Gatsaoko glycosyl transferase GaUGT1156 gene and application of GaUGT1156 gene in preparation of gastrodin

Abstract

The invention relates to a gastrodia elata glycosyl transferase GaUGT1156 gene and an application of the gastrodia elata glycosyl transferase GaUGT1156 gene in preparation of gastrodin, and belongs to the technical field of biology. The nucleotide sequence of the gastrodia elata glycosyl transferase GaUGT1156 gene is as shown in SEQ ID NO. 1, and the total length of the sequence is 1422bp; the amino acid sequence of the encoded protein is as shown in SEQ ID NO.2, and 474 amino acid residues are encoded. The gastrodia elata glycosyl transferase GaUGT1156 gene can be used as a biosynthesis regulation gene of gastrodin, is applied to preparation of gastrodin, and is remarkable in application prospect and easy to popularize and apply.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and specifically relates to a gastrodia elata glycosyltransferase GaUGT1156 Gene and its application in the preparation of gastrodin. Background Art

[0002] Gastrodia elata Gastrodia elata Bl . ) is from the genus Gastrodia of the family Orchidaceae ( Gastrodia )The tuber of the plant Gastrodia elata is a traditional precious Chinese medicine, mainly used to treat dizziness, vertigo, limb numbness, convulsions and stroke. The main active ingredient of Gastrodia elata is gastrodin, also known as gastrodin glycoside, chemical name: 4-hydroxymethylphenyl- β -D-pyranoglucoside is a phenolic glycoside with the molecular formula C 13 H 18 O7, molecular weight is 286.28 kDa.

[0003] Studies have shown that gastrodin can inhibit cell death and apoptosis induced by excitatory amino acids, has the ability to scavenge free radicals, can resist free radical-induced PC12 cell damage, and has a neuroprotective effect. Gastrodin has a good therapeutic effect on patients with functional dyspepsia accompanied by anxiety and depression symptoms, can dilate blood vessels, reduce cardiac hypertension and fibrosis, and also has pharmacological effects on the central nervous system such as anti-anxiety, sedation and hypnosis, anticonvulsant, anti-epileptic, analgesia, intelligence, anti-aging and neuroprotection. In addition, some studies have also found that gastrodin has multiple biological effects such as anti-obesity, anti-inflammatory, memory improvement and acetylcholinesterase inhibitor. Therefore, the demand for gastrodia elata in the market continues to expand. Although wild gastrodia elata has a high content of active ingredients and good efficacy, its yield is low and cannot meet actual needs. It is also on the verge of extinction due to excessive artificial collection. Now gastrodia elata is mainly cultivated artificially. The use of bioengineering to produce gastrodin is the direction of the future industry.

[0004] The main methods of obtaining gastrodin in the early days were direct extraction from gastrodia tubers or chemical processing. However, the chemical synthesis of gastrodin is energy-intensive and environmentally unfriendly; the artificial cultivation extraction method has problems such as the quality of gastrodia cannot be guaranteed, the cultivation cycle of gastrodia is long, and it is difficult to extract high-purity gastrodin. Therefore, the biosynthesis of gastrodin has attracted more and more attention in recent years. The biosynthesis of gastrodin uses 4-hydroxymethyl-phenol (HBA) as a substrate and uridine diphosphate glucose (UDP-glucose) as a glycosyl donor. Under the catalysis of glycosyltransferase, the gastrodin is synthesized in the presence of 4-hydroxybenzyl alcohol. C Glycosylation is carried out on the hydroxyl group at the -4 position to produce gastrodin.

[0005] In recent years, with the rapid development of the field of synthetic biology, the use of synthetic biology techniques to produce natural medicine monomers can effectively solve the above problems. However, to clarify the biosynthetic pathways of these active ingredients, it is necessary to identify the key genes related to these pathways, and exploring these catalytic enzyme genes has become a key link in studying the biosynthetic pathways of plant metabolites. Currently, the synthetic pathway for catalyzing the glycosylation reaction of the hydroxyl group at the C -4 position to form gastrodin is clear, but the function of the glycosyltransferase responsible for the synthesis of gastrodin excavated in Gastrodia elata has not been verified, which has affected the progress of gastrodin biosynthesis work. Summary of the Invention

[0006] To solve the above problems, the present invention provides a Gastrodia elata glycosyltransferase GaUGT1156 gene, which can be used as a biosynthetic regulatory gene for gastrodin.

[0007] To achieve the above object, the technical solution adopted by the present invention is: The first aspect of the present invention provides a Gastrodia elata glycosyltransferase GaUGT1156 gene, and the Gastrodia elata glycosyltransferase GaUGT1156 The second aspect of the present invention provides the above gastrodia glycosyltransferase GaUGT1156 protein encoded by the gene, and the amino acid sequence of the protein is as follows SEQ ID NO.2, encoding 474 amino acid residues.

[0008] MQRMEEGRAHCVMIPYPTQGHISPTLRLAKFLHSSHGFYVTFVNTEFNHARLLRSQGAAAVAGLPGFRFEAIPDGLPPSDLDATQDLRDLCASIQSNFLLPPLLRLLRRLNEPSSGAPPVTRIISDGMMSFCVDAAKELQIPLSAFWTASACGLMGYLHFPALLLRGITPLKDESCVSNGYLDAKVDWIPGMSNEMRFKDLPSFIQTTDPDDIFFNYLSNSARRLNEAGAIIINTFDELEGAVLRSLRSILSPPIYTVGPVHMLFRSGGASLWREDSGWKEWLDCRDPLSVVFVNFGSITVMSNAQLAEFAWGLAGSGFDFLWVVRGDLVRGPNDLQPFLPLEFLEATKNRGLIVGWCAQEDVLLHPAVGCFLTHAGWNSILETLAAGKPLLCWPFFAEQQTNSRYASAEWGVGVQIDSHVKRGELECLISEVMGSNKAFRNKAEKWKQSAIKAVQEGGSSYTNFEAIVNQVLR; (SEQ ID NO.2) The third aspect of the present invention provides a recombinant plasmid containing the above gastrodia glycosyltransferase GaUGT1156 gene.

[0009] Preferably, the recombinant plasmid is obtained by homologous recombination of the above gastrodia glycosyltransferase GaUGT1156 gene with the pET28a vector, and is named pET28a- GaUGT1156 .

[0010] The fourth aspect of the present invention provides a genetically engineered bacterium containing the above recombinant plasmid, or, the genome of the genetically engineered bacterium integrates the exogenous above gastrodia glycosyltransferase GaUGT1156 gene.

[0011] Preferably, the genetically engineered bacterium is Escherichia coli BL21 (DE3) strain.

[0012] The fifth aspect of the present invention provides an above gastrodia glycosyltransferase GaUGT1156Application of gene in preparing gastrodin.

[0013] Preferably, using 4-hydroxybenzyl alcohol and glycosyl donor UDP-glucose as raw materials, under the catalysis of gastrodia glycosyltransferase encoded by the above-mentioned gastrodia glycosyltransferase gene, glycosylation is carried out on the hydroxyl group at the -4 position of 4-hydroxybenzyl alcohol to generate gastrodin. GaUGT1156 Preferably, using 4-hydroxybenzyl alcohol and glycosyl donor UDP-glucose as raw materials, under the catalysis of gastrodia glycosyltransferase encoded by the above-mentioned gastrodia glycosyltransferase gene, glycosylation is carried out on the hydroxyl group at the -4 position of 4-hydroxybenzyl alcohol (4-Hydroxybenzyl alcohol) to generate gastrodin. C Preferably, using 4-hydroxybenzyl alcohol and glycosyl donor UDP-glucose as raw materials, under the catalysis of gastrodia glycosyltransferase encoded by the above-mentioned gastrodia glycosyltransferase gene, glycosylation is carried out on the hydroxyl group at the -4 position of 4-hydroxybenzyl alcohol to generate gastrodin (Gastrodin).

[0014] In the present invention, the target protein is obtained by in vitro expression through a recombinant plasmid, and after further catalyzing the substrate 4-hydroxybenzyl alcohol, gastrodin is directly generated.

[0015] The glycosyltransferase gene described in the present invention GaUGT1156 is identified by screening through transcriptome sequencing and bioinformatics techniques from the tubers of Gastrodia elata, and is obtained by using RNA reagent to extract RNA from the tubers of Gastrodia elata and then reverse transcribing it into cDNA and performing PCR amplification. The amplification primers of the glycosyltransferase gene are as follows: GaUGT1156 The amplification primers of the glycosyltransferase gene are as follows: F: ATGCAAAGGATGGAGGAGGG; (SEQ ID NO.3) R: TTAGCGTAGGACTTGGTTGACAATC; (SEQ ID NO.4) In addition, when performing homologous recombination with the vector pET28a, the gene needs to be amplified and recovered using primers with homologous arms. The primers with homologous arms are as follows: GaUGT1156 In addition, when performing homologous recombination with the vector pET28a, the gene needs to be amplified and recovered using primers with homologous arms. The primers with homologous arms are as follows: F: gtggacagcaaatgggtcgcggatccATGCAAAGGATGGAGGAGGG; (SEQ ID NO.5) R: tgtcgacggagctcgaattcggatccTTAGCGTAGGACTTGGTTGACAATC. (SEQ ID NO.6) The glycosyltransferase gene isolated and identified from Gastrodia elata GaUGT1156 can be used as an important marker gene for molecular assisted breeding of Gastrodia elata, and can also be used as an important candidate gene for producing gastrodin in the construction of yeast chassis cells.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) The present invention provides the gastrodia glycosyltransferase gene, which can be used as a biosynthetic regulatory gene for gastrodin and is applied to the preparation of gastrodin. GaUGT1156 (1) The present invention provides the gastrodia glycosyltransferase gene, which can be used as a biosynthetic regulatory gene for gastrodin and is applied to the preparation of gastrodin.

[0017] (2) With the rapid development of bioinformatics technology, the exploration of key enzyme genes in the biosynthesis pathway of gastrodin has been greatly promoted. The biosynthesis regulatory gene of gastrodin in the present invention, namely gastrodia glycosyltransferase GaUGT1156 gene, is identified and successfully verified for the first time, opening up a new method for the biosynthesis of gastrodin. The present invention obtains the target product by means of in vitro enzymatic catalysis of heterologously expressed proteins in Escherichia coli, adopts in vitro biosynthesis for directional production, and has the advantages of few by-products.

[0018] (3) The present invention also provides a recombinant plasmid, a genetically engineered bacterium and a recombinant protein containing the glycosyltransferase GaUGT1156 gene, laying a foundation for the large-scale synthesis of gastrodin by bioengineering methods and further for the research on constructing a cell factory for producing gastrodin.

[0019] (4) By in vitro biosynthesis of gastrodin, the controllability is strong, the demand for raw material planting can be reduced, the production product is single, which is convenient for the separation and purification of gastrodin in the later stage, and can also reduce problems such as difficulties in chemical synthesis and complex synthesis pathways. The gastrodia glycosyltransferase GaUGT1156 gene, as a key gene in the biosynthesis of gastrodin, can also be used for the breeding research of plants rich in gastrodin such as Mirabilis jalapa. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 is a schematic diagram of the deduced synthesis pathway for gastrodin; Figure 2 is a schematic diagram of the construction of the recombinant expression plasmid pET28a- GaUGT1156 ; Figure 3 is GaUGT1156 the electrophoresis detection result after recombination; Figure 4 is GaUGT1156 the SDS-PAGE protein electrophoresis diagram. Where M is the protein molecular weight standard; Figure 5 is the glycosylation effect of the glycosyltransferase GaUGT1156 on p-hydroxybenzyl alcohol detected by HPLC. The abscissa is time, in minutes, and the ordinate is the response value, in mAU; among them, CK: control group (p-hydroxybenzyl alcohol + uridine diphosphate glucose + inactivated gastrodia glycosyltransferase GaUGT1156 ) enzyme inactivation enzyme activity reaction result; standard: p-hydroxybenzyl alcohol standard + gastrodin standard; GaUGT1156 : experimental group (p-hydroxybenzyl alcohol + uridine diphosphate glucose + gastrodia glycosyltransferase GaUGT1156 ) enzyme activity reaction result; Figure 6 is the fragment ion diagram (theoretical molecular weight 331) (LC / MS / MS) of the reaction product gastrodin; Figure 7 Fragment ion chromatogram of gastrodin as the reference standard (theoretical molecular weight 331) (LC / MS / MS). Detailed implementation manners

[0021] The present invention will be further described in detail below in conjunction with embodiments.

[0022] Those skilled in the art will understand that the following embodiments are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. For those not specified in the embodiments regarding specific technologies or conditions, they shall be carried out according to the technologies or conditions described in the literature in this field or according to the product specifications. For those materials or equipment without indicating the manufacturer, they are all conventional products that can be obtained by purchase. Example 1

[0023] Based on the basic functional annotation information of Gastrodia elata transcriptome Unigene, UGT candidate genes were screened in the sequencing annotation results. At the same time, glycosyltransferases (UGTs) identified in plants were used for local BLAST analysis of sequences. Then, the screening results were sorted out and analyzed. Finally, 1 glycosyltransferase (UGT) gene was found. After a series of work such as cDNA preparation, amplification and recovery of candidate genes, homologous recombination, protein expression, in vitro enzyme activity reaction, and HPLC and LC / MS detection, the target candidate gene that can catalyze the glycosylation of the hydroxyl group at the C-4 position of 4-Hydroxybenzyl alcohol was finally identified GaUGT1156 ( Figure 1 ) The operation steps of each stage of gastrodin synthesis are as follows (the reagents, raw materials, instruments and equipment used in the following examples are all commercially available): (1) Preparation of cDNA template Take fresh samples of Gastrodia elata tubers, quick-freeze them in liquid nitrogen after slicing, and perform RNA extraction. The RNA extraction uses the HiPure Plant RNA Mini Kit of Magen (Guangzhou Meiji Biotechnology Co., Ltd.). Extract RNA according to the operation steps of the kit. After passing the detection, use the TAKARA reverse transcription kit to reverse transcribe RNA into cDNA and store it at -20 °C for later use.

[0024] (2) Gene amplification and recovery Use SnapGene software to design specific primers for candidate genes and entrust Beijing Tsingke Biotechnology Co., Ltd. The Kunming Branch synthesized and performed gene cloning using cDNA as a template. The target gene was amplified using 2×Phanta Max MasterMix polymerase. The reaction system and reaction program are as follows. The reaction system is 25 μL of 2×Phanta Max Master Mix, 1 μL each of the forward and reverse primers of the candidate gene, 1 μL of cDNA, and 22 μL of ddH2O. The PCR reaction program is: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s; annealing at 58°C for 15 s; extension at 72°C for 1 min; 35 cycles; final extension at 72°C for 5 min; incubation at 10°C.

[0025] After the PCR program ended, the target fragment was recovered using 1% agarose gel and the Tiangen agarose gel DNA recovery kit. After recovery, its recovery concentration was measured on a NanoReady ultra-micro ultraviolet-visible spectrophotometer, and finally it was stored at -20 °C in the refrigerator for standby. The gastrodia glycosyltransferase GaUGT1156 gene fragment was obtained. After sequencing, its nucleic acid sequence is as shown in SEQ ID NO.1, and the amino acid sequence of the protein is as shown in SEQ ID NO.2.

[0026] Glycosyltransferase GaUGT813 The amplification primers for the gene are as follows: F: ATGCAAAGGATGGAGGAGGG; (SEQ ID NO.3) R: TTAGCGTAGGACTTGGTTGACAATC; (SEQ ID NO.4) In addition, when performing homologous recombination with the vector pET28a, GaUGT1156 the gene needs to be amplified and recovered using primers with homologous arms. The primers with homologous arms are as follows: F: gtggacagcaaatgggtcgcggatccATGCAAAGGATGGAGGAGGG; (SEQ ID NO.5) R: tgtcgacggagctcgaattcggatccTTAGCGTAGGACTTGGTTGACAATC. (SEQ ID NO.6) (3) Construction and identification of the gene recombinant vector The schematic diagram of homologous recombination is shown in detail in Figure 2 . First, the vector pET28a was linearized. During homologous recombination, it was assembled according to the operation instructions of the homologous recombination enzyme. Then, according to the concentrations of the inserted fragment and the vector, the amounts of each component were calculated according to the recombination instructions. Finally, each component was added to the PCR reaction tube on ice. After assembly, the result was detected and sent to the company for sequencing. The electrophoresis detection result after assembly is shown inFigure 3 , indicating successful assembly.

[0027] (4) SDS-PAGE protein electrophoresis After small-scale protein expression experiments, it was determined that GaUGT1156 the protein induction conditions were: 16 °C, 0.2 mM IPTG, 180 r / min, for 12 h; then large-scale shaking culture was carried out, and the bacteria were collected and lysed. After high-speed centrifugation, the protein supernatant was obtained, and then SDS-PAGE protein electrophoresis was used for detection. The detection results are shown in Figure 4 , indicating that the supernatant protein of the target gene was obtained.

[0028] (5) Enzyme activity reaction The enzyme activity reaction was carried out in a 2.0 mL centrifuge tube and prepared according to the components in Table 1. Then, the components were added in the order shown in the table, and after mixing, the reaction solution was briefly centrifuged and collected at the bottom of the centrifuge tube. The centrifuge tube was placed in a metal bath and reacted at 32 °C for 12 h. After completion, the reaction was terminated with 100 μL of methanol, and finally the product was detected.

[0029] Table 1 Composition ratio of UGT enzyme activity reaction system

[0030] (6) Product detection The HPLC detection conditions are as follows: The instrument used for HPLC detection was an Agilent 1290 ultra-high performance liquid chromatograph. The liquid chromatography column was an Agilent ZORBAX SB-C18 column (250 mm × 4.6 mm, 5.0 μm). The mobile phase was: 0.01% formic acid solution (A) and acetonitrile (B). The gradient elution program was as follows: 0 - 8 min, 99% A - 95% A; 8 - 13 min, 95% A - 90% A; 13 - 20 min, 90% A - 80% A; 20 - 25 min, 80% A - 55% A; 25 - 35 min, 55% A - 10% A; 35 - 40 min, 10% A - 10% A; 40 - 40.01 min, 10% A - 99% A; 45 min Stop. The flow rate was 0.6 mL / min. The column temperature was 30 °C. The injection volume was 10 μL. The absorption wavelength was 220 nm. The detection results are shown in Figure 5 , indicating the production of gastrodin.

[0031] The LC-MS detection conditions are as follows: Detection was carried out using an Agilent 1290 UPLC / 6540 Q-Tof liquid chromatography-mass spectrometry (LC / MS) instrument. Mass spectrometry conditions: The ion source was operated in the negative ion mode, with a voltage of 3500 V; fragmentation voltage: 135 V; cone voltage: 60 V; RF voltage: 750 V, and the scanning range was 100 - 1000 m / z. Chromatography conditions: The column used was an Agilent ZORBAX SB-C18 column (250 mm × 4.6 mm, 5.0 μm), and the flow rate was 0.6 mL / min. The mobile phase was 0.01% formic acid (A) and acetonitrile (B), and the gradient was as follows: 0 min, A:B = 99:1; 8 min, A:B = 95:5; 13 min, A:B = 90:10; 20 min, A:B = 80:20; 25 min, A:B = 55:45; 35 min, A:B = 10:90; 40 min, A:B = 10:90; 40.01 min, A:B = 99:1; 45 min, Stop. The test results are shown in Figure 6 , Figure 7 . It can be seen from the results that the fragment ion spectrum of the reaction product gastrodin ( Figure 6 ) is consistent with the fragment ion spectrum of the standard gastrodin ( Figure 7 ), further confirming that the product formed is gastrodin.

[0032] The above shows and describes the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments. The above embodiments and the descriptions in the specification only illustrate the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the present invention claimed. The scope of protection claimed by the present invention is defined by the appended claims and their equivalents.

Claims

1. A Gastrodia elata glycosyltransferase GaUGT1156 gene, characterized in that The gastrodia elata glycosyltransferase G aUGT1156 The nucleic acid sequence of the gene is shown in SEQ ID NO.

1.

2. The gastrodia glycosyltransferase according to claim 1 GaUGT1156 The protein encoded by the gene, characterized in that The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. A recombinant plasmid containing the gastrodia glycosyltransferase gene as recited in claim 1. GaUGT1156 ​ 4. The recombinant plasmid containing the gastrodia glycosyltransferase GaUGT1156 gene according to claim 3, characterized in that The gastrodia glycosyltransferase GaUGT1156 gene was obtained by homologous recombination with the pET28a vector to obtain the pET28a- GaUGT1156 recombinant plasmid.

5. A genetically engineered bacterium, characterized in that, Containing the recombinant plasmid described in claim 3 or 4, or, the exogenous gastrodia glycosyltransferase described in claim 1 is integrated into the genome of the genetically engineered bacterium GaUGT1156 gene.

6. The genetically engineered bacterium according to claim 5, wherein The genetically engineered bacterium is Escherichia coli BL21(DE3) strain.

7. Use of the gastrodia glycosyltransferase gene according to claim 1 in the preparation of gastrodin. GaUGT1156 ​ 8. Use of the gastrodia glycosyltransferase gene according to claim 7 GaUGT1156 in the preparation of gastrodin, characterized in that Using p-hydroxybenzyl alcohol as a substrate and UDP-glucose as a glycosyl donor, under the catalysis of the gastrodia glycosyltransferase encoded by the gastrodia glycosyltransferase gene as described above, glycosylation occurs at the hydroxyl group at the -4 position of p-hydroxybenzyl alcohol to produce gastrodin. GaUGT1156 gene, glycosylation occurs at the hydroxyl group at the C -4 position of p-hydroxybenzyl alcohol to produce gastrodin.

Images