Peanut sugar transporter gene AhSWEET42 and application thereof

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly discloses a peanut sugar transporter gene AhSWEET42 and application thereof. The nucleotide sequence of the gene AhSWEET42 is as shown in SEQ ID No. 1, and the amino acid sequence of the encoding protein of the gene AhSWEET42 is as shown in SEQ ID No. 2. An overexpression vector driven by a CaMV 35S promoter is constructed through a Gateway system, the overexpression vector is subjected to agrobacterium-mediated transformation of wild type arabidopsis thaliana Columbia-zero, molecular detection and soluble sugar content identification are carried out on a transgenic plant, and the soluble sugar content of the transgenic arabidopsis thaliana can be remarkably increased through overexpression of the overexpression vector in the arabidopsis thaliana; the result shows that AhSWEET42 may participate in plant sweet unloading and sugar accumulation reactions. The invention provides an important gene resource for cultivating new varieties such as high-sweetness peanuts by utilizing a genetic engineering means, and has an important application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to a peanut sugar transporter gene AhSWEET42 and its application. Background Art

[0002] Peanuts have become one of the most widely consumed leguminous crops in the world due to their rich nutrition. In terms of nutrition, there are 10 - 20% carbohydrates in peanut kernels. Among them, dietary fiber has many benefits for physical health, such as reducing cholesterol, reducing obesity, reducing the incidence of colon cancer, promoting cardiovascular health, and improving blood sugar and blood pressure. There are also various soluble sugars in peanut kernels, such as inositol, glucose, fructose, sucrose, raffinose, and stachyose, among which sucrose accounts for about 90%. The sweetness of peanuts mainly depends on the content of sucrose, and sweetness is an inheritable trait. Frying and baking will cause the loss of nutrients in peanut kernels. Therefore, fresh peanuts have the highest nutrition, and the sucrose content that affects the fresh flavor is very worthy of attention.

[0003] Based on the previous BSA analysis results in the laboratory, this study obtained a peanut sugar transporter gene AhSWEET42 , and constructing an overexpression vector and transforming Arabidopsis thaliana mediated by Agrobacterium tumefaciens can significantly increase the soluble sugar content of the plants. It is speculated that AhSWEET42 the gene may be involved in plant sugar transport / unloading, and can provide gene resources for the genetic improvement of high - sweet peanuts. Summary of the Invention

[0004] The present invention provides a peanut sugar transporter gene AhSWEET42 and its application in high - sweet peanuts, which will provide gene resources for the genetic improvement of high - sweet peanuts and have important application prospects.

[0005] To achieve the above object, the present invention adopts the following technical solutions: Application of the peanut sugar transporter gene AhSWEET42 in improving the sweetness of plants, wherein the AhSWEET42 nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by it is shown in SEQ ID NO.2.

[0006] Further, the plant is Arabidopsis thaliana or peanut.

[0007] Further, the sweetness is improved by increasing the soluble sugar content, and the soluble sugars are sucrose, fructose, and glucose.

[0008] Application of the peanut sugar transporter gene AhSWEET42 in cultivating high - sweet peanut varieties, wherein the AhSWEET42The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by it is shown in SEQ ID NO.2.

[0009] The present invention also provides an overexpression vector containing the peanut sugar transporter gene AhSWEET42 ， The nucleotide sequence of the said gene AhSWEET42 is shown in SEQ ID NO.1, and the amino acid sequence encoded by it is shown in SEQ ID NO.2.

[0010] The construction method of the above-mentioned overexpression vector is as follows: Based on the Gateway system, an entry vector pDONR207- AhSWEET42 is constructed through the BP reaction, and then a plant expression vector pK7WG2.0- AhSWEET42 driven by the CaMV 35S promoter is constructed through the LR reaction.

[0011] The present invention also provides the application of the above-mentioned overexpression vector in improving the sweetness of plants, and the plant is Arabidopsis thaliana.

[0012] The present invention also provides the application of the above-mentioned overexpression vector in cultivating high-sweet peanut varieties.

[0013] A method for improving the sweetness of plants, the above-mentioned overexpression vector is transformed into plants by the floral dip method mediated by Agrobacterium, and the plant is Arabidopsis thaliana.

[0014] Based on the results of BSA whole-genome resequencing analysis of two extreme phenotype offspring pools with high and low sugar contents of two parents in the early stage of the laboratory, a peanut sugar transporter gene AhSWEET42 is obtained. Primers are designed according to its predicted CDS sequence, and the polymerase chain reaction is used to amplify the gene. The results show that AhSWEET42 the sequence contains 879 base pairs, encoding 293 amino acids. The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence encoded by it is shown in SEQ ID NO.2. AhSWEET42 The encoded protein is a sucrose / proton symporter and belongs to the glycoside-pentoside-hexoside (GPH) / cation symporter family. It is predicted that these proteins have 12 transmembrane domains.

[0015] The beneficial effect of the present invention is that: Based on the results of BSA whole-genome resequencing analysis of two extreme phenotype offspring pools with high and low sugar contents of two parents in the early stage of the laboratory, a candidate gene for peanut sugar content AhSWEET42 is obtained. The cDNA sequence encoding the protein is obtained by PCR cloning, and the CaMV 35S promoter-driven is constructed through the BP and LR reactions based on the Gateway systemAhSWEET42 The gene plant expression vector pK7WG2.0- AhSWEET42 , which was transformed into Agrobacterium tumefaciens GV3101 and introduced into wild-type Arabidopsis thaliana Columbia-0 by the floral dip method. Molecular identification and soluble sugar content identification were carried out on the transgenic Arabidopsis thaliana, and the results proved that AhSWEET42 it could positively regulate the soluble sugar content of Arabidopsis thaliana. The present invention provides a gene resource for cultivating new high-sugar peanut varieties by means of genetic engineering and has important application value. Brief Description of the Drawings

[0016] Figure 1 is a schematic diagram of the construction of an overexpression vector of peanut AhSWEET42 based on the Gateway system.

[0017] Figure 2 is the cloning of the peanut sugar transporter gene AhSWEET42 ; M: DL2000 DNA Marker; AhSWEET42 : experimental group; CK: blank control.

[0018] Figure 3 is a schematic diagram of the subcellular localization of the protein encoded by the peanut AhSWEET42 gene based on the Gateway system.

[0019] Figure 4 is AhSWEET42 partial identification results of the T0 generation of overexpressing transgenic tobacco, identification at the DNA level; 1-5: experimental group (5 independent transgenic tobacco T0 generation plant samples); M: DL2000 DNA Marker; +: positive control; -: negative control.

[0020] Figure 5 is AhSWEET42 the phenotype of the soluble sugar content of overexpressing transgenic Arabidopsis thaliana; A, B, C, and D are respectively AhSWEET42 the results of the sucrose, fructose, glucose, and total sugar contents of overexpressing transgenic Arabidopsis thaliana, where AhSWEET42-9 and AhSWEET42-18 are two successfully obtained transgenic lines. Detailed Embodiments

[0021] In order to better understand the technical solution of the present invention, the following further describes it in detail with reference to specific examples and drawings, but it does not limit the protection scope of the present invention.

[0022] Unless otherwise specified, the methods used in the present invention are all conventional technical means.

[0023] Example 1 Construction of AhSWEET42 an overexpression vector According to AhSWEET42Full-length gene CDS sequence (the nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence encoded by it is shown in SEQ ID NO.2), design specific primers (AhSWEET42-attB1 - F: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTCATGACGACCAATCATCCCAGTTC-3’; AhSWEET42-attB2 - R: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCCACTGGGGATTTGTGGTGATTC-3’). Using the cDNA of the seeds of the high-sugar peanut variety Nanbeitian as a template for PCR amplification (cloning the sugar transporter gene AhSWEET42 from the cDNA library of the seeds of the high-sugar peanut variety Nanbeitian), use the high-fidelity enzyme PrimeSTAR ® MAX of Takare Company for amplification. PCR reaction system: 1 μL of cDNA as a template, 5 μL of 2×PrimeSTAR ® MAX mix, 0.5 μL of each forward and reverse primer, and make up to 10 μL with water. Reaction conditions: pre-denaturation at 94°C for 5 min; 94°C for 30 s, 65°C for 30 s, 72°C for 1 min, 25 cycles. After detecting the PCR product by agarose gel electrophoresis, cut the gel and purify and recover it. Ligate the target gene fragment with the pDONR207 empty vector for BP reaction: 1 μL (80 - 100 ng) of the purified AhSWEET42 product, 1 μL of pDONR207 empty vector, 0.2 μL of BP enzyme, ligate overnight at 25°C. Transform the ligation product into Escherichia coli DH5α competent cells, screen positive clones for sequencing, extract plasmids from the correctly sequenced clones, and construct the entry vector plasmid pDONR207- AhSWEET42 . Ligate the entry vector plasmid pDONR207- AhSWEET42 and the plant overexpression vector pK7WG2.0 for LR reaction: 1 μL (80 - 100 ng) of pDONR207- AhSWEET42 plasmid, 1 μL of pK7WG2.0 empty vector, 0.2 μL of LR enzyme, ligate overnight at 25°C, transform Escherichia coli, verify positive clones, and construct the plant overexpression vector pK7WG2.0- AhSWEET42 . Constructed the fusion expression vector pEarleyGate103- AhSWEET4 2- GFP (Ligate the entry vector plasmid pDONR207- AhSWEET42 and the plant overexpression vector pEarleyGate103- for LR reaction: pDONR207- AhSWEET421 μL of plasmid (80 - 100 ng), 1 μL of empty pEarleyGate103, 0.2 μL of LR enzyme, ligated overnight at 25°C, transformed into Escherichia coli, positive clones were verified, and the fusion expression vector pEarleyGate103- AhSWEET4 2- GFP was constructed. After transforming the fusion expression vector pEarleyGate103- AhSWEET4 2- GFP into Agrobacterium tumefaciens GV3101, the recombinant Agrobacterium carrying the GFP gene was injected into the epidermal cells of Nicotiana benthamiana leaves by Agrobacterium-mediated transformation technology. The tobacco cells and Agrobacterium were co-cultured for 48 hours under suitable conditions to promote the GFP gene to be transferred to the chromosome of tobacco cells through the T-DNA of Agrobacterium, realizing the GFP integration and expression of the gene. The distribution of green fluorescent protein in cells was observed under a confocal microscope. The schematic diagram of the construction process of the overexpression vector pK7WG2.0- AhSWEET42 is shown as Figure 1 , and the verification diagram of positive clones of the overexpression vector is shown as Figure 2 . The subcellular localization of AhSWEET42 protein is shown as Figure 3 .

[0024] Example 2 Heterologous expression AhSWEET42 Identification and analysis of soluble sugars The overexpression vector pK7WG2.0- AhSWEET42 constructed in Example 1 was transformed into Agrobacterium tumefaciens GV3101 and transformed into wild-type Arabidopsis thaliana Columbia zero by the floral dip method mediated by Agrobacterium tumefaciens. Positive transgenic lines were obtained through kanamycin screening and transgenic molecular identification. To verify whether the gene was recombined into the tobacco genome, the transgenic plants were verified at the DNA ( Figure 4 ) level using the primer pair 35s-F (TGATGTGATATCTCCACTGACGTAAG), AhSWEET42-attB2-R (GGGGACCACTTTGTACAAGAAAGCTGGGTCCACTGGGGATTTGTGGTGATTC), and T0 generation positive plants were obtained. Subsequently, the T3 generation purified transgenic lines were obtained by screening on MS plates containing kanamycin resistance. Taking the soluble sugar content of wild-type Arabidopsis thaliana (WT) as a control, the soluble sugar content of transgenic lines was examined by high performance liquid chromatography (HPLC). The results showed that the contents of sucrose, fructose, glucose, and total sugar increased in the transgenic Arabidopsis thaliana overexpressing AhSWEET42 ( Figure 5 ).

[0025] The above are only the preferred embodiments of the present invention, and all equivalent changes and modifications made according to the scope of the patent application of the present invention shall fall within the scope of the present invention.

Claims

1. Application of peanut sugar transporter gene AhSWEET42 in improving plant sweetness, characterized in that: The said AhSWEET42 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by it is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that: The plants are Arabidopsis thaliana and peanut.

3. The application according to claim 1, characterized in that: Improve sweetness by increasing the content of soluble sugars, and the soluble sugars are sucrose, fructose, and glucose.

4. Application of peanut sugar transporter gene AhSWEET42 in cultivating high-sweet peanut varieties, characterized in that: The AhSWEET42 nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by it is shown in SEQ ID NO.

2.

5. An overexpression vector, characterized in that: Containing the peanut sugar transporter gene AhSWEET42, The gene AhSWEET42 has the nucleotide sequence shown in SEQ ID NO.1 and the amino acid sequence encoded thereby is shown in SEQ ID NO.

2.

6. The construction method of the overexpression vector according to claim 5, characterized in that: Based on the Gateway system, an entry vector pDONR207- was constructed through the BP reaction AhSWEET42 , and then a plant expression vector pK7WG2.0- driven by the CaMV 35S promoter was constructed through the LR reaction AhSWEET42 .

7. Use of the overexpression vector as described in claim 5 in enhancing the sweetness of plants, characterized in that: The plant is Arabidopsis thaliana.

8. Use of the overexpression vector according to claim 5 in cultivating high-sweet peanut varieties.

9. A method for improving the sweetness of plants, characterized in that: Transform the overexpression vector according to claim 5 into a plant by the agrobacterium-mediated flower dipping method, and the plant is Arabidopsis thaliana.

Images