Gene ZmEnd1 for regulating and controlling starch content of plant and application of gene ZmEnd1
By mining and verifying the ZmEnd1 gene, the expression of UDPase is increased to promote G-1-P synthesis, which solves the problem of insufficient regulation of corn starch content and achieves the increase in starch content and yield of corn and rice grains.
Patent Information
- Application Number
- CN202510707402.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-29
- Publication Date
- 2025-07-25
AI Technical Summary
In the prior art, there is insufficient research on the regulation gene for corn starch content, which affects the economic value and yield of corn.
ZmEnd1, a key gene that regulates corn starch content, was mined and verified, and the synthesis of G-1-P was promoted by increasing the expression of UDPase, thereby improving grain starch accumulation.
The starch content and yield of grains have been significantly improved in corn and rice, providing new strategies for crop genetic improvement, and enhancing the economic and nutritional value of the crop.
Smart Images

Figure CN120366335A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to a gene ZmEnd1 for regulating plant starch content and its application. Background Art
[0002] Maize (Zea mays L.) is one of the most important food crops, and is also an essential feed source and industrial raw material. As the most important harvested organ of the maize plant, the starch content in the grain usually accounts for more than 70% of the dry weight, which is the most important energy storage form in the grain. In cereals such as maize and rice, the starch content not only determines the weight and volume of the grain, but also affects the processing performance and the quality of the final product. Therefore, increasing the grain starch content is of great significance for improving the economic value and nutritional value of crops.
[0003] In recent years, the development of molecular biology techniques has provided a powerful tool for revealing the functions of crop genes. Research has shown that many genes are involved in the process of starch synthesis and metabolism. For example, in maize, some key genes affect the starch content by regulating the expression of enzymes such as starch branching enzyme and starch synthase. However, there are still deficiencies in the current research on genes regulating maize starch content.
[0004] The quality characteristics and yield of starch directly affect the economic value and production efficiency of maize. Therefore, mining genes related to regulating grain starch content and deeply analyzing the molecular mechanism of starch synthesis and accumulation have important theoretical and practical significance for increasing maize yield and improving grain quality. The present invention aims to mine new genes related to regulating maize grain starch content through genome-wide association study (GWAS), so as to provide a new strategy for the genetic improvement of crops. Summary of the Invention
[0005] The object of the present invention is to provide a gene ZmEnd1 for regulating plant starch content and its application to solve the problems existing in the above-mentioned prior art. The gene ZmEnd1 can promote the synthesis of G-1-P by increasing the expression level of UDP-glucose pyrophosphorylase (UDPase) in the starch synthesis pathway, thereby increasing the accumulation of grain starch.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides a gene ZmEnd1 for regulating plant starch content, and the nucleotide sequence of the gene ZmEnd1 is as shown in SEQ ID NO.1.
[0008] Furthermore, by upregulating the expression level of the gene ZmEnd1, the starch content of plant grains can be increased.
[0009] The present invention also provides a recombinant expression vector, comprising the above-mentioned gene ZmEnd1.
[0010] The present invention also provides a recombinant host cell, comprising the above-mentioned recombinant expression vector.
[0011] The present invention also provides the use of the above-mentioned gene ZmEnd1, recombinant expression vector or recombinant host cell in increasing the starch content in plant grains.
[0012] The present invention also provides the use of the above-mentioned gene ZmEnd1, recombinant expression vector or recombinant host cell in increasing the glucose-1-phosphate content in plant grains.
[0013] Furthermore, the plant is maize or rice.
[0014] The present invention also provides a method for increasing the starch content in plant grains, comprising the step of genetically transforming the above-mentioned gene ZmEnd1 into a plant to construct a transgenic plant overexpressing the gene ZmEnd1.
[0015] The present invention also provides a method for increasing the yield of plant grains, comprising the step of genetically transforming the above-mentioned gene ZmEnd1 into a plant to construct a transgenic plant overexpressing the gene ZmEnd1.
[0016] Furthermore, the plant is maize or rice.
[0017] The present invention discloses the following technical effects:
[0018] The present invention has for the first time discovered a key gene regulating the starch content in maize - ZmEnd1. Research shows that this gene is involved in the starch synthesis pathway in maize, and can promote the synthesis of G-1-P by increasing the expression level of UDPase in the starch synthesis pathway, thereby increasing the starch accumulation in grains. Further experiments show that after overexpressing the ZmEnd1 gene in rice, the starch content and yield data in grains can be significantly increased.
[0019] By deeply studying the function of the ZmEnd1 gene in maize and successfully applying it to rice, the present invention has achieved a double increase in the starch content and yield in grains. This achievement not only provides a new strategy for the genetic improvement of maize and rice, but also lays a foundation for the research and application of functional genes in other crops. Through the research on the ZmEnd1 gene, the present invention reveals its important role in starch synthesis and verifies its potential in improving crop yield and quality through cross-species gene expression. This technical achievement is expected to promote the development of crop breeding technology and provide technical support for ensuring food security. Brief Description of the Drawings
[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0021] Figure 1 Results graph for detecting significant SNPs controlling grain starch content in four environments and BLUP; among them, (a) is the Manhattan plot of SNPs significantly associated with grain starch content, and the position of the red box is the locus co-localized in four environments and BLUP; (b) is the Q-Q plot of SNPs significantly associated with grain starch content; 2020XSBN, 2021CZ, 2021YA, and 2021XSBN represent Xishuangbanna Dai Autonomous Prefecture, Yunnan Province in 2020, Chongzhou City, Sichuan Province in 2021, Ya'an City, Sichuan Province in 2021, and Xishuangbanna Dai Autonomous Prefecture, Yunnan Province in 2021 respectively; (c) is the expression pattern graph of candidate genes in different tissues;
[0022] Figure 2 Results for detecting the subcellular localization of the ZmEnd1 gene in tobacco leaves; among them, (a) is the schematic diagram of the pCAMBIA1305-35S-eGFP and pCAMBIA1305-35S-eGFP-ZmEnd1 vectors; (b) is the subcellular localization of the ZmEnd1 gene in tobacco leaves; the scale bar is 30 μm; (c) is the fluorescence detection result of ZmEnd1 in the chloroplast channel, scale bar = 30 μm;
[0023] Figure 3 Results of detecting the maize yield traits of the ZmEnd1 mutant and the B73 inbred line; among them, (a) is the comparison graph of phenotypic traits; (b)-(g) are the statistical graphs of ear length, 100-grain weight, grain length, grain width, ear diameter, and grain thickness respectively; ***, **, and * represent significant differences at the P<0.001, P<0.01, and P<0.05 levels respectively, and ns indicates no significant difference;
[0024] Figure 4 Statistical graph of the content of inclusions in maize grains; among them, (a)-(d) are the statistical graphs of the contents of UDP-glucose, starch, glucose-1-P, and trehalose-6-phosphate respectively;
[0025] Figure 5 Results graph of scanning electron microscopy observation of maize grains of the ZmEnd1 mutant and the B73 inbred line; among them, (a) is the scanning electron micrograph of maize grains at different stages; (b)-(d) are the statistical graphs of the starch granule diameters at 15DAP, 20DAP, and 25DAP respectively;
[0026] Figure 6 Phenotype identification results of heterologous expression of ZmEnd1 gene in rice; among them, (a) is a comparison chart of yield traits of heterologous expression of ZmEnd1 in rice; Nip, wild-type rice Nipponbare; (b) is the semi-quantitative analysis result of ZmEnd1 in transgenic grains; (c) is the thousand-grain weight detection results of ZmEnd1 overexpression lines in rice and wild-type Nipponbare; (d) is the detection results of grain starch content of ZmEnd1 overexpression lines in rice and wild-type Nipponbare; (e) is the detection results of grain glucose-1-phosphate content of ZmEnd1 overexpression lines in rice and wild-type Nipponbare; ***, ** and * represent significant differences at P<0.001, P<0.01 and P<0.05, respectively. Detailed implementation manners
[0027] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics and implementation manners of the present invention.
[0028] It should be understood that the terms used in the present invention are only for describing particular implementation manners and are not intended to limit the present invention. In addition, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0029] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0030] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are only exemplary.
[0031] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.
[0032] Example 1
[0033] I. Experimental methods
[0034] 1. Mining genetic loci regulating maize grain starch content using GWAS
[0035] The linkage populations were separately planted in Xishuangbanna Dai Autonomous Prefecture, Yunnan Province (22.02°N, 100.80°E) (2020 XSBN), Chongzhou City, Sichuan Province (30.32°N, 103.38°E) (2021 CZ), Ya'an City, Sichuan Province (9.59°N, 102.57°E) (2021 YA), and Xishuangbanna Dai Autonomous Prefecture, Yunnan Province (22.02°N, 100.80°E) (2021 XSBN). A completely randomized block design was adopted, with a row length of 3 m, a row spacing of 0.7 m, and 12 plants planted in each row. Five ears with consistent growth vigor were taken from each material of the population, and the grains in the middle part of the ears were dried at 60 °C for 2 d. The data of grain starch content was collected using the DA7250 near-infrared spectroscopy analyzer of Bühler, with three technical replicates. Combining with the high-density genotypes containing 969,439 SNP loci already available in the inventor's research group, the FarmCPU model in the R software package rMVP in R studio was used for GWAS analysis. The significant threshold of GWAS was set as P = 0.05 / the number of effective markers, that is, P = 1E -06 .
[0036] 2. Identifying key genes and their significant variant loci for grain starch content using candidate gene association analysis
[0037] By comparing the stable SNPs (SNP-4-245041154) jointly detected under the four environments and BLUP of GWAS. A total of 8 candidate genes were identified within the LD (= 50 Kb) segment of this SNP. Analysis of different tissue expression patterns showed that Zm00001d054004 (named ZmEnd1) was significantly highly expressed in the grain endosperm.
[0038] The nucleotide sequence of the ZmEnd1 gene is shown in SEQ ID NO.1.
[0039] SEQ ID NO.1
[0040] ATGGTCATGGAGACCGGAGACCCCGGGAAGCTGTTGCGCGGGCATTCCCTCTCTCGTGTTCCTCCCGCTTCCCCTTTCCCTCGGCTCAGGCCTCAGGGAGATTTGGTTAGGGCAGGGGACGAACGAGCGCGGGCGTCAGGTATGCCGGGAGAGGAGGACGTCCGCAAGGTCTCGCGCGAGGACATACAGCTTGTCCAGAACCTCATCGAGCGTTGCCTTCAGCTATATATGAACCAGAAAGAAGTGGTGGACACCCTATCTTTCCAGGCAAAAATAGAACCTAGTTTCACTGAGATCGTCTGGCAGAGACTCGAGGAAGAGAACCGTGATTTTTTTAAGGCATACTATGCGAGGCTGATGCTTATGAATCAAATAGTGTCCTTCAATAAGCTTCTTGAGCAGCAGCATCAGATTATGAATAAAGATCATCATTATGGGATGCCTGCTATGCCTTCTACTGCTCCTAATGGCTCAAACACTAACATGTTGAACCAAGCCATGCCATTTCTGCCAGACACTATCCCCAGTACTGCAATGCAAGATAACTTGTTGAGTAATGGAGGTTCTAGTAGTATAGTAAATGGTGCTCCATCCAATGACCAGTGTAGCTATTCTGGTAAAGTTGCTCATGGCCTTCCTGGTGTCATGGATGCTTCATCAAGCCTTCTAGCAGCACACAAATCGACAGTTGGGCAGTTTAATGGACACAATGGAACAACGACAAAGACAGAGTCTGACTACTCAAGCAACTCAGATTTTGGATTAGGCAATGAGACCGTGTTCCTGGAGCAGTCATTTGGAGATATATCAGGTGGATCGTTTAGCAGCTCTGAGTTGAATGGACAACCAGTAGGTTCATCTTCGTATGGTTTCTTGAGCCAGATTCCTTGTAATTTCAGCCTTTCGGATTGGACAGATTGTTTCAGCCAAAGCTCAGAAATTTTTGAGAATTACGGTGGGTCCCCTTTCATCCCTTACGATGCAAATAACATCCCAGAGTCTAGCGCTCGAGAAAATACAGGTTGA.
[0041] 3. Analysis of the spatio-temporal expression pattern and subcellular localization of ZmEnd1
[0042] Analysis of the expression pattern in different tissue parts: To further explore the expression of ZmEnd1 in various tissue parts of maize, the present invention collected 3 biological replicates each of roots, stems, leaves, female inflorescences, male inflorescences and grain samples from 8 DAP to 21 DAP of maize inbred line B73 at the filling stage, extracted RNA and reverse-transcribed it, and performed qRT-PCR analysis. The primers are shown in Table 1 for details. The ZmActin1 gene was used as an internal reference, and the relative expression level of the target gene was calculated using the 2 -ΔΔCT method.
[0043] Subcellular localization: To verify the subcellular localization of the ZmEnd1 gene, the present invention cloned the ZmEnd1 gene into the pCAMBIA2300-eGFP vector to generate a p35S:ZmEnd1-eGFP fusion expression vector. The primers are shown in Table 1 for details. Then the fusion expression vector was transformed into the Agrobacterium strain GV3101, and when the bacterial liquid was cultured to OD 600 = 0.8, it was prepared into an Agrobacterium suspension and injected into tobacco leaves for transient expression. The p35S:eGFP vector was used as a negative control. After culturing for 48 h, the eGFP fluorescence signal in tobacco leaves was detected using a confocal fluorescence microscope (Zeiss LSM 800, Baden-Württemberg, Germany).
[0044] Table 1 Primer table for vector construction
[0045]
[0046]
[0047] 4. Creation of genetic materials of ZmEnd1
[0048] Two EMS premature termination mutants of the maize ZmEnd1 gene in this invention are derived from the Maize EMS Mutant Website (http: / / www.elabcaas.cn / memd / public / index.html), with the B73 inbred line as the wild type. The DNA of the mutant lines was extracted using the improved SLS method. Specific detection primers were designed according to the position of the mutation site. Using the mutant DNA as a template, the fragment containing the mutation site was amplified, and sequencing was performed to detect whether it was positive homozygous. See Table 1 for the detection primers.
[0049] 5. Determination of the starch content in ZmEnd1 mutant grains
[0050] The starch content in ZmEnd1 mutants and wild-type grains was determined using the K-TSTA Total Starch Assay Kit from Megazyme; 5 seeds were randomly selected and weighed. Sample pretreatment: The selected seeds were ground using a ball mill at 60 Hz for 60 s and passed through a 100-mesh sieve. Five groups of 100 mg of the ground samples (accurately weighed) were taken from each sample and placed into 2 mL centrifuge tubes. 0.2 mL of 80% (v / v) ethanol aqueous solution was added, and the samples were thoroughly mixed on a vortex mixer to disperse the samples. Subsequently, 2 mL of dimethyl sulfoxide (DMSO) was immediately added to the centrifuge tubes, and the mixture was mixed again on the vortex mixer. Preliminary incubation and enzymatic hydrolysis: The centrifuge tubes were placed in a boiling water bath for 5 min. After removal, 3 mL of heat-stable α-amylase (diluted 30-fold using 50 mM MOPS buffer, pH 7.0, containing 5 mM calcium chloride) was immediately added to the centrifuge tubes and mixed on a vortex mixer for 20 s. The centrifuge tubes were returned to the boiling water bath and incubated for an additional 6 min, during which vortexing was performed at the 2nd, 4th, and 6th minutes to ensure uniformity. Further enzymatic hydrolysis and transfer: The centrifuge tubes were transferred to a 50 °C water bath, 4 mL of 200 mM sodium acetate buffer (pH 4.5) containing 5 mM calcium chloride was added, and 0.1 mL of amyloglucosidase (AMG, concentration 3,300 U / mL) was added. The contents of the centrifuge tubes were stirred using a vortex mixer and incubated in a 50 °C water bath for 30 min. Volume fixation, centrifugation, and absorbance measurement: All reaction solutions were transferred to a 100 mL volumetric flask (a funnel could be used for assistance), and the residues in the centrifuge tubes were rinsed. The solution was fixed to the scale using 200 mM sodium acetate buffer (pH 4.5) containing 5 mM calcium chloride and shaken well. 2.0 mL was taken from each sample solution and transferred to a microcentrifuge tube, and centrifuged at 13,000 rpm for 5 min. Two replicates were prepared for each sample. Exactly 0.1 mL of the supernatant was pipetted to the bottom of a 16×120 mm glass test tube. 3.0 mL of GOPOD reagent was added to each glass test tube, and the mixture was incubated in a 50 °C water bath for 20 min. Finally, the absorbance was measured at a wavelength of 510 nm, with the reagent blank as a reference.
[0051] Calculation of starch content:
[0052]
[0053] Among them, ΔA refers to the absorbance of the sample solution minus the absorbance of the background blank sample solution; F is the conversion factor for converting the absorbance value to the amount of glucose in μg (100 μg of glucose divided by the absorbance value measured for 100 μg of glucose); EV is the sample extraction volume of 100 mL; 0.1 represents the volume of the sample for analysis; D is the sample solution dilution factor; 1 / 1000 represents the conversion from μg to mg; 100 / W represents the conversion to 100 mg of the sample, where W is the sample weight (mg); 162 / 180 is the conversion coefficient for the final detection of the conversion from free glucose to glucose present in starch.
[0054] 6. Determination of the content of glucose-1-phosphate (G-1-P) in ZmEnd1 mutant grains
[0055] The content of glucose-1-phosphate in grains was determined using a kit from Shanghai Tongwei Biotechnology Co., Ltd. The specific steps are as follows: Weigh 5 groups of 0.1 g of grain powder for each sample, add 1 mL of extraction solution, and homogenize in an ice bath. Centrifuge at 12000 rpm and 4 °C for 10 min, take the supernatant, and add the corresponding reagents (Table 2) to the 96-well plate in sequence:
[0056] Table 2 Glucose-1-phosphate determination mixed system
[0057]
[0058] Result calculation: 1PG / G1P content (μg / g) = 836 × ΔA ÷ W × D, where D is the dilution factor, which is 1 if not diluted, and W is the sample mass.
[0059] 7. Determination of the content of uridine diphosphate glucose (UDPG) and trehalose-6-phosphate synthase (T-6-P) in ZmEnd1 mutant grains
[0060] The ELISA kit of Shanghai Tongwei Biotechnology Co., Ltd. was used to determine the content of UDPG and trehalose-6-phosphate synthase (T-6-P) in corn kernels. The steps were as follows: 0.1 g corn kernel powder was accurately weighed, 1 mL of pre-cooled extract was added for ice bath homogenization, and then centrifuged at 12,000 × g for 10 min at 4 °C, and the supernatant was taken for use. The microplate was taken out from the aluminum foil bag after equilibration at room temperature, and 50 μL of trehalose-6-phosphate and UDPG standard solutions of different concentrations were added to the standard wells in turn, 10 μL of the sample to be tested and 40 μL of sample diluent were added to the sample wells, and no liquid was added to the blank wells. 100 μL of trehalose-6-phosphate and UDPG specific HRP-labeled antibodies were added to all wells except the blank wells, and the plate was sealed and incubated at 37 °C for 60 min. The liquid in the wells was discarded, patted dry with absorbent paper, and then the washing solution was added and allowed to stand for 1 min, and the washing was repeated 5 times. Add 50 μL of substrate A and 50 μL of substrate B to each well, incubate at 37°C in the dark for 15 min, then add 50 μL of stop solution, and immediately measure the OD value at a wavelength of 450 nm using an ELISA reader. Use Excel to draw a linear regression curve between the concentration of the sea standard and the OD value, and calculate the trehalose-6-phosphate and UDP-glucose content in the sample according to the equation.
[0061] 8. Scanning electron microscopy observation of ZmEnd1 mutants
[0062] The ZmEnd1 mutant and wild-type grains at 15DAP, 20DAP, and 25DAP were taken. The complete grains on the ears were removed with a blade and placed in an electron microscope fixative for 24 hours. The fixed grain samples were rinsed with 0.1M phosphate buffer (pH 7.0) three times, each time for 15 minutes. Then, they were immersed in a 1% osmium acid solution (solvent is phosphate buffer) at room temperature for 2 hours, and rinsed again with phosphate buffer for 3 times (15 minutes). They were transferred to a solution containing 30%, 50%, 70%, 80%, and 90% ethanol for gradient dehydration, and treated for 20 minutes respectively. Finally, they were dehydrated twice with anhydrous ethanol (20 minutes). The samples were transferred to a mixture of ethanol and isoamyl acetate in equal proportions for infiltration for 30 minutes, and then treated with pure isoamyl acetate for 20 minutes. After drying in a critical point dryer, they were fixed to the sample stage with conductive glue and treated with gold by an ion sputtering instrument. Finally, the micrographs of starch granules were observed and photographed under a scanning electron microscope (SEM).
[0063] 9. In situ hybridization observation of ZmEnd1 mutant grains
[0064] Sample fixation and dehydration: Select ZmEnd1 mutant and wild-type grains at 15 DAP after pollination. Fix overnight at 4°C using pre-cooled 70% FAA solution. Wash the samples three times with 70% ethanol, 30 min each time, to remove the fixative. Operate on ice and dehydrate the samples stepwise with 30%, 50% (30 min each), 70%, 85%, and 100% ethanol (1 h each). After dehydration, store the samples in absolute ethanol at 4°C overnight. Then infiltrate the samples with xylene-ethanol solutions of different dilutions (25%, 50%, 75%, 100%), 50 - 100 mL for each concentration, for 60 min respectively. Finally, repeat infiltration twice in 100% xylene. Paraffin embedding and sectioning: At 60°C, infiltrate the samples with paraffin / xylene solutions of different dilutions (25%, 50%, 75%, 100%), 50 - 100 mL for each concentration, for 2 h respectively. Incubate the tissues overnight at 60°C with 100% paraffin. To prevent water vapor from infiltrating, ensure that the beaker containing the tissues is well-sealed. Transfer the tissues to a mold, pour in melted paraffin, adjust the tissue position and add more melted paraffin. After cooling, place the mold on ice for 5 - 10 s to make the stainless-steel embedding cassette shrink, then use a spatula to remove the wax block and cut sections with a thickness of 8 - 10 μm using a microtome.
[0065] RNA hybridization and imaging observation: Place the sections in a working solution containing 10 μg / mL proteinase K and digest at room temperature for 10 - 15 min. This step helps improve the probe penetration. Wash the sections twice with PBS, 5 min each time, and then fix with 4% paraformaldehyde solution at room temperature for 10 min to inactivate proteinase K. Cover the sections with pre-hybridization buffer (containing 50% formamide, 10% dextran sulfate, 1×SSC, 0.1% Tween-20, 50 μg / mL heparin, 50 μg / mL yeast tRNA) and incubate at 42°C for 1 h to reduce non-specific binding. Add the labeled RNA probe (usually digoxigenin- or biotin-labeled) to the hybridization buffer to a final concentration of approximately 1 ng / μL. Drop the hybridization solution onto the sections, cover with a coverslip, place in a humid chamber, apply the probe to the tissue sections, and incubate overnight at 50°C. After hybridization, wash the sections with 0.2×SSC and perform RNase treatment. Incubate with anti-digoxigenin antibody at room temperature for 2 h, then wash with a buffer containing 1% bovine serum albumin. Incubate the sections with freshly dissolved NBT / BCIP solution for 12 - 15 h, and then observe by microscopy imaging.
[0066] 10. Heterologous expression of ZmEnd1 gene in rice
[0067] To deeply explore the gene function of ZmEnd1, especially its impact on crop yield components and grain starch synthesis, ZmEnd1 was heterologously expressed in the elite rice inbred line Nipponbare (Nip). Based on the pCUB vector as the backbone, Bar as the selection marker, and BamH1 (GGATCC) as the restriction enzyme site, the complete CDS sequence of ZmEnd1 was cloned onto the vector by homologous recombination to form the pCUB:ZmEnd1 recombinant plasmid. The recombinant plasmid was transferred into Nip by Agrobacterium-mediated transformation, and positive ZmEnd1 overexpression lines were obtained by PCR detection. It was bred to the T2 generation and positive by PCR detection. The expression level of ZmEnd1 in the grains of each transgenic line was detected by semi-quantitative method and phenotypic identification was carried out. The primers for vector construction are shown in Table 1.
[0068] II. Experimental Results
[0069] 1. Identifying the key gene ZmEnd1 controlling maize grain starch content by GWAS
[0070] Using GWAS, a significant SNP marker (SNP-4-245041154, P = 5.45E) controlling maize starch content was jointly identified in four environments (2020 Xishuangbanna Dai Autonomous Prefecture in Yunnan Province (2020XSBN), Chongzhou City in Sichuan Province (2021CZ), Ya'an City in Sichuan Province (2021YA), and Xishuangbanna Dai Autonomous Prefecture in Yunnan Province (2021XSBN)) and BLUP ( -16 )( Figure 1 (a) and (b) in Figure 1 ). Taking the 50Kb range upstream and downstream of it as the candidate gene screening interval, a total of 8 candidate genes were identified. By analyzing the expression patterns of these 8 genes, it was found that Zm00001d054004 was highly expressed in the endosperm (
[0071] (c) in
[0072] ), and it was named ZmEnd1 and further verified. Figure 2 As shown in (a) of Figure 2 , to clarify the expression of ZmEnd1 in subcellular compartments, the present invention constructed a pCAMBIA1305-35S-eGFP-ZmEnd1 fusion expression vector, with the non-fused eGFP expression vector as the negative control. As shown in (b) of Figure 2 , after transforming tobacco leaves and observing under a laser confocal microscope, it was found that the ZmEnd1 protein was specifically expressed in the nucleus and cell membrane. As shown in (c) of , through the detection of chloroplast autofluorescence, it was found that the ZmEnd1 protein was not expressed in chloroplasts. These results indicate that the ZmEnd1 protein is localized in the nucleus and cell membrane.
[0073] 3. Mutation of ZmEnd1 reduces the synthesis of grain starch content
[0074] To explore the effects of the loss of function of the maize ZmEnd1 gene on maize grains, two STOP-GAINED (premature termination) mutants of the ZmEnd1 gene, zmend1-1 and zmend1-2, were constructed using the B73 inbred line as the background. The ear length, ear diameter, 100-grain weight, grain length, and grain width of two EMS mutant lines, zmend1-1, zmend1-2, and the wild-type B73 were measured. The statistical results showed that the 100-grain weight and grain length of mutants zmend1-1 and zmend1-2 were significantly lower than those of the B73 inbred line. At the same time, the ear length and grain thickness were also lower than those of B73; there was no significant difference in grain width and ear diameter between mutants zmend1-1, zmend1-2 and the B73 inbred line ( Figure 3 ).
[0075] In plant storage tissues, UDP-Glc pyrophosphorylase (UGPase) converts UDP-Glc produced by SuSy into glucose-1-P to meet metabolic needs. The contents of uridine diphosphate glucose (UDPG), glucose-1-phosphate (G-1-P), starch, and trehalose-6-phosphate (T-6-P) in the seeds of B73 and zmend1-1, zmend1-2 mutants were determined. The results showed that compared with the wild-type B73, the starch content and G-1-P in the mutants were significantly reduced, while UDPG was significantly increased ( Figure 4 in (a)-(c)); there was no significant difference in trehalose-6-phosphate (T-6-P) compared with the wild-type ( Figure 4 in (d)).
[0076] Collectively, the above results indicate that the ZmEnd1 gene is involved in regulating the biological pathway of maize grain starch synthesis. The loss of function of this gene leads to a weakened reaction of UDPase-catalyzed conversion of UDPG and pyrophosphate into G-1-P and uridine triphosphate (UTP), resulting in the blockage of the synthesis of its downstream product G-1-P and the end product starch. At the same time, the upstream product UDPG accumulates due to the reduced conversion caused by the weakened reaction, resulting in a significantly higher UDPG content in the mutants than in B73. At the same time, it is shown that the mutation of the ZmEnd1 gene does not affect the accumulation and metabolism of intermediate products in other synthesis pathways.
[0077] 4. Scanning electron microscopy observation of ZmEnd1 mutant grains
[0078] The grains of mutants zmend1-1, zmend1-2 and wild type B73 at 15 DAP, 20 DAP, and 25 DAP after pollination were observed by scanning electron microscopy. The results showed that with the progress of grain filling, the number and size of starch granules in B73 grains were significantly higher than those in mutants ( Figure 5 ); at 25 DAP, B73 had presented relatively mature polygonal regular starch granules, and these starch granules were fully filled with the protein protection structure formed by prolamin, while the starch granules in mutants were still in the developing ellipsoidal or irregular polygonal shape, and there were also many voids in their cells. Therefore, it was indicated that the mutation of the ZmEnd1 gene led to the reduction of the volume of maize grain starch granules and accompanied by retarded development.
[0079] 5. Heterologous expression of the ZmEnd1 gene in rice promotes the biosynthesis of grain starch content
[0080] In order to deeply explore the gene function of ZmEnd1, especially its influence on crop yield components and grain starch synthesis, ZmEnd1 was heterologously expressed in the elite rice inbred line Nipponbare. It was bred to the T2 generation and positive was detected by PCR. The expression level of ZmEnd1 in the grains of each transgenic line was detected by semi-quantitative method. As Figure 6 shown in (b) below, the expression level of the ZmEnd1 gene in the transgenic lines was significantly higher than that of the wild type Nip.
[0081] As Figure 6 shown in (c) below, compared with the wild type Nip, the 1000-grain weight of the transgenic lines was significantly higher than that of the wild type; as Figure 6 shown in (a), (d) and (e) below, the starch content and G-1-P content of rice grains were significantly higher than those of the wild type Nip.
[0082] The experimental results showed that the heterologous expression of the ZmEnd1 gene in rice could promote the synthesis of G-1-P by increasing the expression level of UDP-glucose pyrophosphorylase (UDPase) in the starch synthesis pathway, thereby promoting starch accumulation, and finally manifested as an increase in the 1000-grain weight of rice.
[0083] The above-described embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. A gene ZmEnd1 for regulating the starch content in plants, characterized in that, The nucleotide sequence of the gene ZmEnd1 is shown as SEQ ID NO.
1.
2. The gene ZmEnd1 according to claim 1, characterized in that, By upregulating the expression level of the gene ZmEnd1, the starch content of plant grains can be increased.
3. A recombinant expression vector, characterized in that, It includes the gene ZmEnd1 described in claim 1.
4. A recombinant host cell, characterized in that, It includes the recombinant expression vector described in claim 3.
5. Use of the gene ZmEnd1 described in claim 1, the recombinant expression vector described in claim 3, or the recombinant host cell described in claim 4 in increasing the starch content of plant grains.
6. Use of the gene ZmEnd1 described in claim 1, the recombinant expression vector described in claim 3, or the recombinant host cell described in claim 4 in increasing the glucose-1-phosphate content of plant grains.
7. The application according to claim 5 or 6, characterized in that, The plant is maize or rice.
8. A method for increasing the starch content in plant seeds, characterized in that, It includes the step of genetically transforming the gene ZmEnd1 described in claim 1 into a plant to construct a transgenic plant overexpressing the gene ZmEnd1.
9. A method for increasing the grain yield of plants, characterized in that, It includes the step of genetically transforming the gene ZmEnd1 described in claim 1 into a plant to construct a transgenic plant overexpressing the gene ZmEnd1.
10. The method according to claim 8 or 9, characterized in that, The plant is maize or rice.