A plasmid, a haemophilus parasuis surface display vector and a construction method and application thereof

Abstract

The application belongs to the field of biology and discloses a plasmid containing Haemophilus parasuis OmpAm outer membrane protein gene and Mycoplasma hyopneumoniae membrane protein gene; the Mycoplasma hyopneumoniae membrane protein gene is one or more combinations of Mycoplasma hyopneumoniae membrane protein P46 gene, Mycoplasma hyopneumoniae membrane protein P65 gene and Mycoplasma hyopneumoniae membrane protein P159 gene. The plasmid contains OmpAm outer membrane protein gene and Mycoplasma hyopneumoniae membrane protein gene, target genes amplified from the vector by primers are used to prepare recombinant Haemophilus parasuis by natural transformation, and one or more of Mhp antigen proteins such as P46 protein, P65 protein and P159 protein can be effectively expressed, so that the effect of double immunization is achieved. Meanwhile, the application also provides recombinant Haemophilus parasuis and application thereof.

Description

Technical Field

[0001] This invention relates to the field of biology, and more particularly to a plasmid, a surface display vector for Haemophilus parasuis, a method for constructing the plasmid, and its application. Background Technology

[0002] Haemophilus parasuis infection is widespread globally. Pigs aged one week to one month are generally most susceptible. The endotoxin of Haemophilus parasuis causes disseminated intravascular coagulation and microthrombosis in multiple tissues. Infection with this bacterium, requiring extensive antibiotic treatment or resulting in death, causes significant economic losses for pig farmers. Outbreaks of Haemophilus parasuis infection in both healthy and non-healthy herds can lead to high morbidity and mortality rates. In ordinary pig herds, infection can cause respiratory diseases.

[0003] In 1980, Movva et al. first determined the amino acid sequence of the Omp A signal peptide, which contains 21 amino acid residues that guide Omp A to be secreted onto the outer membrane via Sec B-dependent post-translational transport.

[0004] Outer member protein (Omp) is one of the possible virulence factors of Haemophilus parasuis. Among them, outer member protein Omp A is a major adhesion protein of the bacterium, which is related to bacterial colonization. It is one of the major outer member proteins of Haemophilus parasuis. The polyclonal antibody serum prepared with it has cross-reactivity with antigens of various serotype HPS strains and is a possible protective antigen.

[0005] Mycoplasmal pneumonia of Swine (MPS) is a chronic, contagious respiratory disease caused by Mycoplasma hyopneumoniae (Mhp), often presenting as a co-infection with other pathogens in clinical practice. The membrane proteins P46, P65, and P159 of Mycoplasma hyopneumoniae are the main immunodominant proteins on the surface of Mhp, exhibiting high species specificity and frequently used as target proteins for detecting Mycoplasma hyopneumoniae in research. During the later stages of mycoplasma infection, Haemophilus parasuis, a common bacterium in pig farms, can invade the lungs and cause secondary infections due to ciliary damage and weakened immune systems, leading to severe secondary infections. When both diseases are co-infected, conventional drugs are ineffective, ultimately exacerbating the mortality of affected pigs.

[0006] For relevant literature on dual or multiple vaccines against porcine mycoplasmal pneumonia and Haemophilus parasuis, please refer to the following materials:

[0007] CN119303069A, a triple vaccine against porcine circovirus, mycoplasma hyopneumoniae, and Haemophilus parasuis;

[0008] CN104208667A, A method for preparing a trivalent inactivated vaccine;

[0009] CN103083655A, Vaccine composition for prevention and treatment of porcine circovirus type 2, Haemophilus parasuis and Mycoplasma hyopneumoniae infection and method thereof;

[0010] All of the above methods use multivalent inactivated vaccines for epidemic prevention.

[0011] Current research indicates that prevention and control of Mycoplasma hyopneumoniae and Haemophilus parasuis are limited to the level of multivalent vaccines. Summary of the Invention

[0012] The purpose of this invention is to provide a plasmid containing the Omp Am outer membrane protein gene and the Mycoplasma hyopneumoniae membrane protein gene. The target gene is amplified from the vector using primers and then recombinant Haemophilus parasuis is prepared through natural transformation. This plasmid can effectively express one or more Mhp antigen proteins such as P46, P65, and P159 proteins, thereby achieving the effect of dual immunity.

[0013] Meanwhile, the present invention also provides recombinant Haemophilus parasuis and its applications.

[0014] The specific solution of the present invention is as follows:

[0015] A plasmid containing the Haemophilus parasuis Omp Am outer membrane protein gene and the Mycoplasma hyopneumoniae membrane protein gene; wherein the Mycoplasma hyopneumoniae membrane protein gene is one or more of the following: Mycoplasma hyopneumoniae membrane protein P46 gene, Mycoplasma hyopneumoniae membrane protein P65 gene, and Mycoplasma hyopneumoniae membrane protein P159 gene.

[0016] In the plasmids described above, the nucleotides of the plasmids are as shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4.

[0017] Meanwhile, this invention also discloses a method for constructing a Haemophilus parasuis surface display vector. The method involves natural transformation of the target gene and Haemophilus parasuis to obtain a recombinant strain of Haemophilus parasuis capable of expressing Mycoplasma hyopneumoniae antigen protein. The target gene is prepared by amplifying it from the plasmid described above using primers. The target gene contains the Haemophilus parasuis Omp Am outer membrane protein gene and the Mycoplasma hyopneumoniae membrane protein gene. The upstream primer in the primer set contains a USS sequence.

[0018] In the above-described method for constructing the Haemophilus parasuis surface display vector, the sequences of the primers are shown in SEQ ID NO. 5 and SEQ ID NO. 6.

[0019] In addition, the present invention also discloses a surface display vector for Haemophilus parasuis, which is prepared by the method described above.

[0020] The use of the Haemophilus parasuis surface display vector described above for vaccine preparation was also disclosed.

[0021] Finally, the present invention also discloses a vaccine containing an inactivated Haemophilus parasuis surface display vector as described above.

[0022] The beneficial effects of this application are:

[0023] The plasmid of this invention contains the Haemophilus parasuis Omp Am outer membrane protein gene and the Mycoplasma hyopneumoniae membrane protein gene. The target gene is amplified from the vector using primers and then recombinant Haemophilus parasuis is prepared through natural transformation. It can effectively express one or more of the Mhp antigen proteins such as P46 protein, P65 protein, and P159 protein, thereby achieving the effect of dual immunity. Attached Figure Description

[0024] Figure 1 Electrophoresis results of pET-28a(+)-p97-46-65-DH5α Escherichia coli;

[0025] Figure 2 Electrophoresis results of pET-28a(+)-p159-DH5α Escherichia coli;

[0026] Figure 3 The staining pattern for protein rP97-46-65;

[0027] Figure 4 This is a staining diagram of protein rP159;

[0028] Figure 5 Schematic diagram of the detection principle of indirect ELISA;

[0029] Figure 6 This is a Non-Reducing SDS-PAGE electrophoresis image of the purified rP97-46-65 antibody.

[0030] Figure 7 Here is a non-reducing SDS-PAGE electrophoresis image of the rP159 purified antibody;

[0031] Figure 8 The image shows an electrophoresis diagram of the gene fragment of the Omp Am outer membrane protein, which is 1929 bp in length.

[0032] Figure 9 The image shows an electrophoresis diagram of the ompAm-P159 protein gene fragment, which is 2679 bp in length.

[0033] Figure 10 The image shows an electrophoresis diagram of the gene fragment of the ompAm-P65 protein, which is 2436 bp in length.

[0034] Figure 11 The image shows an electrophoresis diagram of the ompAm-P46 protein gene fragment, which is 2238 bp in length.

[0035] Figure 12 The image shows an electrophoresis diagram of the pDL02-ompAm gene fragment, which is 2315 bp in length.

[0036] Figure 13 The image shows an electrophoresis diagram of the pDL02-ompAm-P159 gene fragment, which is 3071 bp in length.

[0037] Figure 14 The image shows an electrophoresis diagram of the pDL02-ompAm-P65 gene fragment, which is 2822 bp in length.

[0038] Figure 15 The image shows an electrophoresis diagram of the pDL02-ompAm-P46 gene fragment, which is 2624 bp in length.

[0039] Figure 16 The developing band pattern of Sc096-ompAm;

[0040] Figure 17 The developing band pattern of Sc096-ompAm-159;

[0041] Figure 18 The developing band pattern of Sc096-ompAm-159;

[0042] Figure 19 The developing band pattern of Sc096-ompAm-65;

[0043] Figure 20 The developing band pattern of Sc096-ompAm-46;

[0044] Figure 21 The developing band patterns of Sc096-ompAm-46 and Sc096-ompAm-65;

[0045] Figure 22 A chart showing the results of the reactivity test between immune serum and wild-type protein;

[0046] Figure 23 A chart showing the results of total IgG level detection against rP159 antigen;

[0047] Figure 24A chart showing the results of total IgG level detection against rP46 antigen;

[0048] Figure 25 A chart showing the results of total IgG level detection against rP65 antigen;

[0049] Figure 26 A chart showing the results of total IgG level detection against sc096 antigen;

[0050] Figure 27 The chart shows the results of the detection of total IgG levels against sc096-ompA antigen. Detailed Implementation

[0051] The present invention will now be clearly and completely described in conjunction with embodiments thereof. It should be noted that, unless specific conditions are specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0052] The main research content of this invention is divided into two parts: the first part is the preparation of polyclonal antibodies against mycoplasma proteins; the second part is the preparation and application of the Haemophilus parasuis surface display vector of this invention.

[0053] Part 1: Preparation of Polyclonal Antibodies Against Mycoplasma Proteins

[0054] 1. Construction and validation of prokaryotic protein expression plasmids

[0055] 1.1 First, we commissioned Sangon Biotech to synthesize the sequence of the pET28a(+) mycoplasma protein-related plasmid;

[0056] pET28a(+) mycoplasma protein-related plasmids include plasmid pET-28a(+)-p97-46-65 (SEQ ID NO.7) and plasmid pET-28a(+)-p159 (SEQ ID NO.8).

[0057] 1.2 Transformation: Two tubes of competent DH5α cells were removed from -80℃. E. coli Place on ice, and after 5 min, add 10 μL of plasmid pET-28a(+)-p97-46-65 and plasmid pET-28a(+)-p159. React on ice for 25 min, then heat shock for 45 s, quickly place back on ice, let stand for 3 min, and then add 100 μL of antibiotic-free LB liquid culture medium. Incubate at 37℃ and 200 r / min on a shaker for 1 h.

[0058] 1.3 Sequencing and identification: 100 μL of bacterial suspension was spread on kanamycin LB agar plate. After bacterial growth, single colonies of pET-28a(+)-p97-46-65-DH5α Escherichia coli and pET-28a(+)-p159DH5α Escherichia coli were picked and the results were detected.

[0059] The target band size is approximately 1452 bp. Figure 1 ) and 993bp ( Figure 2 The results showed that the target bands p97-46-65 and p159 were present in the pET-28a(+)-p97-46-65-DH5α plasmid and pET-28a(+)-p159-DH5α plasmid. The bacterial cultures corresponding to the positive bands were sequenced.

[0060] Detection was performed using the following primers, P1 and P2.

[0061] P1 TAATACGACTCACTATAGGG (SEQ ID NO.9)

[0062] P2 TGCTAGTTATTGCTCAGCGG (SEQ ID NO. 10);

[0063] Figure 1 Electrophoresis results of pET-28a(+)-p97-46-65-DH5α Escherichia coli;

[0064] Figure 2 Electrophoresis results of pET-28a(+)-p159-DH5α Escherichia coli;

[0065] 1.4 Plasmid Extraction and Preservation: For bacterial cultures with correct sequencing results, amplification culture was performed. Plasmids pET-28a(+)-p97-46-65-DH5α and pET-28a(+)-p159-DH5α were extracted using a plasmid extraction kit and stored at -20℃. The bacterial cultures were then preserved at -80℃ in LB liquid medium containing 15-20% glycerol.

[0066] 1.5 Second Transformation: Two tubes of competent BL21 were removed from -80℃ E. coli Place on ice, and after 5 min, add 10 μL of plasmids pET-28a(+)-p97-46-65-DH5α and pET-28a(+)-p159-DH5α from section 1.4 above. React on ice for 25 min, then heat shock for 45 s, quickly place back on ice, let stand for 3 min, and then add 100 μL of antibiotic-free LB liquid culture medium. Incubate at 37 °C and 200 r / min on a shaker for 1 h.

[0067] 1.6 Sequencing Identification: 100 μL of bacterial culture was spread on kanamycin LB agar plates. After bacterial growth, single colonies of pET-28a(+)-p97-46-65-BL21 and pET-28a(+)-p159-BL21 Escherichia coli were picked and the target bands were detected. The size of the target bands was approximately 1452 bp and 993 bp, respectively, indicating that the target bands p97-46-65 and p159 were present in the pET-28a(+)-p97-46-65-BL21 plasmid and pET-28a(+)-p159-BL21 plasmid. The bacterial cultures corresponding to the positive bands were sequenced.

[0068] The detection primers are the same as P1 and P2;

[0069] 1.7 Plasmid extraction and preservation: For bacterial cultures with correct sequencing results, expand the culture and preserve the bacterial culture at -80℃ using LB liquid medium containing 15-20% glycerol.

[0070] 2. Induction and purification of recombinant proteins

[0071] 2.1 The above-obtained pET-28a(+)-p97-46-65-BL21 and pET-28a(+)-p159-BL21 bacterial suspensions were inoculated into 10 ml of liquid LB medium at a volume ratio of 1:100, and Km antibiotics were added at a ratio of 1:1000. The culture was incubated overnight at 37°C and 220 rpm.

[0072] 2.2 Transfer 10 mL of each of the two overnight bacterial cultures to 1 L of liquid LB medium containing 100 mg Km antibiotic, and incubate at 37 °C and 220 rpm for 3-4 h until the bacterial OD600 is 0.5. Then add 1 mol / L IPTG to a final concentration of 0.5 mmol / L and induce at 16 °C and 220 rpm for 12 h.

[0073] 2.3 Collect the four types of induced bacterial cells using 500ml centrifuge cups, centrifuge at 4000rpm for 40min, discard the supernatant and retain the bacterial cells;

[0074] 2.4 Each bacterial cell was resuspended and washed with 30 ml of PBS solution, centrifuged at 1200 rpm for 15 min at 4 °C, and the supernatant was discarded while the bacterial cells were retained;

[0075] 2.5 Each bacterial cell was resuspended in 30 ml of purification washing buffer, and then sonicated in an ice bath for 20 min at a sonication frequency of 40%.

[0076] 2.6 Centrifuge at 12000 rpm for 15 min at 4℃, collect the supernatant, filter it through a 0.45 μm filter membrane, and store it at 4℃;

[0077] 2.7 Pretreatment of nickel column: Flow the preservation solution in the nickel column down, add ddH2O to wash the nickel column and then flow down again, add purification washing solution to equilibrate the nickel column, and then discard the washing solution;

[0078] 2.8 Add the protein supernatant filtered through the filter membrane to the equilibrated nickel column, place it on a shaker in an ice bath for 2 hours to allow the target protein to bind with the nickel column packing material, and then discard the solution;

[0079] 2.9 Wash four times with purification washing buffer for 5 minutes each time to remove impurities;

[0080] 2.10 Elute four times with purification elution buffer, 10 min each time, to remove the target protein;

[0081] The proteins were named rP97-46-65 and rP159.

[0082] 3. SDS-PAGE identification of recombinant proteins

[0083] Prepare a 12% SDS-PAGE gel and perform SDS-PAGE gel electrophoresis on the protein samples purified in Section 2.10 above. Electrophoresis is performed at 80V for 30 minutes. After the samples run off the stacking gel, the voltage is changed to 120V and electrophoresis is continued. After electrophoresis, the protein gel is separated from the glass plate, and the stacking gel is discarded. The separating gel is stained with Coomassie Brilliant Blue staining solution and stained on a shaker for 2 hours. Then, it is destained three times with destaining solution for 30 minutes each time until the Coomassie Brilliant Blue background color is removed. The gel is then placed under a film viewing lamp for observation and photography.

[0084] Figure 3 The staining pattern for protein rP97-46-65;

[0085] Figure 4 This is a staining diagram of protein rP159;

[0086] 4. Preparation of polyclonal antibodies against recombinant proteins

[0087] 4.1 Animal Immunization

[0088] Two New Zealand white rabbits were immunized with rP97-46-65 and rP159, with each rabbit receiving a dose of 500 μg. For the first immunization, the immunogen was emulsified with an equal volume of complete Freund's adjuvant and injected subcutaneously at multiple sites on the back. Two weeks later, the same dose of immunogen was emulsified with an equal volume of incomplete Freund's adjuvant. One week after the fourth immunization, blood was collected and serum titers were determined by ELISA. Rabbits with high serum titers were selected for blood purification to prepare rabbit polyclonal antibodies. Rabbits with unsatisfactory serum titers were given a follow-up immunization, and their serum titers were determined by ELISA. Rabbits with acceptable serum titers were selected for blood purification to prepare rabbit polyclonal antibodies.

[0089] 4.2 Serum Collection

[0090] One week after the last immunization, 3-4 mL of blood was collected from the rabbit's ear vein, incubated overnight at 4°C, and then centrifuged at 4000 rpm for 15 min at 4°C to separate the supernatant serum for testing.

[0091] 4.3 ELISA Potency Testing

[0092] Serum titer was determined using an indirect ELISA method, which measures the binding of antiserum to the antigen. A titer of (antiserum absorbance - blank absorbance) / (pre-immunization negative control serum absorbance - blank absorbance) > 2.1 was considered acceptable, and the serum could be used for purification to prepare rabbit polyclonal antibodies.

[0093] Detection principle as follows Figure 5 As shown; Figure 5 Schematic diagram of the detection principle of indirect ELISA;

[0094] The testing steps are as follows.

[0095] (1) Coating: Take an appropriate amount of the detection protein, dissolve and dilute it with coating buffer to 0.1 μg / mL, 1 μg / mL, and 5 μg / mL respectively, and then add 100 μL to each well of a 96-well plate with a single pipette. Gently tap the plate to mix the sample, seal it tightly with plastic wrap, and coat it overnight at 4°C; (2) Washing: Wash the plate once with washing buffer at 300 μL / well, and dry the plate; (3) Blocking: Block the plate with blocking buffer at 300 μL / well, and block it at room temperature for 1 h; (4) Washing: Wash the plate twice with washing buffer at 300 μL / well, and dry the plate; (5) Adding samples: Add the serially diluted serum samples and sample diluent at 100 μL / well; (6) Adding secondary antibody: Add the detection antibody at 100 μL / well to the 96-well plate, and incubate them together at room temperature for 2 hours. h; (7) Washing: Wash the plate 5 times with 300 μL / well of washing solution and then dry the plate; (8) Color development: Add 200 μL / well of color development solution and let it stand at room temperature for 12 min; (9) Termination and detection: Add 50 μL / well of termination solution to terminate the reaction and then use an enzyme-linked immunosorbent assay (ELISA) reader to detect the reaction at a wavelength of 450 nm.

[0096] 5. Polyclonal antibody purification

[0097] 5.1 Sample Preparation

[0098] The collected rabbit blood was centrifuged using a benchtop centrifuge at 4200 r and 4℃ for 30 min. The serum was collected after centrifugation and filtered through a 0.45 μM filter membrane for later use.

[0099] 5.2 Antibody Purification

[0100] Rabbit serum was purified sequentially using protein A affinity purification and antigen affinity purification to harvest rabbit polyclonal antibodies. The operation steps are as follows.

[0101] 5.3 Affinity purification of protein A, the steps of which are as follows:

[0102] (1) Water equilibration: Wash with ultrapure water for 3 CV, and replace with 25% ethanol preservation solution; (2) Equilibrate the column: Equilibrate with 1X ACBinding for 5-10 CV; (3) Load the sample: Load the centrifuged and filtered serum; (4) Elute: Elute with elution buffer for 5-10 CV; (5) Elute: Elute with 1X AC Elution; (6) Neutralize: Add 2M Tris, pH 8.0 to neutralize the eluted antibody; (7) Equilibrate: Equilibrate with AC Binding for 3 CV to neutral; (8) CIP wash: CIP wash for more than 5 CV; (9) Rinse with alkali: Wash with ultrapure water for 5 CV; (10) Preservation: Equilibrate with 25% ethanol for 2 CV, and preserve the column.

[0103] 5.4 Antigen affinity purification, the steps of which are as follows:

[0104] (1) Water equilibration: Wash with ultrapure water for 3 CV, and replace with 25% ethanol preservation solution; (2) Equilibrate the column: Equilibrate with 1X ACBbinding for 5-10 CV; (3) Loading: Load the elution peak of purified Protein A onto the column; (4) Eluting: Eluting with elution buffer for 5-10 CV; (5) Elution: Elute with 1X AC Elution; (6) Neutralization: Add 2M Tris, pH 8.0 to neutralize the eluted antibody; (7) Equilibration: Equilibrate with AC Binding for 5-10 CV to neutral; (8) Water washing: Wash with ultrapure water for 5-10 CV; (9) Preservation: Equilibrate with 25% ethanol for 2 CV, and preserve the column.

[0105] 5.5 Antibody Identification

[0106] 5.5.1 Antibody concentration and purity detection

[0107] Start the micro-spectrophotometer and spot the sample with the corresponding buffer solution. When the absorbance value is within ±0.015 at 280 nm, the instrument baseline is stable. Spot the purified antibody sample sequentially and record the absorbance values. Divide the detection data by the IgG extinction coefficient (1.414) to obtain the concentration of the sample (mg / mL).

[0108] The purity of the purified antibody was verified using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). This method separates proteins of different molecular weights in the sample within the electrophoretic gel, thus verifying the purity of the target antibody. 5 μg of the sample was added to 5 μL of 4R / 4N buffer, heated in a 100°C water bath, and then centrifuged at 10,000 rpm. Sufficient 1×SDS electrode buffer was added to the electrophoresis tank, and the prepared sample solution and protein molecular weight standards were added to the wells using a micropipette. The power was connected, and electrophoresis was first performed at a constant voltage of 100 V until bromophenol blue dye entered the separating gel from the stacking gel. The current was then adjusted to 140 V, and electrophoresis continued until the bottom of the gel was reached. The power was then turned off. The gel was immersed in staining solution, heated in a microwave oven for 60 seconds, and then stained at room temperature on a gently agitated platform. Replace the decolorizing solution to cover the gel, heat in a microwave for 60 seconds, place on a gently shaking platform to decolorize at room temperature, and repeat the decolorization process until a blue band and a clean background are obtained.

[0109] 5.5.2 ELISA combined detection

[0110] The binding of purified rabbit polyclonal antibody to the antigen was detected using an indirect ELISA method. The detection principle is shown in the diagram above, and the detection procedure is as follows.

[0111] (1) Coating: The concentration of the coating antigen protein is 0.1 μg / mL, 1 μg / mL, 100 μL / well, and the coating is carried out overnight at 4 ℃; (2) Blocking: The liquid in the plate is shaken off and patted dry, 2% BSA, 300 μL / well, sealed and incubated at room temperature for 1 h; (3) Washing: 300 μL / well washing buffer, wash the plate twice, and pat dry the plate after the last wash; (4) Antibody dilution and loading: The antibody is diluted to 0.1 μg / mL, 100 μL is added to the corresponding well plate, mixed evenly, and reacted at room temperature for 2 h; (5) Washing: 300 μL / well washing buffer, wash the plate 3 times, and pat dry the plate after the last wash; (6) Secondary antibody incubation: Dilute Goat Anti-Rabbit IgG Fc / HRP secondary antibody to the working concentration, 100 μL / well, mix evenly, and incubate at room temperature for 1 h; (7) Washing: 300 μL / well washing buffer, wash the plate twice, and pat dry the plate after the last wash; μL / well washing solution, wash plate 3 times, and pat dry the last time; (8) color development: mix solution A and solution B in a 1:1 ratio, add 200 μL to each well, and incubate at room temperature in the dark for 20 min; (9) termination and detection: add 50 μL of termination solution to each well, and immediately measure the OD value at a wavelength of 450 nm.

[0112] The results are shown in Tables 1 and 2.

[0113] Table 1. Serum ELISA results after four immunizations (rP159)

[0114]

[0115] Table 2. Serum ELISA results after four immunizations (rP97-46-65)

[0116]

[0117] Figure 6 This is a Non-Reducing SDS-PAGE electrophoresis image of the purified rP97-46-65 antibody.

[0118] Figure 7 This is a Non-Reducing SDS-PAGE electrophoresis image of the rP159 purified antibody.

[0119] Part Two: Preparation and Application of the Haemophilus parasuis Surface Display Vector of the Present Invention

[0120] 1. First, we commissioned Sangon Biotech to synthesize the following plasmid:

[0121] pDL02-ompAm (SEQ ID NO.1)

[0122] pDL02-ompAm-P159 (SEQ ID NO.2)

[0123] pDL02-ompAm-P65 (SEQ ID NO.3)

[0124] pDL02-ompAm-P46 (SEQ ID NO.4)

[0125] 2. Natural transformation

[0126] TSB medium: Add 15 g Tryptone, 5 g Peptones soybean, and 5 g NaCl to 1 L of deionized water, adjust the pH to neutral, sterilize by steaming at 121℃ in an autoclave, and then store in a refrigerator at 4℃.

[0127] TSA medium: Add 40 g of Tryptone SOYA AGAR and 3 g of YEAST EXTRACT to 1 L of deionized water. Sterilize by steaming at 121℃ in an autoclave and then store at room temperature.

[0128] Haemophilus parasuis strain SC096 (a series of gene deletion mutant strains of HPS serotype 4 SC096, Zhang B, Feng S, et al. Serum resistance in Haemophilus parasuis SC096 strain requires term embryo protein P2 expression. FEMS Microbiol Lett, 2012, 326:109–115. Zhang B, He Y, et al. Cytolethal inhibiting toxin (CDT) of the Haemophilus parasuis SC096 strain contributes serorum resistance and adhesion to and invasion of PK-15 and PUVEC cells. Vet Microbiol, 2012, 157:237-242), was obtained from the National-Local Joint Engineering Laboratory for Zoonotic Disease Control Agents of South China Agricultural University.

[0129] 2.1 Preparation of naturally competent states

[0130] Activated Haemophilus parasuis strain SC096 was inoculated into 5 ml of TSB medium and cultured at 37°C on a shaker at 220 rpm until the bacterial culture OD... 600 When the bacterial concentration reaches approximately 1.60, 200 μL of bacterial suspension is spotted onto TSA medium, allowing it to form independent circular spots of about 100 mm. The sample is then incubated at 37°C for 13 hours. The suspension is resuspended in TSB medium, and the bacterial concentration is adjusted to 1 / 100 OD. 600 It is approximately 0.4.

[0131] 2.2 Natural Transformation of Fragments

[0132] 2.2.1 The synthesized plasmids pDL02-ompAm, pDL02-ompAm-P159, pDL02-ompAm-P46, and pDL02-ompAm-P65 were amplified using primers P3 and P4 to amplify the mycoplasma target gene fragment required for natural transformation.

[0133] P3: atACCGCTTGTgATGAAAAAATC (SEQ ID NO.5)

[0134] P4: TGAACTTGGATTTCAACACGG (SEQ ID NO.6);

[0135] Amplification results are visible Figures 8 to 11 ;

[0136] Figure 8 The image shows an electrophoresis diagram of the gene fragment of the Omp Am outer membrane protein, which is 1929 bp in length.

[0137] Figure 9 The image shows an electrophoresis diagram of the ompAm-P159 protein gene fragment, which is 2679 bp in length.

[0138] Figure 10 The image shows an electrophoresis diagram of the gene fragment of the ompAm-P65 protein, which is 2436 bp in length.

[0139] Figure 11 The image shows an electrophoresis diagram of the ompAm-P46 protein gene fragment, which is 2238 bp in length.

[0140] 2.2.2 After confirming the correct size by PCR, the gene was sent for first-generation sequencing. After confirming the absence of mutations, the target gene was recovered and purified using a DNA gel extraction kit.

[0141] The PCR primers used in this step are:

[0142] P5:CGTTAATGGGATAATAAGCATATTCTTG

[0143] P6: CCTACAGGATTACGCTTCTGC;

[0144] Figure 12 The image shows an electrophoresis diagram of the pDL02-ompAm gene fragment, which is 2315 bp in length.

[0145] Figure 13 The image shows an electrophoresis diagram of the pDL02-ompAm-P159 gene fragment, which is 3071 bp in length.

[0146] Figure 14 The image shows an electrophoresis diagram of the pDL02-ompAm-P65 gene fragment, which is 2822 bp in length.

[0147] Figure 15 The image shows an electrophoresis diagram of the pDL02-ompAm-P46 gene fragment, which is 2624 bp in length.

[0148] 2.2.3 The concentration of the recovered product was determined using an ultra-micro spectrophotometer;

[0149] 2.2.4 Take 20 μL of bacterial resuspension and add 2 μg of ompAm, ompAm-P159, ompAm-P65, and ompAm-P46 fragments respectively. Mix well and incubate at 37℃ for 10 min. Spot the mixture onto TSA medium, forming circular spots of about 10 mm, and incubate at 37℃. After 5 h of incubation, remove the bacteria and resuspend them in 100 μL of TSB medium. Spread the bacterial suspension onto TSA medium containing GM resistance.

[0150] 2.2.5 Place the plate in a 37℃ constant temperature incubator until the liquid is completely absorbed, invert the plate, and observe the results after 24-48 h of incubation.

[0151] 2.2.6 Once the bacteria have grown, select a single colony for culture PCR, and sequence the bacterial culture corresponding to the positive band; use the above-mentioned P3 and P4 primers for detection;

[0152] 2.2.7 After the sequencing results were verified to be correct, strains pDL02-sc096-ompAm, pDL02-sc096-ompAm-P159, pDL02-sc096-ompAm-P65, and pDL02-sc096-ompAm-P46 were obtained. At the same time, they were expanded and cultured, and the bacteria were freeze-dried and stored at -80℃.

[0153] 3. Identification of protein recombination displayed on surface carriers

[0154] The following are the WB results for strains pDL02-sc096-ompAm, pDL02-sc096-ompAm-P159, pDL02-sc096-ompAm-P65, and pDL02-sc096-ompAm-P46;

[0155] The method for WB testing is as follows:

[0156] (1) The collected bacterial cells were washed with PBS and then sampled. The samples were then incubated in a water bath at 100°C for 10 min and subjected to SDS-PAGE.

[0157] (2) After electrophoresis, the PVDF membrane was soaked in methanol solution for 5 min, and the transfer was started at 200 mA for 40 min.

[0158] (3) Wash off the residual transfer buffer on the membrane with PBST solution, and add rapid blocking solution to block at room temperature for 15 min;

[0159] (4) Wash away the blocking solution with PBST, cut the blocked membrane, and incubate it with the prepared primary antibody (rabbit anti-rP97-46-65 polyclonal antibody and rabbit anti-rP159 polyclonal antibody were prepared as above, diluted 1:1000; mouse anti-6×His monoclonal antibody, diluted 1:5000) overnight at 4℃;

[0160] (5) Wash away the primary antibody with PBST 4 times, 2 min each time, add the prepared secondary antibody (goat anti-rabbit IgG or goat anti-mouse IgG, 1:1000), and incubate at room temperature for 45 min;

[0161] (6) Wash away the secondary antibody with PBST 3 times, 5 min each time, and finally store the membrane in PBST solution;

[0162] (7) Mix the two components of the ECL colorimetric solution 1:1, drop it onto the membrane, and place it in an ultrasensitive chemiluminescence imaging instrument for development.

[0163] The primary antibodies used were rP159, rP97-46-65 polyclonal antibodies, and mouse anti-6×His monoclonal antibody, and the imaging bands were consistent with the predicted size.

[0164] Figure 16 The image shows the banding pattern of Sc096-ompAm. The primary antibody for Sc096-ompAm is 6×his, which can be used as a control group to identify the heterogeneous band on OmpAm. All the bands hybridized with 6his below show this heterogeneous band.

[0165] Figure 17 The image shows the bands of Sc096-ompAm-159. The primary antibody for Sc096-ompAm-159 is 6×his, which is used as a control group for comparison with the bands of the polyclonal antibody with primary antibody P97-46-65. Theoretically, the two target bands should be the same size.

[0166] Figure 18 The image shows the band pattern of Sc096-ompAm-159. The primary antibody for Sc096-ompAm159 is the polyclonal antibody p159. The target band is the same as the result of 6HIS, proving that the result was successful.

[0167] Figure 19 The image shows the bands of Sc096-ompAm-65. The primary antibody for Sc096-ompAm-65 is 6×his, which is used as a control group for comparison with the bands of the polyclonal antibody with primary antibody P97-46-65. Theoretically, the two target bands should be the same size.

[0168] Figure 20The image shows the bands of Sc096-ompAm-46. The primary antibody for Sc096-ompAm-46 is 6×his, which is used as a control group for comparison with the bands of the polyclonal antibody with primary antibody P97-46-65. Theoretically, the two target bands should be the same size.

[0169] Figure 21 The images show the contrast bands of Sc096-ompAm-46 and Sc096-ompAm-65. The primary antibody for Sc096-ompAm-46 and Sc096-ompAm-65 is the polyclonal antibody p97-46-65. The target bands are the same as those obtained with 6HIS, confirming the success of the results. 1 represents Sc096-ompAm-46; 2 represents Sc096-ompAm-65.

[0170] 4. Vaccine preparation

[0171] Four freeze-dried strains for seedling production were respectively:

[0172] Strains pDL02-sc096-ompAm, pDL02-sc096-ompAm-P159, pDL02-sc096-ompAm-P65, and pDL02-sc096-ompAm-P46 were inoculated into TSB-YE medium (containing 5% fetal bovine serum and 1% NAD) for resuscitation, and then transferred to TSA-YE medium and incubated at 37°C for 12 h. Single colonies were picked from TSA-YE medium and inoculated into TSB-YE medium (5 mL / tube), and incubated at 37°C with shaking at 200 rpm for 12 h. The cultures were then transferred 1:100 to fresh TSB-YE medium and incubated at 37°C with shaking at 200 rpm for 18 h. Bacterial counting and contamination testing were performed; the total bacterial count should reach 1.0 × 10⁻⁶. 9 CFU / mL.

[0173] Four strains of bacteria used for vaccine production were inactivated by incubating them in formaldehyde at a final concentration of 0.3% at 37°C for 24 hours. Then, 1 mL of the inactivated bacterial solution was inoculated into TSA-YE medium and incubated at 37°C for 24 hours. If no bacterial growth was observed, inactivation was considered complete, and the bacteria were used for vaccine preparation. Guinea pigs were divided into six groups and injected subcutaneously into their backs. Each group consisted of six guinea pigs.

[0174] Serum was collected from guinea pigs in the immunized group and the control group on day 0 and 21 after immunization using the orbital sinus blood collection method, with 6 guinea pigs in each group.

[0175] Immunological data are shown in Table 3;

[0176] Table 3 shows the immunization data for guinea pigs.

[0177]

[0178] The immunization results are as follows:

[0179] 4.1 Detection of the reactivity of immune serum with wild-type protein

[0180] To investigate whether antibodies induced in immunized guinea pigs can recognize native Mhp proteins, reference was made to the relevant literature (Marchioro SB, Simionatto S, Galli V, Conceição FR, Brum CB, Fisch A, GomesCK, Dellagostin OA. Production and characterization of recombinant transmembrane proteins from Mycoplasma hyopneumoniae. Vet Microbiol. 2012 Feb24;155(1):44-52. doi: 10.1016 / j.vetmic.2011.08.001. Epub 2011 Aug 7). The method (PMID:21890287.) was used to coat enzyme-labeled plates (10 μg / well) with crude extracts of strains pDL02-sc096-ompAm, pDL02-sc096-ompAm-P159, pDL02-sc096-ompAm-P65, and pDL02-sc096-ompAm-P46 as antigens. After adsorption overnight at 4°C, the plates were placed in a -80°C freezer for 2 hours, then thawed at room temperature before ELISA detection.

[0181] The primary antibody was serum collected on day 21, diluted 1:100. The secondary antibody was HRP-labeled goat anti-guinea pig IgG, diluted 1:1000. All serum samples were tested in triplicate, and the absorbance was measured at 450 nm.

[0182] Results Reference Figure 22 , Figure 22 In the study, when crude extracts of strains pDL02-sc096-ompAm, pDL02-sc096-ompAm-P159, pDL02-sc096-ompAm-P65, and pDL02-sc096-ompAm-P46 were used as antigens, the antibody levels in immunization groups III, IV, and V were significantly higher than those in the blank control group (P<0.0001), indicating successful immunization.

[0183] 4.2 Serum Antibody Level Analysis and Detection

[0184] The humoral immune response was reflected by measuring serum antibody levels using an indirect ELISA method. The specific ELISA procedure is described in section 4.1, with the difference that the ELISA plate was coated with prokaryotically expressed rP97-46-65 and rP159 (section 2.10 above) at a concentration of 0.1 μg / well. The primary antibody was serum collected on days 0 and 21, diluted 1:100 in both cases. The secondary antibody was HRP-labeled goat anti-guinea pig IgG, diluted 1:1000. All serum samples were tested in triplicate, and the absorbance was measured at 450 nm.

[0185] Results Reference Figures 23 to 27 On day 21, serum IgG levels of anti-rP65 and anti-rP159 were significantly higher than those in the blank control group (P<0.0001), while anti-rP46 IgG levels showed no significant difference compared to the blank control group (P>0.05). In both positive control groups, anti-sc096 and anti-sc096-ompA IgG levels were significantly higher than those in the blank control group (P<0.0001), indicating that only pDL02-sc096-ompAm-P65 and pDL02-sc096-ompAm-P159 successfully expressed mycoplasma antigens. Indirect ELISA results confirmed successful display of the surface display vectors pDL02-sc096-ompAm-P65 and pDL02-sc096-ompAm-P159.

[0186] Figure 22 A chart showing the results of the reactivity test between immune serum and wild-type protein;

[0187] Figure 23 A chart showing the results of total IgG level detection against rP159 antigen;

[0188] Figure 24 A chart showing the results of total IgG level detection against rP46 antigen;

[0189] Figure 25 A chart showing the results of total IgG level detection against rP65 antigen;

[0190] Figure 26 A chart showing the results of total IgG level detection against sc096 antigen;

[0191] Figure 27 The chart shows the results of the detection of total IgG levels against sc096-ompA antigen.

[0192] The core innovation of this invention lies in:

[0193] 1. This invention constructs the plasmid pDL02-ompAm, and based on this plasmid, the Mycoplasma hyopneumoniae membrane protein gene is linked to obtain a variety of plasmids. These plasmids can be combined with Haemophilus parasuis strain SC096 through natural transformation to obtain two surface display vectors pDL02-sc096-ompAm-P65 and pDL02-sc096-ompAm-P159 that can express Mhp antigen proteins.

[0194] 2. Based on the fundamental method of surface display carriers, this invention successfully realizes a surface display carrier with dual immune effects by using the uptake signal sequence USS through natural transformation.

[0195] It should be noted that the technology based on the uptake signal sequence USS has been applied in the applicant's earlier application CN105331601B, "A method for efficient genetic recombination of Haemophilus parasuis based on natural transformation and its application"; however, the transformation was a natural transformation of the target gene of the same strain, and there have been no reports on the natural transformation of the target gene of other strains.

[0196] The experiments of this invention also show that not all Mhp antigen protein genes can be successfully expressed.

[0197] 3. The successful construction of the surface display vector of the present invention is, in our opinion, inseparable from the following factors: the structure of the plasmid, the selection of the Mhp antigen protein gene, and the rational application of natural transformation technology based on uptake signal sequence.

[0198] This invention overcomes the drawbacks of existing technologies that require the use of bivalent inactivated vaccines to prepare vaccines, and it has good immunization effects and high immunization efficiency.

Claims

1. A plasmid, characterized in that, The plasmid contains the Haemophilus parasuis Omp Am outer membrane protein gene and the Mycoplasma hyopneumoniae membrane protein gene; the Mycoplasma hyopneumoniae membrane protein gene is either the Mycoplasma hyopneumoniae membrane protein P65 gene or the Mycoplasma hyopneumoniae membrane protein P159 gene; the nucleotides of the plasmid are shown in SEQ ID NO.2 or SEQ ID NO.

3.

2. A method for constructing a surface display vector for Haemophilus parasuis, characterized in that, The method involves natural transformation of the target gene and *Haemophilus parasuis* to obtain a recombinant strain of *Haemophilus parasuis* capable of expressing *Mycoplasma parasuis* antigen protein. The target gene is prepared by amplifying it from the plasmid as described in claim 1 using primers. The target gene contains the *Haemophilus parasuis* Omp Am outer membrane protein gene and the *Mycoplasma parasuis* membrane protein gene. The *Mycoplasma parasuis* membrane protein gene is either the *Mycoplasma parasuis* membrane protein P65 gene or the *Mycoplasma parasuis* membrane protein P159 gene. The upstream primer in the primer set contains a USS sequence.

3. The method for constructing the Haemophilus parasuis surface display vector according to claim 2, characterized in that, The sequences of the primers are shown in SEQ ID NO.5 and SEQ ID NO.

6.

4. A surface display vector for Haemophilus parasuis, characterized in that, It is prepared by the method described in claim 2 or 3.

5. Use of the Haemophilus parasuis surface display vector as described in claim 4 to prepare a vaccine; the vaccine is a vaccine against Haemophilus parasuis and Mycoplasma hyopneumoniae.

6. A vaccine, characterized in that, The vaccine contains an inactivated Haemophilus parasuis surface display vector as described in claim 4, and the vaccine is a vaccine against Haemophilus parasuis and Mycoplasma hyopneumoniae.

Images