Application of TaDREB11 gene in cultivation of drought-resistant wheat variety

By overexpressing the TaDREB11 gene in wheat, the problem of insufficient tolerance in wheat in drought adversity is solved, the cultivation of wheat drought-tolerant varieties is achieved, and the tolerance of wheat to drought stress is enhanced.

CN120366363APending Publication Date: 2025-07-25NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510401570.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-01
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

The prior art has not yet effectively utilized the TaDREB11 gene to cultivate drought-tolerant varieties in wheat, resulting in insufficient tolerance in wheat in drought adversity.

Method used

Through genetic engineering technology, the nucleotide sequence of the TaDREB11 gene is transformed into wheat cells to overexpress the TaDREB11 protein. The TaDREB11 gene is overexpressed in wheat plants using Agrobacterium-mediated genetic transformation method to enhance its drought tolerance.

Benefits of technology

Overexpression of TaDREB11 gene significantly improves the drought tolerance of wheat, enhances the tolerance of wheat to drought stress, and provides a new method for breeding of drought-tolerant varieties in wheat.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366363A_ABST
    Figure CN120366363A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of biological agriculture, and particularly relates to application of a TaDREB11 gene in cultivation of drought-resistant wheat varieties. The invention provides a cultivation method of a TaDREB11 transgenic wheat drought-enduring variety, a nucleotide sequence of a TaDREB11 gene is transformed into receptor wild type wheat by adopting a gene recombination technology, a TaDREB11 transgenic wheat strain of which the drought-enduring capability is higher than that of the wild type wheat is created, and the nucleotide sequence of the TaDREB11 gene is as shown in SEQ ID NO: 1. The protein coded by the TaDREB11 gene is the TaDREB11 protein, and the amino acid sequence of the TaDREB11 protein is as shown in SEQ ID NO: 2; through verification, the drought resistance of TaDREB11 transgenic wheat is enhanced, it is determined that the TaDREB11 gene plays a positive regulation role in drought stress, and a new gene resource is provided for stress-resistant wheat breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biological agriculture, and particularly relates to the application of TaDREB11 gene in cultivating drought-resistant wheat varieties. Background Art

[0002] Drought stress is an important obstacle to wheat growth and development. Therefore, studying the molecular mechanism of wheat under drought stress is of great significance for screening excellent genes for wheat to adapt to drought climate and breeding drought-resistant varieties.

[0003] Transcription factors are DNA binding proteins that can specifically interact with cis-acting elements in the promoter region of eukaryotic genes, activating or inhibiting transcription through interactions between them and other related proteins. The DNA binding region of the transcription factor determines its specificity in binding to the cis-acting element, while the transcriptional regulatory region determines whether it activates or inhibits gene expression.

[0004] AP2 / ERF transcription factors are the main transcription factor family involved in plant stress response. AP2 / ERF transcription factors are divided into five subfamilies, namely AP2, ERF, DREB, RAV and Soloist subfamilies. DREB is an important member of the AP2 / ERF transcription factor family. The transcription factors of this subfamily have only one AP2 domain. In plants, DREB transcription factor family genes do not contain introns, and the N-terminal and C-terminal protein sequences have no significant similarity. Only the DNA binding domain is highly homologous. DREB transcription factors can bind to DRE cis-acting elements to regulate downstream gene expression. When various abiotic stresses stimulate plants, the signaling pathways involved in stress are activated. This activation is usually related to the expression of plant transcription factors. When plants are subjected to adverse stress, overexpression of a single DREB family gene can enhance plant tolerance.

[0005] Although the functions of genes such as DREB1, DREB2, and DREB3 have been reported in the literature, the regulatory effects of different subtypes of DREB genes in different species are unpredictable. In addition, the wheat genome is complex and it is difficult to create transgenic wheat plants. So far, there have been no reports on the use of the TaDREB11 gene in the breeding of drought-resistant transgenic wheat varieties. Summary of the invention

[0006] The present invention aims to further explore the response mechanism of wheat to abiotic stress stimuli, to explore the transcription factor genes that play a regulatory role in wheat under drought stress, and to provide a new path for creating drought-resistant wheat materials using the transcription factors by conducting gene function research.

[0007] For the above purposes, on the one hand, the present invention discloses the application of the TaDREB11 gene in cultivating drought-tolerant wheat varieties.

[0008] To understand the technical solution of the present invention completely and without objection, it should be added that the TaDREB11 gene described in the present invention is represented by the italicized font "TaDREB11", and the TaDREB11 protein is represented by the non-italicized font "TaDREB1". Of course, those of ordinary skill in the art can clearly and completely understand the meanings and expressions of the relevant genes and their encoded proteins according to the description of the present invention.

[0009] Furthermore, in the application of the TaDREB11 gene in cultivating drought-tolerant wheat varieties, the TaDREB11 gene is transformed into wheat cells to obtain drought-tolerant transgenic wheat varieties.

[0010] Furthermore, in the application of the TaDREB11 gene in cultivating drought-tolerant wheat varieties, the amino acid sequence of the TaDREB11 protein is as shown in SEQ ID NO: 2; the nucleotide sequence of the TaDREB11 gene is as shown in SEQ ID NO: 1.

[0011] Furthermore, in the application of the TaDREB11 gene in cultivating drought-tolerant wheat varieties, the nucleotide sequence of the TaDREB11 gene is expressed by Agrobacterium-mediated genetic transformation and has a positive regulatory effect in the drought stress response of wheat. Overexpression of the nucleotide sequence of the TaDREB11 gene can enhance the drought tolerance of wheat.

[0012] Furthermore, in the application of the TaDREB11 gene in cultivating drought-tolerant wheat varieties, overexpression of the TaDREB11 protein in wheat can enhance the drought tolerance of wheat.

[0013] On the other hand, the present invention discloses a method for cultivating drought-tolerant wheat varieties.

[0014] Furthermore, the method for cultivating drought-tolerant wheat varieties is to express the TaDREB11 protein in wheat or transfer the nucleotide sequence of the TaDREB11 gene into wheat.

[0015] Furthermore, the method for cultivating drought-tolerant wheat varieties includes: transforming the nucleotide sequence of the TaDREB11 gene into wheat cells to obtain a wheat variety transgenic for the TaDREB11 gene.

[0016] Furthermore, the method for cultivating drought-tolerant wheat varieties includes: constructing an overexpression vector of the TaDREB11 gene using the pANIC-6E vector; transforming the young embryos of wheat by the Agrobacterium-mediated genetic transformation method to obtain a wheat variety transgenic for the TaDREB11 gene.

[0017] Furthermore, a method for cultivating drought-tolerant wheat varieties includes the following steps:

[0018] Step 1: Prepare an overexpression vector of the TaDREB11 gene.

[0019] Step 2: Prepare Agrobacterium competent cells.

[0020] Step 3: Transfer the overexpression vector of the TaDREB11 gene into wheat immature embryos using Agrobacterium competent cells to obtain TaDREB11 transgenic wheat varieties.

[0021] Step 4: Identify TaDREB11 transgenic wheat varieties.

[0022] Furthermore, the identification method of TaDREB11 transgenic wheat varieties mainly uses BASTA patches and qRT-PCR to detect the expression of the TaDREB11 gene in transgenic wheat.

[0023] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0024] (1) Through gene function research, the present invention discovers that the TaDREB11 gene plays a positive regulatory role in the drought stress response of wheat, that is, overexpression of the TaDREB11 gene nucleotide sequence can improve the drought tolerance of wheat. When the nucleotide sequence of the TaDREB11 gene is overexpressed in wheat, it can endow wheat with certain drought tolerance performance.

[0025] (2) The present invention provides a method for cultivating drought-tolerant wheat varieties. This method uses genetic engineering technology to overexpress the TaDREB11 gene in wheat plants and enhance the tolerance of wheat to drought stress. It has been verified that the drought tolerance of TaDREB11 transgenic wheat obtained by the method of the present invention is improved. The present invention provides a new technical idea for cultivating drought-tolerant wheat varieties from the perspective of molecular biology and effectively solves the technical problems of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is the PCR amplification electrophoresis diagram of the TaDREB11 gene in Example 1.

[0027] Figure 2 It is the vector map of pANIC-6E-TaDREB11-OE.

[0028] Figure 3 It is the identification of positive plants of TaDREB11 transgenic wheat.

[0029] Figure 4 It is the drought phenotype of TaDREB11 transgenic wheat.

[0030] Figure 5 For the survival rate of TaDREB11 transgenic wheat under drought stress.

[0031] Figure 6 For the response mechanism of TaDREB11 transgenic wheat under drought stress. A. Peroxidase activity under drought stress; B. Malondialdehyde content under drought stress; C. Catalase activity under drought stress; D. Superoxide dismutase activity under drought stress; E. Proline content under drought stress. Detailed implementation manners

[0032] Next, the technical solutions of the present invention will be described in conjunction with the embodiments. However, the present invention is not limited to the following embodiments.

[0033] In order to enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and drawings, but the embodiments cited are not intended to limit the present invention.

[0034] In the following embodiments, the experimental methods and detection methods, unless otherwise specified, are all conventional methods; the reagents and materials, unless otherwise specified, can all be purchased on the market.

[0035] Experimental materials: Common wheat variety Fielder.

[0036] Example 1

[0037] This example is to clone the TaDREB11 gene.

[0038] Wheat seed germination:

[0039] Take an appropriate amount of plump Chinese Spring seeds (from the Laboratory of Crop Stress Resistance and High-Efficiency Production, Northwest A&F University), soak them in tap water in a petri dish with wet filter paper, and grow them in a light incubator at 16°C - 18°C. Keep the filter paper moist during this period. When the wheat grows to about 10 cm, collect the wheat leaves to extract RNA.

[0040] Extraction of wheat RNA:

[0041] (1) Take an appropriate amount of wheat tissue material, grind it thoroughly in a mortar, and put the grinding product into a 1.5 mL centrifuge tube.

[0042] (2) Add 1 mL of RNAiso Plus Trizols to each centrifuge tube and vortex to form a homogenate.

[0043] (3) After thorough mixing, let it stand at room temperature for 5 min, and then centrifuge at 12000 rpm for 10 min in a 4°C centrifuge.

[0044] (4) Transfer the supernatant to another centrifuge tube, add 200 μL of chloroform, invert and mix well, let it stand at room temperature for 5 min, and centrifuge at 12,000 rpm for 10 min at 4 °C;

[0045] (5) Transfer the supernatant to a new centrifuge tube, add an equal volume of isopropanol as the supernatant, and let it stand in a -20 °C refrigerator for 1 - 2 h;

[0046] (6) Centrifuge at 12,000 rpm for 10 min at 4 °C, discard the supernatant, and retain the precipitate;

[0047] (7) Add 1 mL of 75% ethanol to the precipitate to wash the precipitate, pipette several times with a pipette tip, centrifuge at 12,000 rpm for 5 min at 4 °C, and remove the supernatant;

[0048] (8) Repeat the previous step;

[0049] (9) After removing the supernatant, centrifuge briefly, gently suck off the residual ethanol with a yellow pipette tip, open the centrifuge tube and let it dry in a fume hood; when there is no residual liquid at the bottom of the centrifuge tube, add an appropriate amount of DEPC-treated water to obtain an RNA solution;

[0050] (10) Measure the quality and concentration of RNA and store it at -80 °C.

[0051] RNA reverse transcription into cDNA:

[0052] (1) Use the TransGen kit for reverse transcription, with a 20 μL system. First, add reagents according to the following ratios:

[0053] Total RNA (4 μg);

[0054] Anchored Oligo(dT)18 Primer (μg / μL) (1 μL);

[0055] RNase-free Water (add to 8 μL);

[0056] (2) After mixing, incubate with a PCR instrument at 65 °C for 5 min, ice bath for 2 min, and then add the following reaction components:

[0057] 2×ES Reaction Mix (10 μL);

[0058] RT / RI Enzyme Mix (1 μL);

[0059] gDNA Remover (1 μL);

[0060] (3) Extend at 42 °C for 30 min, heat at 85 °C for 30 s to inactivate the enzyme, and obtain cDNA.

[0061] Gene cloning:

[0062] The above reverse transcription product was amplified using the following primers.

[0063] TaDREB11-F: 5’CACCAAGAACACCAACCATAGAAA 3’;

[0064] TaDREB11-R: 5’GCCGCCAGTGGATAGGAGAC 3’.

[0065] The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 30 s, for 36 cycles; final extension at 72°C for 10 min, incubation at 12°C.

[0066] The PCR electrophoresis result of the amplified TaDREB11 gene was as Figure 1 shown, and the size of the TaDREB11 gene was 510 bp.

[0067] The TaDREB11 gene fragment was subjected to Sanger sequencing to determine that the PCR product had the nucleotide sequence shown in SEQ ID NO: 1.

[0068] Example 2

[0069] This example was to construct an overexpression vector of the TaDREB11 gene.

[0070] According to the multiple cloning sites of the pUN1301-TaDREB11-3xflag vector and the intermediate vector pENTR-MBD, the available restriction enzyme sites of the TaDREB11 gene with a 3xflag tag were searched using Primer5 software. Finally, the Kpn I site was selected upstream and the BamH I site was selected downstream to design homologous recombination primers. The primers were as follows:

[0071] MBD-DREB11-OE-F:

[0072] 5’CGCCCCCTTCACCGGTACCATCCCCAAAGCAATTTCCAA 3’;

[0073] MBD-DREB11-OE-R:

[0074] 5’CGCGCCCACCCTTGGATCCTCACTTGTCATCGTCATCCT 3’.

[0075] Construct pENTR-MBD-TaDREB11-3xflag by homologous recombination method. The constructed pENTR-MBD-TaDREB11-3xflag vector was transformed into Escherichia coli Top10. To obtain the terminal expression vector pANIC-6E-TaDREB11-OE, the intermediate vector pENTR-MBD-TaDREB11-3xflag and pANIC-6E vector were subjected to LR reaction with LR enzyme. The reaction system is as follows:

[0076] Entry clone 150 ng pANIC-6E 150 ng LR enzyme 1 μL ddH2O to 5 μL

[0077] The above reaction system was incubated at 25 °C overnight for ligation. The constructed overexpression vector pANIC-6E-TaDREB11-OE was transformed into Escherichia coli Top10. After sequencing verification, the overexpression vector pANIC-6E-TaDREB11-OE was obtained. The vector map of pANIC-6E-TaDREB11-OE is as Figure 2 shown.

[0078] Example 3

[0079] This example is to construct TaDREB11 transgenic wheat varieties.

[0080] The recombinant plasmid pANIC-6E-TaDREB11-OE prepared in Example 2 was transformed into Agrobacterium tumefaciens EHA105 competent cells. Using the wheat variety fielder as the receptor material, select well-grown young embryos and plump wheat seeds, place them in a sterile conical flask, disinfect with 70% alcohol for 2 min, wash three times with sterile water, disinfect with 2.5% sodium hypochlorite for 20 min, and wash six times with sterile water; Take out the young embryos of wheat seeds in a laminar flow hood, place them on the induction medium, and culture them in the dark at 24 °C for about 10 d to obtain callus. Subsequently, the method of Agrobacterium infection of callus was used to obtain TaDREB11 transgenic wheat varieties.

[0081] Example 4

[0082] This example is the identification of TaDREB11 transgenic wheat positive plants

[0083] The TaDREB11 transgenic wheat positive plants obtained in Example 3 were identified. The positive transgenic plants were identified by using the BASTA positive screening method combined with qRT-PCR to detect the expression level of the endogenous TaDREB11 gene in transgenic plants.

[0084] BASTA patch method: Cut the leaves of the same part of wild-type wheat and transgenic wheat, divide them into 3 pieces and flatten them on an agar plate with a glufosinate concentration of 0.05%. After standing for 72 h, observe the leaf color. Among them, the leaves of negative plants and wild-type plants turn yellow, while the positive plants remain green.

[0085] qRT-PCR detection method:

[0086] Using the qRT-PCR method, with the following primers:

[0087] TaDREB-Q-F: 5'GCTCTGGCTCGGAACCT 3'

[0088] TaDREB-Q-R: 5'GATGGTGCGGGAGATGA 3'

[0089] Perform qRT-PCR detection on the positive plants verified by BASTA screening to identify the expression of the transferred gene TaDREB11. The results are as Figure 3 shown. Finally, the plants that are positive in both screening methods are regarded as positive plants.

[0090] Example 5

[0091] This example is an evaluation experiment on the drought tolerance of TaDREB11 transgenic wheat.

[0092] Planting and screening of T2 generation TaDREB11 transgenic wheat plants:

[0093] Select a number of wild-type wheat seeds and T2 generation TaDREB11 transgenic lines (TaDREB11-OE3, TaDREB11-OE5, TaDREB11-OE11, TaDREB11-OE12, TaDREB11-OE14) wheat seeds that are plump, mold-free and of the same size. Soak them overnight in a petri dish containing distilled water, and then place the seeds on the agar medium and germinate them in a light incubator for 1-2 days. Transfer the germinated wheat seeds with white tips to a 25°C incubator (16 h of light and 8 h of darkness) and culture them with a 1:1 mixture of nutrient soil and seedling substrate. When the soil-grown seeds grow to the two-leaf and one-heart stage, perform BASTA positive screening on the TaDREB11 transgenic line plants. Take the leaves of the same part, cut them into 3 square pieces and flatten them on the medium. Take pictures and record after 48 h and 72 h. The plants with yellowing leaves do not have Bar resistance and are identified as negative plants. The plants with unchanged green leaf color are identified as transgenic positive plants for subsequent experiments. When the wheat seedlings grow for about 2 weeks, transfer them to a culture pot without holes for cultivation.

[0094] Drought stress analysis experiment of TaDREB11 transgenic wheat plants:

[0095] When the T2 generation of TaDREB11 transgenic wheat obtained by the above screening was grown in soil for one month, drought treatment was carried out without watering under the conditions of an artificial climate chamber (16 h light / 8 h dark, temperature 22 °C / 18 °C, light intensity 4000 lx, relative humidity 50%). When the wheat showed phenotypes such as leaf wilting and plant death as the critical point of drought stress, rewatering was carried out (using the drought phenotype of WT as the reference standard for rewatering). Three days after rewatering, the survival rate of each line was counted and the phenotypes were photographed and recorded. Plants that showed normal growth were defined as surviving plants, and plants that showed severe drought damage and could not grow normally were defined as dead plants.

[0096] Under drought stress conditions, the leaves of wild-type plants showed obvious wilting phenotypes, while TaDREB11 transgenic plants showed mild drought stress phenotypes. When the wheat seedlings reached the critical point of natural drought stress, rewatering treatment was carried out. The results were as Figure 4 shown. The results showed that TaDREB11 transgenic plants (TaDREB11-OE group) recovered to the normal growth state faster than wild-type plants (WT group). The survival rate after rewatering was as Figure 5 shown, showing that the survival rates of TaDREB11 transgenic lines (TaDREB11-OE3 and TaDREB11-OE14) were higher than those of wild-type plants (WT). It was indicated that under drought stress, TaDREB11 transgenic wheat had better drought tolerance than wild-type wheat.

[0097] Determination of physiological and biochemical indexes of TaDREB11 transgenic wheat plants:

[0098] To further explore the reasons for the enhanced drought tolerance of TaDREB11 transgenic wheat, samples were taken before drought as the control group and samples were taken about 7 d after drought as the treatment group to determine the proline content (Pro content), malondialdehyde (MDA) content, and the activities of three enzymes, superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD) in the plants before and after drought.

[0099] The results were as Figure 6 shown. The results showed that after drought stress treatment, the malondialdehyde (MDA) content of TaDREB11 transgenic lines was significantly lower than that of wild-type plants, indicating that the degree of damage suffered by TaDREB11 transgenic lines under drought stress was lower than that of wild-type plants. Moreover, the activities of the three enzymes (SOD, CAT, POD) of TaDREB11 transgenic lines (TaDREB11-OE3 and TaDREB11-OE14) were higher than those of wild-type lines (WT), suggesting that TaDREB11 transgenic plants might respond to drought by increasing enzyme activities.

[0100] In summary, the drought tolerance assessment experiment of TaDREB11 transgenic wheat provided in this embodiment involves planting and screening T2 generation TaDREB11 transgenic wheat plants, subjecting the screened TaDREB11 transgenic positive plants and wild-type "Fielder" plants to drought treatment. Under drought stress conditions, the TaDREB11 transgenic wheat lines can recover to the normal growth state faster than the wild-type wheat lines after re-watering at the stress critical point of drought stress, and the survival rate of the TaDREB11 transgenic wheat lines is higher than that of the wild-type wheat lines. This indicates that the TaDREB11 transgenic wheat lines have better drought tolerance than the wild-type wheat lines. After drought stress treatment, the malondialdehyde (MDA) content of the TaDREB11 transgenic wheat lines is significantly lower than that of the wild-type wheat, indicating that the degree of damage suffered by the TaDREB11 transgenic wheat lines under drought stress is lower than that of the wild-type. The activities of three enzymes (SOD, CAT, POD) in the TaDREB11 transgenic wheat lines are all higher than those of the wild-type, suggesting that the TaDREB11 transgenic wheat plants may respond to drought by increasing enzyme activity.

[0101] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Application of TaDREB11 gene in cultivating drought-tolerant wheat varieties, characterized in that, The TaDREB11 gene is transformed into wheat cells to obtain a drought-tolerant transgenic wheat variety.

2. Use of the TaDREB11 gene according to claim 1 in cultivating drought-tolerant wheat varieties, characterized in that The nucleotide sequence of the TaDREB11 gene is as shown in SEQ ID NO: 1, and the protein encoded by the TaDREB11 gene is the TaDREB11 protein, and the amino acid sequence of the TaDREB11 protein is as shown in SEQ ID NO:

2.

3. Use of the TaDREB11 gene according to claim 2 in cultivating drought-tolerant wheat varieties, characterized in that, The nucleotide sequence of the TaDREB11 gene is expressed by Agrobacterium-mediated genetic transformation and has a positive regulatory role in the drought stress response of wheat. Overexpressing the nucleotide sequence of the TaDREB11 gene enhances the drought tolerance of wheat.

4. Use of the TaDREB11 gene according to claim 2 in cultivating drought-tolerant wheat varieties, characterized in that, Overexpressing the TaDREB11 protein in wheat can enhance the drought tolerance of wheat.

5. A method for cultivating drought-tolerant wheat varieties, characterized in that, Expressing the TaDREB11 protein described in claim 2 in wheat or transferring the nucleotide sequence of the TaDREB11 gene described in claim 2 into wheat.

6. The wheat drought-tolerant variety cultivation method according to claim 5, characterized in that, Including: Transforming the nucleotide sequence of the TaDREB11 gene into wheat cells to obtain a wheat variety transgenic for the TaDREB11 gene.

7. The method for cultivating drought-tolerant wheat varieties according to claim 5, characterized in that Including: Constructing an overexpression vector of the TaDREB11 gene; using the Agrobacterium-mediated genetic transformation method to transform the young embryos of the wheat to obtain a wheat variety transgenic for the TaDREB11 gene.

8. The method for cultivating drought-tolerant wheat varieties according to claim 5, characterized in that, The backbone of the overexpression vector of the TaDREB11 gene is the pANIC-6E vector.

9. The wheat drought-tolerant variety cultivation method according to claim 5, characterized in that Including the following steps: Step 1, preparing an overexpression vector of the TaDREB11 gene; Step 2, preparing Agrobacterium competent cells; Step 3, transforming the overexpression vector of the TaDREB11 gene into Agrobacterium competent cells, and then transforming it into wheat young embryos to obtain a TaDREB11 transgenic wheat variety; Step 4, identifying the TaDREB11 transgenic wheat variety.

10. The method for cultivating drought-tolerant wheat varieties according to claim 9, characterized in that, The TaDREB11 transgenic wheat identification method in the said step 4 includes detecting the expression of the TaDREB11 gene in transgenic wheat by qRT-PCR.