VIGS vector for silencing Frankliniella occidentalis gene and application of VIGS vector

Abstract

The invention discloses a VIGS vector for silencing a Frankliniella occidentalis gene and application of the VIGS vector, and belongs to the technical field of gene engineering. According to the invention, a recombinant engineering bacterium is constructed by constructing a VIGS vector containing a Fusarium graminearum PH-1 / Tri5 gene specific nucleotide fragment and successfully transfecting the VIGS vector into the Fusarium graminearum PH-1 / Tri5 by utilizing a PEG (Polyethylene Glycol)-mediated Fusarium graminearum protoplast transfection method. The sRNA is extracted and separated by culturing recombinant engineering bacteria or a crude extract is prepared from hyphae, and the sRNA or the crude extract is sprayed on the Frankliniella occidentalis, so that the Frankliniella occidentalis can be effectively prevented and controlled. Therefore, the Frankliniella occidentalis ACT and SNF gene VIGS vector provided by the invention can provide a new technical support and direction for prevention and control of Frankliniella occidentalis.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to a VIGS vector for silencing genes of Frankliniella occidentalis and its application. Background Art

[0002] Virus-induced Gene Silencing (VIGS) is a powerful functional genomics tool. The VIGS technology is based on the host's RNA interference (RNAi) mechanism. When the host is infected by a virus, its RNAi system is activated to degrade the viral RNA. VIGS triggers the host RNAi system by introducing a recombinant viral vector containing a target gene fragment, generating virus-derived small RNAs (vsRNAs), which guide the RNA-induced silencing complex (RISC) to specifically degrade the mRNA of the target gene, thereby achieving gene silencing.

[0003] Frankliniella occidentalis is a crop pest with worldwide invasiveness, characterized by strong reproductive ability and short life cycle. It is a highly polyphagous species with a wide host range, including more than 500 kinds of plants such as chili peppers, tomatoes, cucumbers, cotton, and flowers. The sucking of larvae and adults can directly damage flower and leaf tissues, resulting in inhibited plant growth, reduced yield and quality, and it can also transmit various plant viruses. Currently, the control of Frankliniella occidentalis mainly relies on chemical insecticides, but excessive use of chemical insecticides has led to the development of resistance in Frankliniella occidentalis. Therefore, it is extremely important to develop new sustainable RNAi pesticides. Summary of the Invention

[0004] The object of the present invention is to provide a VIGS vector for silencing genes of Frankliniella occidentalis and its application, so as to solve the problems existing in the above-mentioned prior art. By constructing a VIGS vector for silencing genes of Frankliniella occidentalis and transferring it into Fusarium graminearum to construct a recombinant engineering bacterium, it is found that the sRNA extracted from the recombinant engineering bacterium or the crude extract prepared can significantly inhibit Frankliniella occidentalis, indicating that the VIGS vector constructed by the present invention can provide new technical support and direction for the prevention and control of Frankliniella occidentalis.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a VIGS vector for silencing genes of Frankliniella occidentalis, and the VIGS vector includes a specific nucleotide fragment of the ACT gene or the SNF gene of Frankliniella occidentalis. The specific nucleotide fragment of the ACT gene is shown as SEQ ID NO.1, and the specific nucleotide fragment of the SNF gene is shown as SEQ ID NO.2.

[0007] Preferably, the backbone of the VIGS vector comprises the p26-D4 vector.

[0008] The present invention also provides a recombinant engineered bacterium for silencing the genes of Frankliniella occidentalis, and the recombinant engineered bacterium comprises the VIGS vector described above.

[0009] The present invention also provides sRNA for silencing the genes of Frankliniella occidentalis, which is obtained by culturing the recombinant engineered bacterium and extracting and isolating it.

[0010] The present invention also provides a crude extract for silencing the genes of Frankliniella occidentalis, and the crude extract comprises the recombinant engineered bacterium described above.

[0011] Preferably, the crude extract is obtained by culturing the recombinant engineered bacterium and then grinding the mycelium with water.

[0012] The present invention also provides the application of the VIGS vector, the recombinant engineered bacterium, the sRNA or the crude extract described above in any one of the following:

[0013] (1) Application in controlling Frankliniella occidentalis;

[0014] (2) Application in controlling plant pests caused by Frankliniella occidentalis;

[0015] (3) Application in preparing a biological pesticide for controlling Frankliniella occidentalis.

[0016] The present invention also provides a biological pesticide for controlling Frankliniella occidentalis, which comprises the recombinant engineered bacterium, the sRNA or the crude extract described above.

[0017] The present invention also provides a method for silencing the genes of Frankliniella occidentalis, which comprises the step of contacting the sRNA or the crude extract with the larvae and / or adults of Frankliniella occidentalis.

[0018] The present invention also provides a method for controlling Frankliniella occidentalis, which comprises the step of contacting the sRNA or the crude extract with the larvae and / or adults of Frankliniella occidentalis.

[0019] The present invention discloses the following technical effects:

[0020] By constructing a VIGS vector containing a specific nucleotide fragment of the ACT or SNF gene of Frankliniella occidentalis and using the PEG-mediated protoplast transfection method of Fusarium graminearum to successfully transfect the VIGS vector into Fusarium graminearum PH-1 / Tri5, a recombinant engineered bacterium was constructed. By culturing the recombinant engineered bacterium to extract and isolate sRNA or preparing a crude extract using the mycelium, and spraying the sRNA or the crude extract on Frankliniella occidentalis, it was found that Frankliniella occidentalis could be effectively controlled. Therefore, the VIGS vector of the ACT and SNF genes of Frankliniella occidentalis provided by the present invention can provide new technical support and direction for the control of Frankliniella occidentalis. Brief Description of the Drawings

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0022] Figure 1 Schematic diagrams of p26-D4-GFP, p26-D4-ACT, and p26-D4-SNF vectors

[0023] Figure 2 Phenotypic comparison of PH-1 / Tri5 strains transfected with three VIGS vectors of p26-D4-GFP, p26-D4-ACT, and p26-D4-SNF

[0024] Figure 3 Electrophoresis detection map of sRNA extracted from PH-1 / Tri5 strains transfected with three VIGS vectors of p26-D4-GFP, p26-D4-ACT, and p26-D4-SNF; the 1st - 4th lanes from left to right correspond to Marker, p26-D4-GFP, p26-D4-ACT, and p26-D4-SNF respectively

[0025] Figure 4 Effects of three sRNAs on the lethality rate and gene expression of western flower thrips larvae; among them, A: Survival curve analysis of the lethality rate of different sRNAs on western flower thrips larvae during a 5-day observation period; B: Evaluation of the lethality rate of different sRNAs on western flower thrips larvae on the 5th day; C: Detection of the gene expression level of western flower thrips larvae after treatment with different sRNAs; WFT-L represents treatment of western flower thrips larvae

[0026] Figure 5 Effects of three sRNAs on the lethality rate and gene expression of western flower thrips adults; among them, A: Survival curve analysis of the lethality rate of different sRNAs on western flower thrips adults during a 5-day observation period; B: Evaluation of the lethality rate of different sRNAs on western flower thrips adults on the 5th day; C: Detection of the gene expression level of western flower thrips adults after treatment with different sRNAs; WFT-A represents treatment of western flower thrips adults

[0027] Figure 6To evaluate the lethality of crude extracts produced by carrying different VIGS vector strains against Frankliniella occidentalis larvae; among them, A: On the 6th day, evaluate the lethality of 1-fold crude extracts of p26-D4-ACT and p26-D4-SNF VIGS vector strains against Frankliniella occidentalis larvae; B: On the 6th day, evaluate the lethality of 100-fold crude extracts of p26-D4-ACT and p26-D4-SNF VIGS vector strains against Frankliniella occidentalis larvae; C: On the 6th day, evaluate the lethality of 10,000-fold crude extracts of p26-D4-ACT and p26-D4-SNF VIGS vector strains against Frankliniella occidentalis larvae. Detailed implementation manners

[0028] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0029] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0030] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0031] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are only exemplary.

[0032] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0033] Example 1 A method for controlling Frankliniella occidentalis using the technology of virus-induced gene silencing (VIGS) by fungi

[0034] 1. Experimental materials

[0035] (1) Western flower thrips: The larvae and adults of western flower thrips were used as experimental subjects.

[0036] (2) VIGS vector: The p26-D4 vector was used, which contains a cloning site for inserting the target gene fragment. This vector has been disclosed in the invention patent "CN202310441503.1 A fungal virus-induced gene silencing vector and its construction method and application".

[0037] (3) Target gene fragment: The ACT and SNF genes of western flower thrips were used as target genes, and the specific gene fragment sequences are shown in SEQ ID NO.1-2.

[0038] (4) Fungal strain: DON is a type of trichothecene mycotoxin produced by Fusarium fungi, which is toxic to both plants and animals. The expression of the Tri5 gene is closely related to the synthesis of DON toxin, and it is the key enzyme for the first step of DON toxin synthesis. By knocking out the Tri5 gene, the pathogenicity of the pathogen can be significantly reduced. Therefore, the Tri5 gene knockout mutant strain PH-1 / Tri5 (this mutant strain has been disclosed in the following literature: Brown D W, McCormick S P, Alexander NJ, et al. A genetic and biochemical approach to study trichothecene diversity in Fusarium sporotrichioides and Fusarium graminearum.) was selected to mediate the VIGS vector.

[0039] (5) Medium: PDA medium was used for culturing fungi.

[0040] 2. Construction of VIGS vector

[0041] (1) Gene fragment cloning: The target gene sequence with a coding region length of 150 bp was selected, and specific F and R primers (Table 1) were designed according to the sequence. The target gene fragment was specifically amplified using PCR technology, and the amplification conditions are shown in Table 2 - Table 3; the target fragment was recovered using an agarose gel recovery kit.

[0042] The fragment of the target gene (ACT) is as shown in SEQ ID NO.1:

[0043] ACACCATCACCAGAATCCAAGACGATACCAGTGGTACGACCAGAGGCATACAGGGAAAGGACAGCCTGGATGGCGACGTACATGGCGGGTGTGTTGAAGGTCTCAAACATAATCTGTGTCATCTTTTCCCTGTTGGCTTTAGGGTTCAGG。

[0044] The fragment of the target gene (SNF) is shown in SEQ ID NO.2:

[0045] CTTCATATTTGAGCTTCGAAGTTTAATCAAAATTTGGGACTTATTAGTCTTATCAATGTCTTGATCAGTAACAGCTGCATACCCCTGGTACTGTAGATAATATGCTATAAACCTGGCATCAGTAGAAGGTACATTTTCCATACCACAAGC。

[0046] Table 1 Primers for amplifying specific sequences of Frankliniella occidentalis

[0047]

[0048] Table 2 PCR reaction system

[0049]

[0050] Table 3 PCR reaction program

[0051]

[0052] (2) Construction of VIGS vector: The target fragment was inserted into the p26-D4 vector by homologous recombination method to obtain p26-D4-ACT and p26-D4-SNF vectors (see Figure 1 ). The recombinant ligation reaction system is shown in Table 4.

[0053] Table 4 Recombinant ligation reaction system

[0054]

[0055] After mixing according to the above reaction system, the recombinant reaction was carried out under the reaction conditions of 50 °C for 5 min.

[0056] 3. Fungal-mediated transfection of VIGS vector

[0057] PEG-mediated method for protoplast transfection of Fusarium graminearum (refer to the invention patent "CN202310441503.1 A gene silencing vector induced by a fungal virus, its construction method and application") was used to transfect the VIGS silencing vector into the knockout mutant strain PH-1 / Tri5, and the correct transfectants were screened by PCR detection. The transfection of PH-1 / Tri5 with the p26-D4-GFP vector (see Figure 1 ) was used as a control.

[0058] Table 5 Primers for detecting transfectants

[0059]

[0060] 4. Control experiment of western flower thrips

[0061] (1) Extraction of sRNA: The transfected fungi were cultured (the phenotypes of the three transfected strains of p26-D4-ACT, p26-D4-SNF, and p26-D4-GFP are shown in Figure 2 ). The miRcute miRNA extraction and isolation kit (DP501) from Tiangen Biochemical Co., Ltd. was used to extract sRNA, and electrophoresis detection of sRNA was carried out.

[0062] (2) Preparation of crude extract: The transfected fungi were cultured, 7.5 g of mycelia were weighed, and after being fully ground with liquid nitrogen, 100 mL of ddH2O was added to obtain the crude extract stock solution. Then the crude extract stock solution was diluted 100 times and 10,000 times to finally obtain three different concentrations of crude extracts.

[0063] (3) Control experiment: sRNA and crude extracts with different concentrations were sprayed on western flower thrips larvae and adults respectively to ensure that the western flower thrips larvae and adults were fully exposed to sRNA or crude extracts with different concentrations. The survival rate was observed and counted every day, and a certain number of western flower thrips were selected within the specified time for detection and analysis of gene expression levels by qPCR. The primers for qPCR detection are shown in Table 6, and the detection conditions are shown in Tables 7 - 8.

[0064] Table 6 Primers for qPCR

[0065]

[0066] Table 7 qPCR reaction system

[0067]

[0068] Table 8 qPCR reaction program

[0069]

[0070] The results showed that sRNA could be successfully extracted from the strains transfected with different VIGS vectors (see Figure 3 ). After treating Frankliniella occidentalis with sRNA and observing for 5 days, survival curves were plotted, gene expression levels were detected by fluorescence quantitative method, and mortality rates were evaluated (see Shi B, He H, Zhao C, Lei C, Li J, Yan FM. Potential of Virus-MediatedRNAi of Insect Genes in Plants to Control Aphids for details). The results showed that the sRNAs produced by p26-D4-ACT and p26-D4-SNF both significantly increased the mortality rates of the larvae and adults of Frankliniella occidentalis, and the gene expression levels were also significantly decreased, indicating that p26-D4-ACT and p26-D4-SNF could effectively control Frankliniella occidentalis (see Figure 4 and Figure 5 ).

[0071] Compared with the control (water) treatment, after treating with crude extracts at different concentrations, it was found that: on the 6th day, the mortality rates of the larvae of Frankliniella occidentalis were significantly increased under the treatments with crude extracts at 1-fold and 100-fold concentrations, and under the 10,000-fold treatment, the sRNA of p26-D4-ACT still had a significant effect (see Figure 6 ).

[0072] The embodiments described above are only used to describe the preferred mode of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solution of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A VIGS vector for silencing genes of Frankliniella occidentalis, characterized in that, The VIGS vector comprises a specific nucleotide fragment of the Frankliniella occidentalis ACT gene or SNF gene, the specific nucleotide fragment of the ACT gene is as shown in SEQ ID NO.1, and the specific nucleotide fragment of the SNF gene is as shown in SEQ ID NO.

2.

2. The VIGS vector according to claim 1, characterized in that, The backbone of the VIGS vector comprises the p26-D4 vector.

3. Recombinant engineering bacteria for silencing genes of Frankliniella occidentalis, characterized in that, The recombinant engineering bacterium comprises the VIGS vector according to claim 1 or 2.

4. sRNA for silencing the gene of Frankliniella occidentalis, characterized in that, It is obtained by culturing the recombinant engineering bacterium according to claim 3 and extracting and separating.

5. The crude extract of the gene silencing Frankliniella occidentalis, characterized in that, The crude extract comprises the recombinant engineering bacterium according to claim 3.

6. The crude extract according to claim 5, characterized in that, The crude extract is obtained by culturing the recombinant engineering bacterium and then grinding the mycelium with water.

7. Use of the VIGS vector according to any one of claims 1-2, the recombinant engineering bacterium according to claim 3, the sRNA according to claim 4, or the crude extract according to any one of claims 5-6 in any one of the following: (1) Use in controlling Frankliniella occidentalis; (2) Use in controlling plant pests caused by Frankliniella occidentalis; (3) Use in preparing a biological pesticide for controlling Frankliniella occidentalis.

8. A biological pesticide for preventing and controlling Frankliniella occidentalis, characterized in that, Comprises the recombinant engineering bacterium according to claim 3, the sRNA according to claim 4, or the crude extract according to any one of claims 5-6.

9. A method for silencing genes of western flower thrips, characterized in that, Comprises the step of contacting the Frankliniella occidentalis larvae and / or adults with the sRNA according to claim 4 or the crude extract according to any one of claims 5-6.

10. A method for preventing and controlling Frankliniella occidentalis, characterized in that, Comprises the step of contacting the Frankliniella occidentalis larvae and / or adults with the sRNA according to claim 4 or the crude extract according to any one of claims 5-6.

Images