Gajute glycosyl transferase GaUGT813 gene and application thereof in preparation of gastrodin

Abstract

The invention relates to a gastrodia elata glycosyl transferase GaUGT813 gene and application thereof in preparation of gastrodin, and belongs to the technical field of biology. The nucleotide sequence of the gastrodia elata glycosyl transferase GaUGT813 gene is as shown in SEQ ID NO. 1, and the full length of the sequence is 1494 bp; the amino acid sequence of the encoded protein is as shown in SEQ ID NO.2, and 498 amino acid residues are encoded. The gastrodia elata glycosyl transferase GaUGT813 gene can be used as a biosynthesis regulation gene of gastrodin, is applied to preparation of gastrodin, and is remarkable in application prospect and easy to popularize and apply.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a gastrodia glycosyltransferase GaUGT813 gene and its application in the preparation of gastrodin. Background Art

[0002] Gastrodia elata Blume ( Gastrodia elata Bl . ), also known as Dingfengcao and Chijian, is a perennial parasitic herb of the genus Gastrodia in the family Orchidaceae ( Gastrodia ). It is mainly distributed in sparse forests, open spaces in the forest and the edges of forest-edge shrubs at an altitude of 400-3200 m in Nepal, Bhutan, India, Japan, the Korean Peninsula to Siberia. It is mainly produced in Hunan, Sichuan, Guizhou, Yunnan and Tibet in China. Gastrodia elata has the effects of calming endogenous wind and stopping convulsions, suppressing the hyperactive liver-yang, expelling wind and dredging collaterals, etc., and is often used to treat infantile convulsions, epilepsy convulsions, tetanus, headache and dizziness, flaccidity of hands and feet, numbness of limbs, and rheumatic arthralgia.

[0003] Gastrodin (GAS) is one of the main active ingredients of Gastrodia elata, also known as gastrodioside, chemical name: 4-hydroxymethylphenyl- β -D-glucopyranoside, which is a phenolic glycoside with the molecular formula: C 13 H 18 O7 and molecular weight: 286.28 kDa. Gastrodin has long had analgesic and hypnotic effects in clinical practice in China, and no obvious side effects have been seen. It is a drug for the central nervous system. It is mainly used for sedation, hypnosis and analgesia. Gastrodin can inhibit the cell death and apoptosis induced by excitatory amino acids, has the ability to scavenge free radicals, can counteract the damage of free radicals to PC12 cells, and has a neuroprotective effect. Gastrodin has obvious effects in the treatment of sclerosis, presumably related to promoting angiogenesis. Gastrodin has a good therapeutic effect on patients with functional dyspepsia accompanied by anxiety and depression symptoms, and can dilate blood vessels and reduce the pharmacological effects of the central nervous system such as hypertensive heart disease and fibrosis. Gastrodin enhances spinal synapses and inhibits inflammatory pain. In addition, some studies have also found that gastrodin has a variety of biological effects such as anti-obesity, anti-inflammatory, memory improvement and acetylcholinesterase inhibitor.

[0004] The main methods for obtaining gastrodin in the early stage were direct extraction from Gastrodia elata tubers or chemical processing. However, the chemical synthesis of gastrodin is energy-consuming and environmentally unfriendly; the artificial cultivation and extraction method has problems such as the inability to guarantee the quality of Gastrodia elata, a long cultivation cycle of Gastrodia elata, and difficulty in extracting high-purity gastrodin. Therefore, the biosynthesis of gastrodin has attracted more and more attention in recent years. The biosynthesis of gastrodin uses 4-hydroxymethyl-phenol (HBA) as a substrate and uridine diphosphate glucose (UDP-glucose) as a glycosyl donor. Under the catalysis of glycosyltransferase, glycosylation occurs at the C hydroxyl group at the -4 position of 4-hydroxymethyl-phenol to generate gastrodin.

[0005] In recent years, with the rapid development of the field of synthetic biology, using synthetic biology technology to produce natural medicine monomers can effectively solve the above problems. However, to clarify the biosynthetic pathways of these active ingredients, it is necessary to identify the key genes related to these pathways, and exploring these catalytic enzyme genes has become a key link in studying the biosynthetic pathways of plant metabolites. Currently, the synthetic pathway for catalyzing the glycosylation reaction of 4-hydroxymethyl-phenol at the C hydroxyl group at the -4 position to form gastrodin is clear, but the functions of the glycosyltransferases responsible for glycosylation mined in Gastrodia elata have been less verified, which has affected the progress of gastrodin biosynthesis work. Summary of the Invention

[0006] To solve the above problems, the present invention provides a Gastrodia elata glycosyltransferase GaUGT813 gene, which can be used as a biosynthetic regulatory gene for gastrodin.

[0007] To achieve the above object, the technical solution adopted by the present invention is: The first aspect of the present invention provides a Gastrodia elata glycosyltransferase GaUGT813 gene, and the Gastrodia elata glycosyltransferase GaUGT813 In the second aspect of the present invention, there is provided the above gastrodia glycosyltransferase GaUGT813 protein encoded by the gene. The amino acid sequence of the protein is as follows SEQ ID NO.2, encoding 498 amino acid residues.

[0008] MPNQSPLDVSSGHNNADPNPNSNPKHFILIPFMAQGHMIPMVDIARLLAAAGSLVTLITTPVNAARIRPTIVRIQNSGLPIRFIELPFPSSDAGLPSGCENLDLIPSPDLFKPFVEALPLFGERVKLYLKEEAAPVNCIVFDSLNSWVALMAKSLGIPHVLFHGPSCFYILCSFLLTKHQLLKGTDDDCKLFRVPELPEPVEVIMAQVGSWLDRPGWEKIKSDYVASEKSAYGVVLNTFEELEMMDLEKYRVETGKKVWPIGPLSLSNSDVDSKAMRGKVSSIDTELLLSWLDSKPASSVMFVSFGSLVRNSLSQLLEIGQGLESASPSFIWVVKEEESCPKADAWLSEFEERTLGKGLLIRGWAPQAIILSHAAVGGFMTHCGWNSTLEAVAAGVVMVTWPRFSDQFLNERLVIDVLRVGVVVGKNVPTFLASSMSENALVKGEEVRTAVEKVMDGGTEGEERRKRAKEFGEKAKRAMEDGGSSFQNLREMIRFVKN; (SEQ ID NO.2) In the third aspect of the present invention, there is provided a recombinant plasmid containing the above gastrodia glycosyltransferase GaUGT813 gene.

[0009] Preferably, the recombinant plasmid is obtained by homologous recombination of the above gastrodia glycosyltransferase GaUGT813 gene and the pET28a vector, and is named pET28a- GaUGT813 .

[0010] In the fourth aspect of the present invention, there is provided a genetically engineered bacterium containing the above recombinant plasmid, or, the genome of the genetically engineered bacterium integrates an exogenous above gastrodia glycosyltransferase GaUGT813 gene.

[0011] Preferably, the genetically engineered bacterium is Escherichia coli BL21 (DE3) strain.

[0012] The fifth aspect of the present invention provides the above-mentioned gastrodia glycosyltransferase GaUGT813 gene for use in the preparation of gastrodin.

[0013] Preferably, using 4-hydroxybenzyl alcohol and the glycosyl donor UDP-glucose as raw materials, under the catalysis of the gastrodia glycosyltransferase GaUGT813 encoded by the gene, glycosylation occurs at the hydroxyl group at the -4 position of 4-hydroxybenzyl alcohol to produce gastrodin. C -4 position of the hydroxyl group to generate gastrodin.

[0014] In the present invention, through a recombinant plasmid, the target protein is obtained after in vitro expression, and further catalysis of the substrate 4-hydroxybenzyl alcohol directly generates gastrodin.

[0015] The glycosyltransferase GaUGT813 gene of the present invention was identified through transcriptome sequencing and bioinformatics techniques from the tubers of Gastrodia elata after a large number of experiments; RNA of Gastrodia elata tubers was used with RNA reagents, reverse transcribed into cDNA, and then amplified by PCR. The amplification primers for the glycosyltransferase GaUGT813 gene are as follows: F: ATGCCCAACCAAAGCCC; (SEQ ID NO.3) R: TTAGTTTTTGACAAATCGTATCATC; (SEQ ID NO.4) In addition, when performing homologous recombination with the vector pET28a, GaUGT813 the gene needs to be amplified and recovered using primers with homologous arms. The primers with homologous arms are as follows: F: gtggacagcaaatgggtcgcggatccATGCCCAACCAAAGCCC; (SEQ ID NO.5) R: tgtcgacggagctcgaattcggatccTTAGTTTTTGACAAATCGTATCATC. (SEQ ID NO.6) The glycosyltransferase GaUGT813 gene isolated and identified from Gastrodia elata can be used as an important marker gene for molecular assisted breeding of Gastrodia elata, and can also be used as an important candidate gene for the production of gastrodin in the construction of yeast chassis cells.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) The present invention provides the gastrodia glycosyltransferase GaUGT813 gene, which can be used as a gene for regulating the biosynthesis of gastrodin and applied to the preparation of gastrodin.

[0017] (2) With the rapid development of bioinformatics technology, the excavation of key enzyme genes in the biosynthesis pathway of gastrodin has been greatly promoted. The biosynthesis regulatory gene of gastrodin in the present invention, namely gastrodia glycosyltransferase GaUGT813 gene, was identified and successfully verified for the first time, opening up a new method for the biosynthesis of gastrodin. The present invention obtains the target product by means of enzymatic catalysis in vitro through heterologous expression of proteins in Escherichia coli, adopts in vitro biosynthesis for directional production, and has the advantages of few by-products.

[0018] (3) The present invention also provides a recombinant plasmid, a genetically engineered bacterium and a recombinant protein containing the glycosyltransferase GaUGT813 gene, laying a foundation for the large-scale synthesis of gastrodin by bioengineering methods and further for the research on constructing a cell factory for producing gastrodin.

[0019] (4) By in vitro biosynthesis of gastrodin, the controllability is strong, the demand for raw material planting can be reduced, the production product is single, which is convenient for the separation and purification of gastrodin in the later stage, and can also reduce problems such as difficulties in chemical synthesis and complex synthesis pathways. The gastrodia glycosyltransferase GaUGT813 gene, as a key gene for the biosynthesis of gastrodin, can also be used for the breeding research of plants rich in gastrodin such as Mirabilis jalapa. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Schematic diagram of the deduced synthesis pathway for gastrodin; Figure 2 Schematic diagram of the construction of the recombinant expression plasmid pET28a-GaUGT813; Figure 3 Electrophoresis detection result after recombination of GaUGT813; Figure 4 SDS-PAGE protein electrophoresis diagram of GaUGT813. Among them, M is the protein molecular weight standard; Figure 5 HPLC detection of the glycosylation of p-hydroxybenzyl alcohol by glycosyltransferase GaUGT813 . The abscissa is time, in minutes, and the ordinate is the response value, in mAU; among them, CK: control group (p-hydroxybenzyl alcohol + uridine diphosphate glucose + inactivated gastrodia glycosyltransferase GaUGT813 ) enzyme inactivation enzyme activity reaction result; standard: p-hydroxybenzyl alcohol standard + gastrodin standard; GaUGT813 : experimental group (p-hydroxybenzyl alcohol + uridine diphosphate glucose + gastrodia glycosyltransferase GaUGT813 ) enzyme activity reaction result; Figure 6It is a mass spectrometry (LC / MS / MS) spectrum. Among them, A is the retention time of the standard gastrodin, which is 17.96 minutes; B is the retention time of the reaction product gastrodin, which is 17.70 minutes; Figure 7 It is the fragment ion diagram of the standard gastrodin (theoretical molecular weight 331) (LC / MS / MS); Figure 8 It is the fragment ion diagram of the reaction product gastrodin (theoretical molecular weight 331) (LC / MS / MS). Detailed implementation manners

[0021] The present invention will be further described in detail below in conjunction with the embodiments.

[0022] Those skilled in the art will understand that the following embodiments are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. For those not specified in the embodiments regarding specific technologies or conditions, they shall be carried out according to the technologies or conditions described in the literature in this field or according to the product specifications. For those materials or equipment whose manufacturers are not specified, they are all conventional products that can be obtained by purchase. Embodiment 1

[0023] Based on the basic functional annotation information of Gastrodia elata transcriptome Unigene, UGT candidate genes were screened in the sequencing annotation results. At the same time, glycosyltransferases (UGTs) identified in plants were analyzed by local BLAST analysis of sequences, and then the screening results were sorted out and analyzed. Finally, 1 glycosyltransferase (UGT) gene was found. After a series of work such as cDNA preparation, amplification and recovery of candidate genes, homologous recombination, protein expression, in vitro enzyme activity reaction, and HPLC and LC / MS detection, the target candidate gene that can catalyze the glycosylation of the hydroxyl group at the C-4 position of 4-Hydroxybenzyl alcohol was finally identified GaUGT813 ( Figure 1 ). The operation steps of each stage of gastrodin synthesis are as follows (all reagents, raw materials, instrument equipment, etc. used in the following embodiments are commercially available): (1) Preparation of cDNA template Take fresh samples of Gastrodia elata tubers, quick-freeze them in liquid nitrogen after slicing, and extract RNA. The RNA extraction uses the HiPure Plant RNA Mini Kit of Magen (Guangzhou Meiji Biotechnology Co., Ltd.). Extract RNA according to the operation steps of the kit. After passing the detection, use the TAKARA reverse transcription kit to reverse transcribe RNA into cDNA and store it at -20 °C for standby.

[0024] (2) Gene amplification and recovery Design specific primers for the candidate gene using SnapGene software and entrust Beijing Tsingke Biotechnology Co., Ltd. Kunming Branch to synthesize them. Use 2×Phanta Max Master Mix polymerase to amplify the target gene. The reaction system and reaction program are as follows. The reaction system is 25 μl of 2×Phanta Max Master Mix, 1 μl each of the forward and reverse primers of the candidate gene, 1 μl of Bletilla striata tissue cDNA, 22 μl of ddH2O. The PCR reaction program is: Pre-denature at 95 °C for 3 min; Denature at 95 °C for 15 s, Anneal at 58 °C for 15 s, Extend at 72 °C for 1 min for 35 cycles; Final extension at 72 °C for 5 min; Incubate at 10 °C.

[0025] Recover the target fragment using 1% agarose gel and Tiangen agarose gel DNA recovery kit. After recovery, measure its recovery concentration on a NanoReady ultra-micro ultraviolet-visible spectrophotometer, and finally store it in a -20 °C refrigerator for later use. Obtain the Gastrodia elata glycosyltransferase GaUGT813 gene fragment. After sequencing, its nucleic acid sequence is shown in SEQ ID NO.1, and the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0026] Glycosyltransferase GaUGT813 The amplification primers for the gene are as follows: F: ATGCCCAACCAAAGCCC; (SEQ ID NO.3) R: TTAGTTTTTGACAAATCGTATCATC; (SEQ ID NO.4) In addition, when performing homologous recombination with the vector pET28a, GaUGT813 the gene needs to be amplified and recovered using primers with homologous arms. The primers with homologous arms are as follows: F: gtggacagcaaatgggtcgcggatccATGCCCAACCAAAGCCC; (SEQ ID NO.5) R: tgtcgacggagctcgaattcggatccTTAGTTTTTGACAAATCGTATCATC. (SEQ ID NO.6) (3) Construction and identification of the gene recombinant vector The schematic diagram of homologous recombination is shown in detail in Figure 2. First, linearize the vector pET28a. During homologous recombination, assemble according to the operating instructions of the homologous recombination enzyme. Then, calculate the dosage of each component based on the concentrations of the inserted fragment and the vector and in accordance with the recombination instructions. Finally, add each component to the PCR reaction tube on ice. After assembly, detect the result and send it to the company for sequencing. The electrophoresis detection result after assembly is shown in Figure 3 , indicating successful assembly.

[0027] (4) SDS-PAGE protein electrophoresis After small-scale protein expression experiments, it was determined that GaUGT813 the protein induction conditions are as follows: 16 °C, 0.2 mM IPTG, 180 r / min, induce for 12 h; then perform large-scale shaking, collect the bacteria, break the cell wall, obtain the protein supernatant after high-speed centrifugation, and then detect it by SDS-PAGE protein electrophoresis. The detection result is shown in Figure 4 , indicating that the supernatant protein of the target gene was obtained.

[0028] (5) Enzyme activity reaction The enzyme activity reaction is carried out in a 1.5 mL centrifuge tube and prepared according to the components in Table 1. Then, add each component in the order shown in the table, mix well, and briefly centrifuge to collect the reaction solution at the bottom of the centrifuge tube. Place the centrifuge tube in a metal bath and react at 32 °C for 12 h. After completion, terminate the reaction with 100 μL of methanol, and finally perform product detection.

[0029] Table 1 Component ratio of the UGT enzyme activity reaction system

[0030] (6) Product detection The HPLC detection conditions are as follows: The instrument used for HPLC detection is the Agilent 1290 ultra-high performance liquid chromatograph. The liquid chromatography column is an Agilent ZORBAX SB-C18 column (250 mm × 4.6 mm, 5.0 μm). The mobile phase is: 0.01% formic acid solution (A) and acetonitrile (B). The gradient elution program is as follows: 0 - 8 min, 99% A - 95% A; 8 - 13 min, 95% A - 90% A; 13 - 20 min, 90% A - 80% A; 20 - 25 min, 80% A - 55% A; 25 - 35 min, 55% A - 10% A; 35 - 40 min, 10% A - 10% A; 40 - 40.01 min, 10% A - 99% A; 45 min Stop. The flow rate is 0.6 mL / min. The column temperature is 30 °C. The injection volume is 10 μL. The absorption wavelength is 220 nm. The detection result is shown in Figure 5 , indicating the production of gastrodin.

[0031] The LC-MS detection conditions are as follows: Detection was carried out using an Agilent 1290 UPLC / 6540 Q-Tof liquid chromatography-mass spectrometry (LC / MS) instrument. Mass spectrometry conditions: The ion source was in negative ion mode, with a voltage of 3500 V; fragmentation voltage: 135 V; cone voltage: 60 V; RF voltage: 750 V, and the scanning range was 100 - 1000 m / z. Chromatography conditions: The column used was an Agilent ZORBAX SB-C18 column (250 mm × 4.6 mm, 5.0 μm), with a flow rate of 0.6 mL / min. The mobile phase was 0.01% formic acid (A) and acetonitrile (B), and the gradient was as follows: 0 min, A:B = 99:1; 8 min, A:B = 95:5; 13 min, A:B = 90:10; 20 min, A:B = 80:20; 25 min, A:B = 55:45; 35 min, A:B = 10:90; 40 min, A:B = 10:90; 40.01 min, A:B = 99:1; 45 min, Stop. The detection results are shown in Figure 6 , and it can be seen from the results that the retention time of the reaction product ( Figure 6 A) and the characteristic peak ( Figure 6 B) are consistent with the retention time of the standard gastrodin ( Figure 7 ) and the characteristic peak ( Figure 8 ), further confirming that the product generated is gastrodin.

[0032] The above shows and describes the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments. What is described in the above embodiments and the specification only illustrates the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the present invention claimed. The scope of protection of the present invention is defined by the appended claims and their equivalents.

Claims

1. A gastrodia glycosyltransferase GaUGT813 gene, characterized in that The gastrodia elata glycosyltransferase GaUGT813 The nucleic acid sequence of the gene is shown in SEQ ID NO.

1.

2. The gastrodia glycosyltransferase according to claim 1 GaUGT813 The protein encoded by the gene, characterized in that The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. A recombinant plasmid containing the gastrodia glycosyltransferase gene recited in claim 1 GaUGT813 gene.

4. The recombinant plasmid containing the gastrodia glycosyltransferase GaUGT813 gene according to claim 3, characterized in that The gastrodia glycosyltransferase GaUGT813 gene was obtained by homologous recombination with the pET28a vector to obtain the pET28a- GaUGT813 recombinant plasmid.

5. A genetically engineered bacterium, characterized in that, Containing the recombinant plasmid described in claim 3 or 4, or, the exogenous gastrodia glycosyltransferase described in claim 1 is integrated into the genome of the genetically engineered bacterium GaUGT813 gene.

6. The genetically engineered bacterium according to claim 5, characterized in that, The genetically engineered bacterium is Escherichia coli BL21(DE3) strain.

7. Use of the gastrodia elata glycosyltransferase according to claim 1 GaUGT813 in the preparation of gastrodin.

8. Use of the gastrodia glycosyltransferase gene according to claim 7 GaUGT813 in the preparation of gastrodin, characterized in that Using p-hydroxybenzyl alcohol as a substrate and UDP-glucose as a glycosyl donor, under the catalysis of the gastrodia glycosyltransferase encoded by the gastrodia glycosyltransferase gene described above GaUGT813 glycosylation occurs at the hydroxyl group at the -4 position of p-hydroxybenzyl alcohol to produce gastrodin under the catalysis of the gastrodia glycosyltransferase C encoded by the gene

Images