of SEQ ID NO:1; A2) A protein derived from A1) with the same function or having more than 80% identity to the protein shown in A1), which is obtained by substitution and / or deletion and / or addition of amino acid residues to the amino acid sequence shown in SEQ ID NO:1; A3) A fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0018] The tag proteins include, but are not limited to: GST (glutathione S-transferase) tag protein, His6 tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein), or AviTag tag protein.

[0019] Those of ordinary skill in the art can easily mutate the nucleotide sequence encoding the protein ZmPER64 of the present invention by using known methods, such as directed evolution or site-directed mutagenesis. Those nucleotides that have been artificially modified and have 75% or more identity to the nucleotide sequence of the protein ZmPER64 isolated from the present invention, as long as they encode the protein ZmPER64 and have the function of the protein ZmPER64, are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.

[0020] The above 75% or more identity can be 80%, 85%, 90%, or 95% or more identity.

[0021] In this article, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web page on the NCBI home page website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively and performing a search, the identity value (%) of the amino acid sequence can be calculated.

[0022] In this article, the identity of more than 80% can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0023] In a second aspect, the present invention provides the use of a coding gene of a pre-protein or a substance that up-regulates or increases the expression of the coding gene in any of the following: M1) increasing the stem diameter of a plant; M2) preparing a product for increasing the stem diameter of a plant; M3) cultivating a plant with an increased stem diameter; M4) increasing the stem strength of a plant; M5) preparing a product for increasing the stem strength of a plant; M6) cultivating a plant with an increased stem strength; M7) increasing the lignin content of the stem of a plant; M8) preparing a product for increasing the lignin content of the stem of a plant; M9) cultivating a plant with an increased lignin content in the stem; M10) plant breeding.

[0024] In the above applications, the substance is any of the following: B1), a nucleic acid molecule encoding the aforementioned protein; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6), a transgenic plant tissue containing the nucleic acid molecule described in B1), or a transgenic plant tissue containing the expression cassette described in B2); B7), a transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2).

[0025] In the above applications, the nucleotide sequence of the nucleic acid molecule described in B1) is SEQ ID NO: 2.

[0026] In a second aspect, the present invention provides the use of a biological material related to the aforementioned protein ZmPER64, and the use is any one of the following: M1) increasing the stem diameter of a plant; M2) preparing a product for increasing the stem diameter of a plant; M3) cultivating a plant with an increased stem diameter; M4) increasing the stem strength of a plant; M5) preparing a product for increasing the stem strength of a plant; M6) cultivating a plant with an increased stem strength; M7) increasing the lignin content of the stem of a plant; M8) preparing a product for increasing the lignin content of the stem of a plant; M9) cultivating a plant with an increased lignin content in the stem; M10) plant breeding.

[0027] The biological material is any one of the following: B1), a nucleic acid molecule encoding the aforementioned protein; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6), a transgenic plant tissue containing the nucleic acid molecule described in B1), or a transgenic plant tissue containing the expression cassette described in B2); B7), a transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2).

[0028] Among the above substances, the expression cassette containing a nucleic acid molecule as described in B3) refers to a DNA that can express the protein described above in a host cell. The expression cassette may also include a single-stranded or double-stranded nucleic acid molecule containing all the regulatory sequences necessary for the nucleic acid molecule encoding any one of the above proteins. The regulatory sequences can direct the coding sequence to express any one of the above proteins in a suitable host cell under its compatible conditions. The regulatory sequences include, but are not limited to, a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal sequence, and a transcription terminator. At a minimum, the regulatory sequences should include a promoter and the termination signals for transcription and translation. To introduce specific restriction enzyme sites into the vector for ligating the regulatory sequences to the coding region of the nucleic acid sequence encoding the protein, regulatory sequences with linkers can be provided. The regulatory sequence can be a suitable promoter sequence, i.e., a nucleic acid sequence recognizable by the host cell expressing the nucleic acid sequence. The promoter sequence contains the transcriptional regulatory sequences mediating protein expression. The promoter can be any nucleic acid sequence having transcriptional activity in the selected host cell, including mutant, truncated, and chimeric promoters, and can be from a gene encoding an extracellular or intracellular protein homologous or heterologous to the host cell. The regulatory sequence can also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell to terminate transcription. The termination sequence is operably linked to the 3'-end of the nucleic acid sequence encoding the protein. Any terminator that can function in the selected host cell can be used in the present invention. The regulatory sequence can also be a suitable leader sequence, i.e., an untranslated region of mRNA that is important for translation in the host cell. The leader sequence is operably linked to the 5'-end of the nucleic acid sequence encoding the protein. Any leader sequence that can function in the selected host cell can be used in the present invention. It may also be necessary to add regulatory sequences that can regulate protein expression according to the growth of the host cell. Examples of regulatory sequences are those systems that can respond to chemical or physical stimulants (including in the presence of regulatory compounds) to turn on or off gene expression. Other examples of regulatory sequences are those that can amplify genes.

[0029] In the above application, the nucleotide sequence of the nucleic acid molecule described in B1) is SEQ ID NO:2.

[0030] In the above application and / or method, the plant is any one of the following: M1) Dicotyledonous plants or monocotyledonous plants; M2) Plants of the order Poales; M3) Gramineous plants; M4) Zea plants; M5) Maize.

[0031] In a specific embodiment of the present invention, overexpression ZmPER64 genes are driven by a maize constitutive promoter Ubiquitin1 .

[0032] In a preferred embodiment, the expression cassette on the maize expression vector consists of a promoter from a Ubiquitin1 gene of maize and a 3' transcriptional termination region from the nopaline synthase (nos) gene. The selectable marker gene is the herbicide-resistant gene Bar. The starting vector of the expression vector is the pBECXUN vector, and the recombinant plasmid pBECXUN- ZmPER64 is constructed, where ZmPER64 the gene is inserted forward and is driven by a maize Ubiquitin1 promoter for expression.

[0033] The present invention transforms the overexpression vector containing ZmPER64 into the maize inbred line ND101, and plants with increased stem diameter, increased puncture force, and increased lignin content are obtained.

[0034] The advantages of the present invention are that the present invention discovers for the first time that ZmPER64 the gene has the biological functions of regulating plant stem diameter, puncture force, and promoting lignin synthesis. Regulating the ZmPER64 expression in maize can regulate the maize stem diameter. Overexpressing ZmPER64 genes can increase the maize stem diameter, increase the puncture force, and increase the lignin content. The present invention provides a new method for using ZmPER64 genes to increase stem diameter, increase lodging resistance, and promote lignin synthesis, which can be used for cultivating new maize varieties with increased stem thickness, is beneficial to high and stable yield of maize, improves the maize harvest index, enhances the lodging resistance of maize, and can improve the utilization rate of bioenergy. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is for proving that ZmPER64 the gene is expressed in the stem vascular bundles in Example 2 of the present invention. Among them, the material is the first stem of six-week-old seedlings. ZmActin1 The expression of

[0036] Figure 2 is the positive control, and the sample without reverse transcription is the negative control. ZmPER64 This is the ZmUbiquitin1 overexpression vector constructed in Example 1 of the present invention, in which the expression of the gene is initiated by a ZmPER64 promoter and terminated by the terminator nos, and the

[0037] Figure 3 For the detection results of overexpression materials in Example 4 of the present invention, where ZmPER64 , OE1 , OE2 are overexpression lines of two different inbred lines with ND101 as the background. The material is the fourth internode stem at the pollen shedding stage, ZmUBI2 is the reference gene.

[0038] Figure 4 are the field phenotype photos of the inbred line materials and the statistical results of stem diameters in Example 4 of the present invention, OE1 , OE2 are overexpression lines of two different inbred lines with ND101 as the background.

[0039] Figure 5 are the statistical results of the stem piercing force of the inbred line materials in Example 4 of the present invention, OE1 , OE2 are overexpression lines of two different inbred lines with ND101 as the background.

[0040] Figure 6 are the staining and chemical determination results of the lignin content in the inbred line stems in Example 4 of the present invention. OE1 , OE2 refer to 2 different lines of the inbred line with ND101 as the background. Detailed implementation manners

[0041] The present invention will be further described in detail below in combination with specific implementation manners. The given examples are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided examples can be used as a guide for those of ordinary skill in the art to make further improvements and do not limit the present invention in any way.

[0042] The experimental methods in the following examples are all conventional methods unless otherwise specified, such as in the molecular cloning experimental manual by Sam brook et al. (Sam brook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0043] Inbred line ND101: It is described in the non-patent literature "The transcription factor ZmMYB69 represses lignin biosynthesis by activating ZmMYB31 / 42 expression in maize", and the public can obtain it from China Agricultural University. This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0044] pBECXUN vector: Its preparation method is described in the non-patent literature "A versatile zero background T-vector system for gene cloning and functional genomics". It is specified in this literature that the pBECXUN vector is based on the commercial vector pCAMBIA1300. The hygromycin resistance gene hpt in it is replaced with the herbicide resistance gene bar, and the CP4-mstm resistance gene driven by the 35S promoter is integrated after the Bar gene, making the vector have the property of dual-antibiotic screening; at the same time, the promoter of the maize ubiquitin gene Ubi is cloned onto the vector by restriction enzyme digestion and ligation to drive the transcription of the downstream overexpressed gene. The public can obtain it from China Agricultural University. This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0045] In the following examples, the GraphPad Prism 8 statistical software was used to process the data. The experimental results are expressed as mean ± standard deviation, and T-test or one-way ANOVA test was used. * P <0.05 or ** P <0.01 or *** P <0.001 indicates significant difference.

[0046] Example 1, ZmPER64 Construction of expression vector and genetic transformation I. Construction of recombinant expression vector Total RNA was extracted from the V6-stage seedlings of maize inbred line ND101, and cDNA was reverse-transcribed using the cDNA Synthesis Kit of Takala Company. Specific primers (ZmPER64-F and ZmPER64-R) were used for amplification to obtain ZmPER64 the CDS sequence, with a full length of 993 bp (SEQ ID NO: 2). The nucleotide sequences of the primer pair are: ZmPER64-F: 5'-ATGGCGGCGGCGCCTCC-3'; ZmPER64-R: 5'-TCATGATGGGTTAACTCGCCTGCAG-3'.

[0047] Recover the PCR product, ligate the target fragment to the pBECXUN vector, and transform competent Escherichia coli cells. After culturing for 12 - 16 hours, identify monoclonal colonies by colony PCR, and pick positive monoclonal colonies for sequencing. After sequencing, name the correctly sequenced recombinant vector as pBECXUN- ZmPER64 . pBECXUN- ZmPER64 is a recombinant expression vector obtained by replacing the U biquitin1 promoter of the pBECXUN vector with a DNA fragment whose nucleotide sequence is SEQ ID NO:2. This recombinant expression vector expresses a protein with an amino acid sequence of SEQ ID NO:1. The expression cassette for expressing ZmPER64 in pBECXUN- ZmPER64 is composed of ZmUbiquitin1 the promoter and the 3' transcriptional termination region from the nopaline synthase (nos) gene. The selectable marker gene is the herbicide-resistant gene Bar. Its expression cassette is as Figure 2 shown.

[0048] Transform the correctly sequenced pBECXUN- ZmPER64 recombinant plasmid into competent Agrobacterium tumefaciens EHA105 by electroporation. Identify positive monoclonal strains by colony PCR, and name the identified positive monoclonal colonies as pBECXUN- ZmPER64 Agrobacterium strains carrying the target gene. The primers for colony PCR identification are as follows: F: 5'-TTTTAGCCCTGCCTTCATACGC-3'; R: 5'-AGACCGGCAACAGGATTCAATC-3'.

[0049] II. Obtaining Transgenic Plants Use the pBECXUN- ZmPER64 Agrobacterium strains carrying the target gene to transform the immature embryos of maize inbred line ND101, and screen to obtain single-copy positive seedlings. After screening and identification, obtain single-copy homozygous lines. The specific operations are as follows: 1. Transformation: Inoculate the correctly identified single colony of Agrobacterium into 2 - 3 mL of liquid medium containing 100 μg / mL kanamycin and 50 μg / mL rifampicin, and culture overnight at 28°C with shaking. The next day, transfer it to a large amount of liquid medium containing antibiotics and culture with shaking. After transferring several times, collect the bacteria and resuspend them to an OD 600 between 0.8 - 1.0. Use the obtained recombinant Agrobacterium suspension to infect the ND101 maize immature embryos excised under sterile conditions, and then induce callus to form seedlings.

[0050] 2. Obtaining of homozygous lines: Use a Bar test strip to detect whether the recombinant plasmid has been introduced into maize immature embryos, and screen positive seedlings. Self-pollinate and multiply the seeds of the positive seedlings to obtain the T1 generation. Self-pollinate the T1 generation, screen the transgenic plants with a segregation ratio of 3:1 by herbicide and self-pollinate to obtain the T2 generation. Self-pollinate the T2 generation to obtain the T3 generation. Screen all positive plants in the T3 generation with herbicide, that is, the non-segregating lines, and infer that the T2 generation is the homozygous line.

[0051] Name the overexpressing homozygous plants of the T3 generation used for subsequent experiments as ZmPER64 OE1 and ZmPER64 OE2.

[0052] Example 2. Tissue expression analysis of ZmPER64 ZmPER64 Tissue expression analysis is carried out by in situ PCR method. Fix the stems of six-week-old maize inbred line ND101 with FAA fixative, evacuate for 30 minutes, cut sections with a thickness of 50 μm using a Leica microtome, and detect the tissue expression according to the in situ PCR method. ZmPER64 Use the non-reverse-transcribed sample as a negative control, the sample reverse-transcribed with ZmActin1 qPCR -F as a primer as a positive control, and detect the tissue localization of ZmPER64 with ZmPER64 qPCR-F as a primer.

[0053] Zm-Actin1 qPCR-F: 5'-TTGTCCTCAGTGGGGGATCT-3'; Zm-PER64 qPCR -F: 5'-TGCATTTCCACGACTGCT-3'; In situ PCR: Refer to the method of Koltai and Brid (Koltai and Brid, 2000), cut the samples required for the experiment into small pieces, with a maximum size of 5×2 mm, immediately soak them in FAA solution, and fix them in a 4°C refrigerator for 24 h.

[0054] After fixation, wash the sample three times with 63% ethanol and 5% acetic acid solution for 10 min each time, and then wash it once with PBS buffer for 10 min. Place 5% low melting point agarose in an 80°C oven to melt it the night before. Cool it to 45°C when embedding the sample. Immerse the sample in the low melting point agarose and position the sample properly for subsequent sectioning. Use a microtome to section the agarose-embedded sample with a thickness of 50 μm, and place it in deionized water to separate the sample from the agarose. Use a brush to pick up the sample from the water and place it into a PCR tube containing deionized water with RNase inhibitor. Approximately 10 sections can be placed in each tube. Incubate with 8 U RNase free DNase (DNase buffer Ⅰ) at 37°C for 45 min to remove genomic DNA, and add EDTA with a final concentration of 15 mM and treat at 75°C for 10 min to inactivate DNase. Reverse transcribe cDNA, and the reaction system and procedure are as follows: Table 1. Reaction System (I)

[0055] Place the reaction system in a 65°C metal bath and react for 10 min, then immediately place it on ice for 5 min, and continue to add the following reagents (a total of 40 μL including the reagents in Table 1): Table 2. Reaction System (II)

[0056] After mixing, perform the following PCR reaction procedure: 42°C, 50 min; 72°C, 15 min.

[0057] After reverse transcription, perform PCR amplification reaction, and the amplification system and amplification procedure are shown in Table 3 and Table 4.

[0058] Table 3. PCR Amplification System

[0059] Table 4. PCR Amplification Procedure

[0060] After PCR, wash twice with PBS buffer for 5 min each time, and block with 100 μL of 0.1% BSA (prepared freshly) for 30 min. Dilute the digoxin antibody with 0.1% BSA blocking solution at a ratio of 1:500, add 50 μL to each well, and incubate for 1 h. Wash twice with 10×Washing buffer (0.1M Tris-HCl, 0.15M NaCl, pH9.5) for 15 min each time. Stain with BCIP staining solution for about 1 h. When the sample turns purple, wash with ultrapure water to terminate the reaction, and the sample can be further observed under a microscope.

[0061] The results are as Figure 1 shown, indicating ZmPER64 expression in the vascular bundles of the stem.

[0062] Example 3. Identification of ZmPER64 expression levels in transgenic maize Extract the total RNA from the stems of the positive transgenic maize (T3 generation) at the pollen shedding stage obtained in Example 1, reverse transcribe it into cDNA, and use ZmPER64 gene-specific primers for real-time fluorescence quantitative PCR amplification. The amplification system and amplification program are shown in Tables 5 and 6. Each gene has three biological replicates. Using the ZmUBI2 gene as an internal reference gene, perform Realtime qPCR, and use the 2 -ΔΔCt method to analyze the qRT-PCR results and calculate the relative gene expression levels.

[0063] Primer pairs for detecting ZmPER64 the gene: ZmPER64qPCR-F: 5'-TGCATTTCCACGACTGCT -3'; ZmPER64qPCR-R: 5'-GCGTTGTCGATGACGTAGAA -3'.

[0064] Primer pairs for detecting the ZmUBI2 gene: ZmUBI-2-F: 5'-TGGTTGTGGCTTCGTTGGTT-3'; ZmUBI-2-R: 5'-GCTGCAGAAGAGTTTTGGGTACA-3'.

[0065] Table 5. qRT-PCR amplification system

[0066] Table 6. qRT-PCR amplification program

[0067] The results are as follows Figure 3 As shown, the expression levels of the genes in each overexpressing transgenic line ZmPER64 OE1 , ZmPER64 OE2 are ZmPER64 higher than those in the control inbred line ND101.

[0068] Example 4. Measurement of the stem diameter of transgenic maize plants overexpressing ZmPER64 The inbred line ND101 and the positive transgenic maize plants obtained in Example 1 OE1 and ZmPER64 OE2 were planted at the Experimental Station of China Agricultural University in Zhuozhou, Hebei Province (latitude 39°27'49", longitude 115°51'05"). Each line was planted in three plots, with a row spacing of 50 cm and a plant spacing of 25 cm in each plot. When the plants entered the pollen-dispersing stage, the stem diameter of the fourth internode of the plants was measured using a vernier caliper. At least 15 plants were counted for each line. ZmPER64 The results are as follows

[0069] As shown, the stem diameters of each overexpressing transgenic line Figure 4 are ZmPER64 OE1 , ( P < 0.01), ZmPER64 OE2 , ( P < 0.01) are higher than those in the control inbred line ND101.

[0070] Example 5. Measurement of the stem puncture force of transgenic maize plants overexpressing ZmPER64 The inbred line ND101 and the positive transgenic maize plants obtained in Example 1 OE1 and ZmPER64 OE2 were planted at the Experimental Station of China Agricultural University in Zhuozhou, Hebei Province (latitude 39°27'49", longitude 115°51'05"), with a row spacing of 50 cm and a plant spacing of 25 cm. When the plants entered the pollen-dispersing stage, a stem strength tester was used to measure the stem puncture force of the fourth internode during the pollen-dispersing stage. At least 15 plants were counted for each line. ZmPER64 The results are as follows

[0071] As shown, the stem puncture forces of each overexpressing transgenic line Figure 5 are ZmPER64 OE1 , ( P < 0.01), ZmPER64 OE2 , ( P < 0.01) are higher than those in the control inbred line ND101.

[0072] Example 6. Measurement of the lignin content in the stems of transgenic maize plants overexpressing ZmPER64 The inbred line ND101 and the positive transgenic maize plants obtained in Example 1 OE1 and ZmPER64OE1 and ZmPER64 OE2 were planted at the experimental station of China Agricultural University in Zhuozhou City, Hebei Province (39°27'49" N, 115°51'05" E). Three plots were planted for each strain, with a row spacing of 50 cm and a plant spacing of 25 cm in each plot. When the plants entered the pollen-dispersing stage, the stem of the fourth internode was taken to measure the lignin content. The measurement method is as follows: The lignin content was measured according to the Acetyl Bromide method (Fukushima and Hatfield, 2004): a) Take about 15 mg of the dried and ground powder. b) Add 1 mL of freshly prepared 25% acetyl bromide solution and 40 μL of perchloric acid, place it at 80 °C for 40 min, and gently shake and mix it every 10 min. c) After natural cooling, add 400 μL of 2 M NaOH solution and 70 μL of freshly prepared 0.5 M hydroxylamine hydrochloride. After shaking and mixing, take 10 μL and add it to 0.99 mL of glacial acetic acid, and mix it by inverting up and down. d) Take 200 μL of the sample and add it to the well of the microplate reader. Put it into the microplate reader, set the absorption wavelength of light to 280 nm, and detect the absorbance value. The absorbance value without adding the sample is recorded as ACK as the blank control, and the absorbance value of the added sample is recorded as ASPL. ΔA = ASPL - ACK. e) Calculate the lignin content (Acetyl Bromide Soluble Lignin (ABSLmg / g)) according to the formula: Lignin content (mg / g) = 0.0735 × (ΔA - 0.0068) / W × 100, where: W is the sample mass (g), and 100 is the dilution factor.

[0073] The method of lignin staining is as follows: 1) Select the middle part of the first internode of the stem of the control group ND101, mutants, and overexpression materials that have grown for 42 days. The size of the material is about 5 mm thick, and place it in a centrifuge tube containing FAA, evacuate for 1 h, and fix at 4 °C for 24 h. 2) Embed the material with 5% low melting point agarose, and it can be stored in the refrigerator for two weeks. 3) Use a microtome to slice the agarose-embedded sample, with a thickness of 40 - 100 μm, place it in deionized water to separate the sample from the agarose, and pick up the sample from the water with a brush and place it in deionized water.

[0074] 4) Pick up the complete slice material and place it on a glass slide. Unfold the material completely, suck off the excess moisture, add 5% phloroglucinol and stain for 2 min. Then add an equal volume of concentrated hydrochloric acid again and wait for 2 min. Add 40% glycerol, cover with a cover slip, and observe and take pictures using a microscope (Olympus BX51) equipped with a color CCD (the lens used in this experiment is 10×, 0.3 NA).

[0075] The results are as Figure 6 shown. The lignin content in the stems of each overexpressing transgenic line ZmPER64 OE1 ( P <0.05)、 ZmPER64 OE2 ( P <0.05) is higher than that of the control inbred line ND101.

[0076] SEQ ID NO:1 (PRT Zea mays) MAAAPPAAEAALLLLLALLALAAVALRRGDALSLDLYDVTCPEVEAAVTAAVRQAMANDRTVAAGLLRMHFHDCFVRGCDGSVLLDSTATVTAEKDGPPNASLHAFYVIDNAKRAVEALCPGVVSCADILALAARDAVALSGGPWWVVPVGRRDGRVSLANETTAALPGPTASFDQLKQAFHGRGLSTKDLVALSGAHTLGFAHCSSFQNRILRAQQGVAAADDPSLSPSFAAALRRACPANNTVRAAGSALDATSAAFDNTYYRMLQAGRGLLSSDEALLTHPKTRAFVALYAASQEAFFRAFTKSMLRMAGLNGGQEVRANCRRVNPS*.

[0077] SEQ ID NO:2 (DNA Zea mays) 5'-ATGGCGGCGGCGCCTCCTGCCGCAGAGGCAGCTCTTCTTCTCCTCCTAGCATTACTGGCACTCGCCGCGGTGGCTCTGAGACGCGGCGATGCGCTGAGCCTGGATTTGTACGACGTGACCTGCCCGGAGGTGGAGGCGGCGGTGACGGCGGCCGTGCGGCAGGCCATGGCCAACGACCGCACAGTGGCGGCCGGACTCCTCCGAATGCATTTCCACGACTGCTTCGTGAGGGGCTGCGACGGCTCCGTTCTCCTGGACTCCACGGCCACCGTGACGGCGGAGAAGGACGGCCCGCCCAACGCGTCGCTGCACGCCTTCTACGTCATCGACAACGCCAAGCGTGCCGTGGAGGCCCTCTGCCCCGGCGTCGTCTCCTGCGCCGACATCCTCGCCCTCGCCGCAAGGGACGCCGTCGCGCTGTCCGGTGGTCCGTGGTGGGTGGTGCCCGTGGGGCGGCGGGACGGGCGCGTGTCCCTGGCCAACGAGACCACGGCGGCGCTGCCGGGGCCGACGGCCAGCTTCGACCAGCTGAAGCAGGCGTTCCACGGCCGCGGGCTGTCCACCAAGGACCTGGTGGCGCTGTCGGGCGCCCACACGCTGGGCTTCGCGCACTGCTCCTCCTTCCAGAACCGCATCCTCCGAGCCCAGCAGGGCGTCGCCGCCGCCGACGACCCTTCCCTCAGCCCCTCCTTCGCCGCCGCCCTTCGCCGTGCGTGCCCCGCCAACAACACCGTCCGCGCCGCCGGCTCCGCCCTGGACGCCACCTCCGCGGCCTTCGACAACACCTACTACCGGATGCTGCAGGCCGGCCGGGGCCTGCTCTCCTCCGACGAGGCGCTGCTCACGCACCCCAAGACGCGCGCCTTTGTCGCGCTCTACGCCGCGTCGCAGGAGGCATTCTTCAGGGCCTTTACAAAATCCATGCTGCGGATGGCCGGCCTCAACGGAGGCCAAGAGGTGCGAGCCAACTGCAGGCGAGTTAACCCATCATGA-3'.

[0078] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In general, according to the principle of the present invention, this application is intended to cover any modifications, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that depart from the scope disclosed in this application.

Claims

1. A method for increasing the diameter, strength or / and lignin content of plant stalks, characterized in that, The method includes increasing the stem diameter, stem strength, and / or lignin content of a target plant by expressing a gene encoding a protein or a substance that upregulates or increases the expression of the gene in the target plant; The protein is any of the following: A1) A protein with an amino acid sequence of SEQ ID NO: 1; A2) A protein derived from A1) or having more than 80% identity with the protein shown in A1), which has the same function and is obtained by substitution and / or deletion and / or addition of amino acid residues to the amino acid sequence shown in SEQ ID NO: 1; A3) A fusion protein with the same function obtained by fusing a tag protein to the N-terminus and / or C-terminus of A1) or A2).

2. The method according to claim 1, wherein The substance is any of the following: B1), A nucleic acid molecule encoding the protein described in claim 1; B2), An expression cassette containing the nucleic acid molecule described in B1); B3), A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2).

3. The method according to claim 1 or 2, characterized in that The plant is any of the following: M1) A dicotyledonous plant or a monocotyledonous plant; M2) A plant of the order Poales; M3) A plant of the family Poaceae; M4) A plant of the genus Zea; M5) Maize.

4. Application, characterized in that, Use of the encoding gene of the protein described in claim 1 or a substance that upregulates or increases the expression of the encoding gene in any of the following, M1) Increasing the stem diameter of a plant; M2) Preparing a product for increasing the stem diameter of a plant; M3) Cultivating a plant with an increased stem diameter; M4) Increasing the stem strength of a plant; M5) Preparing a product for increasing the stem strength of a plant; M6) Cultivating a plant with an increased stem strength; M7) Increasing the lignin content of the stem of a plant; M8) Preparing a product for increasing the lignin content of the stem of a plant; M9) Cultivating a plant with an increased lignin content in the stem; M10) Plant breeding.

5. The application according to claim 4, characterized in that, The substance is any of the following: B1), A nucleic acid molecule encoding the protein described in claim 1; B2), An expression cassette containing the nucleic acid molecule described in B1); B3), A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4), A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6), A transgenic plant tissue containing the nucleic acid molecule described in B1), or a transgenic plant tissue containing the expression cassette described in B2); B7), A transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2).

6. The application according to claim 5, wherein The nucleotide sequence of the nucleic acid molecule described in B1) is SEQ ID NO:

2.

7. The application according to claim 6, characterized in that, The plant is any of the following: M1) A dicotyledonous plant or a monocotyledonous plant; M2) A plant of the order Poales; M3) A plant of the family Poaceae; M4) A plant of the genus Zea; M5) Maize.

8. Use of a biological material related to the protein described in claim 1, characterized in that, The use is any of the following: M1) Increasing the stem diameter of a plant; M2) Preparing a product for increasing the stem diameter of a plant; M3) Cultivating a plant with an increased stem diameter; M4) Increasing the stem strength of a plant; M5) Preparing a product for increasing the stem strength of a plant; M6) Cultivating a plant with an increased stem strength; M7) Increasing the lignin content of the stem of a plant; M8) Preparing a product for increasing the lignin content of the stem of a plant; M9) Cultivating a plant with an increased lignin content in the stem; M10) Plant breeding; The biological material is any one of the following: B1), a nucleic acid molecule encoding the protein described in claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6), a transgenic plant tissue containing the nucleic acid molecule described in B1), or a transgenic plant tissue containing the expression cassette described in B2); B7), a transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2).

9. The application according to claim 8, wherein The nucleotide sequence of the nucleic acid molecule in B1) is SEQ ID NO:

2.

10. The application according to claim 8 or 9, characterized in that, The plant is any one of the following: M1) Dicotyledonous plants or monocotyledonous plants; M2) Plants of the order Poales; M3) Gramineous plants; M4) Plants of the genus Zea; M5) Maize.

Images