Peanut sugar transporter gene AhSUT4 and application thereof
By overexpressing the peanut sugar transporter gene AhSUT4 in Arabidopsis, the problem of improving the sweetness of peanut seed kernels is solved, and the soluble sugar content is significantly increased, providing the genetic resources of high-sweet peanut varieties.
Patent Information
- Application Number
- CN202510550148.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-29
- Publication Date
- 2025-07-25
AI Technical Summary
The prior art is difficult to significantly increase the sucrose content in peanut seed kernels through genetic engineering, affecting the sweetness and nutritional value of fresh peanuts.
The overexpression vector of the peanut sugar transporter gene AhSUT4 was used to transform Arabidopsis thaliana through Agrobacterium-mediated invasion method to increase the soluble sugar content, especially the content of sucrose, fructose and glucose.
The content of soluble sugars in Arabidopsis has been significantly improved, proving that the AhSUT4 gene can participate in plant sugar transport, providing the genetic resources of high-sweet peanut varieties, and providing an important means for genetic engineering breeding.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to a peanut sugar transporter gene AhSUT4 and its application in high-sweet peanut varieties. Background Art
[0002] Peanuts, owing to their nutrient-rich content, are one of the most widely consumed legumes in the world. Nutrient-wise, peanut kernels contain 10-20% carbohydrates. Dietary fiber, in particular, offers numerous health benefits, such as lowering cholesterol, reducing obesity, reducing the incidence of colon cancer, promoting cardiovascular health, and improving blood sugar and blood pressure. Peanut kernels also contain a variety of soluble sugars, such as inositol, glucose, fructose, sucrose, raffinose, and stachyose, of which sucrose accounts for approximately 90%. The sweetness of peanuts is primarily determined by their sucrose content, and sweetness is a heritable trait. Frying and roasting both cause a loss of nutrients in peanut kernels. Therefore, fresh peanuts offer the highest nutritional value, and the sucrose content, which affects their flavor, is of particular concern.
[0003] Based on the results of the previous BSA analysis in the laboratory, this study obtained a peanut sugar transporter gene AhSUT4 , constructing an overexpression vector and transforming Arabidopsis thaliana through Agrobacterium-mediated transformation can significantly increase the content of soluble sugar in the plant, AhSUT4 The gene may be involved in plant sugar transport / unloading and can provide genetic resources for the genetic improvement of high-sweet peanuts. Summary of the Invention
[0004] The present invention provides a peanut sugar transporter gene AhSUT4 Its application in high-sweet peanuts will provide genetic resources for the genetic improvement of high-sweet peanuts and has important application prospects.
[0005] In order to test the above-mentioned purpose, the present invention adopts the following technical scheme: Peanut sugar transporter gene AhSUT4 Application in improving the sweetness of plants, AhSUT4 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by the gene is shown in SEQ ID NO.2.
[0006] Furthermore, the plants are Arabidopsis thaliana and peanut.
[0007] Furthermore, the sweetness is improved by increasing the soluble sugar content, and the soluble sugars include sucrose, fructose, and glucose.
[0008] Peanut sugar transporter gene AhSUT4 The application of the method in cultivating high-sweet peanut varieties, AhSUT4The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by the gene is shown in SEQ ID NO.2.
[0009] The present invention also provides a method comprising a peanut sugar transporter gene AhSUT4 Overexpression vector, the gene AhSUT4 The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence encoded by it is shown in SEQ ID NO.2.
[0010] The above-mentioned overexpression vector was constructed by: constructing the entry vector pDONR207- AhSUT4 Then, the CaMV 35S promoter-driven plant expression vector pK7WG2.0- AhSUT4 .
[0011] The present invention also provides the use of the above-mentioned overexpression vector in improving the sweetness of plants, characterized in that: the plant is Arabidopsis thaliana.
[0012] The present invention also provides the use of the above-mentioned overexpression vector in cultivating high-sweet peanut varieties.
[0013] 9. A method for improving the sweetness of plants, characterized in that the overexpression vector according to claim 5 is transformed into a plant by Agrobacterium-mediated floral invasion, wherein the plant is Arabidopsis thaliana.
[0014] Based on the results of BSA whole genome resequencing analysis of two extreme phenotypes of high and low sugar content progeny from two parents in the early laboratory, a peanut sugar transporter gene was obtained. AhSUT4 , primers were designed based on the predicted CDS sequence and polymerase chain reaction was performed to amplify the gene. The results showed that AhSUT4 The sequence contains 1500 base pairs and encodes 500 amino acids. Its nucleotide sequence is shown in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.2. AhSUT4 The encoded protein is a sucrose / proton symporter, which belongs to the glycoside-pentoside-hexoside (GPH) / cation symporter family. These proteins are predicted to have 12 transmembrane domains.
[0015] The beneficial effects of the present invention are: Based on the results of BSA whole genome resequencing analysis of the two extreme phenotypes of high and low sugar content of the two parents in the early laboratory, the candidate genes for peanut sugar content were obtained. AhSUT4The cDNA sequence encoding the protein was obtained by PCR cloning, and the CaMV 35S promoter was constructed by BP and LR reactions based on the Gateway system. AhSUT4 Gene plant expression vector pK7WG2.0- AhSUT4 , transformed into GV3101 Agrobacterium, and introduced into wild-type Arabidopsis Columbia Zero by floral invasion method. The molecular identification and soluble sugar content of transgenic Arabidopsis were carried out. AhSUT4 The invention can positively regulate the soluble sugar content of Arabidopsis thaliana. The invention provides gene resources for breeding new high-sugar peanut varieties by genetic engineering means, and has important application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 For peanuts based on the Gateway system AhSUT4 Schematic diagram of the construction of overexpression vector.
[0017] Figure 2 Peanut sugar transporter gene AhSUT4 Clone; M: DL2000 DNA Marker; AhSUT4: experimental group; CK: blank control.
[0018] Figure 3 for AhSUT4 Partial identification results of the T0 generation of overexpressed transgenic tobacco; (a) Identification at the DNA level; (b) Identification at the RNA level; M: DL2000 DNA Marker; +: positive control; -: negative control; CK: blank control, 1-5: experimental groups.
[0019] Figure 4 for AhSUT4 Phenotype of soluble sugar content in overexpressing transgenic Arabidopsis; (a) AhSUT4 The sucrose, glucose, and fructose contents of overexpressed transgenic Arabidopsis thaliana increased; (b) AhSUT4 The total sugar content of overexpressed transgenic Arabidopsis is increased.
[0020] Figure 5 For peanuts based on the Gateway system AhSUT4 Schematic diagram of subcellular localization of gene-encoded proteins DETAILED DESCRIPTION
[0021] In order to better understand the technical solution of the present invention, the following is a further detailed description with reference to specific embodiments and drawings, but this does not limit the scope of protection of the present invention.
[0022] Unless otherwise specified, the methods used in the present invention are all conventional technical means.
[0023] Example 1 Construction AhSUT4 Overexpression vector According to the CDS sequence of the full-length AhSUT4 gene (the nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence it encodes is shown in SEQ ID NO.2), specific primers were designed. PCR amplification of the sugar transporter gene AhSUT4 (AhSUT4-attb-F1: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTCATGGAGTCCCCAACAAAGAC-3', AhSUT4-attb-R1: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCGTGTCCACCACCAACG-3') was performed using cDNA from the kernel of the high-sugar peanut cultivar Nanbeitian as a template. (The sugar transporter gene AhSUT4 was cloned from a cDNA library of the kernel of the high-sugar peanut cultivar Nanbeitian.) Takare's high-fidelity enzyme PrimeSTAR® MAX was used for amplification. The PCR reaction system consisted of 1 µL of cDNA as template, 5 µL of 2× PrimeSTAR® MAX mix, 0.5 µL of each forward and reverse primer, and water was added to 10 µL. Reaction conditions included initial denaturation at 94°C for 5 min, followed by 25 cycles of 94°C for 30 s, 65°C for 30 s, and 72°C for 1 min. The PCR product was purified and recovered after gel electrophoresis and excision. The target gene fragment was then ligated with the pDONR207 empty vector for a BP reaction: 1 μL (80-100 ng) of the purified AhSUT4 product, 1 μL of the pDONR207 empty vector, and 0.2 μL of BP enzyme. The ligation was carried out overnight at 25°C. The ligation product was transformed into Escherichia coli DH5α competent cells, and positive clones were screened for sequencing. Plasmids from the correctly sequenced clones were extracted to construct the entry vector pDONR207-AhSUT4. The entry vector plasmid was then subjected to a LR reaction with the plant overexpression vector pK7WG2.0: 1 μL (80-100 ng) of the pDONR207-AhSUT4 plasmid, 1 μL of the pK7WG2.0 empty vector, and 0.2 μL of LR enzyme. The ligation was carried out overnight at 25°C. E. coli was then transformed, and positive clones were verified to construct the plant overexpression vector pK7WG2.0-AhSUT4. The schematic diagram of the construction process of pK7WG2.0-AhSUT4 overexpression vector is shown in the figure. Figure 1 As shown, the positive clone verification diagram of the overexpression vector is shown in Figure 2 shown.
[0024] Example 2 Heterologous Expression AhSUT4 Identification and analysis of soluble sugars The overexpression vector pK7WG2.0- AhSUT4Agrobacterium GV3101 was transformed into wild-type Arabidopsis Columbia 0 by Agrobacterium tumefaciens-mediated floral invasion. Positive transgenic lines were obtained by kanamycin selection and transgenic molecular identification. In order to verify whether the gene was recombined into the tobacco genome, 35s-F (TGATGTGATATCTCCACTGACGTAAG) was used. AhSUT4-attb-R1 : (GGGGACCACTTTGTACAAGAAAGCTGGGTCGTGTCCACCACCAACG) primers were used to perform DNA sequencing of transgenic plants ( Figure 3 a) and RNA ( Figure 3 b) Level verification, 5 T0 generation positive plants were obtained. Subsequently, the T3 generation purified transgenic lines were screened using MS plates containing kanamycin resistance. The soluble sugar content of the wild-type Arabidopsis was used as a control, and the soluble sugar content of the transgenic lines was examined by high performance liquid chromatography (HPLC). The results showed that overexpression AhSUT4 It can significantly increase the soluble sugar content of Arabidopsis thaliana ( Figure 4 The fusion expression vector pEarleyGate103-AhSUT4-GFP was constructed and transformed into Agrobacterium GV3101. After that, it was injected into Nicotiana benthamiana by Agrobacterium injection. The distribution of green fluorescent protein in cells was observed under a confocal microscope. Figure 5 for AhSUT4 Gene subcellular localization results.
[0025] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.
Claims
1. Application of peanut sugar transporter gene AhSUT4 in improving plant sweetness, characterized by: The said AhSUT4 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by it is shown in SEQ ID NO.
2.
2. The application according to claim 1, wherein: The plants are Arabidopsis thaliana and peanut.
3. The application according to claim 1, characterized in that: Improving sweetness by increasing the content of soluble sugars, which are sucrose, fructose and glucose.
4. Application of peanut sugar transporter gene AhSUT4 in cultivating high-sweet peanut varieties, characterized in that: The AhSUT4 nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by it is shown in SEQ ID NO.
2.
5. An overexpression vector, characterized in that: Containing the peanut sugar transporter gene AhSUT4, The gene AhSUT4 has the nucleotide sequence shown in SEQ ID NO.1, and the amino acid sequence encoded by it is shown in SEQ ID NO.
2.
6. The method for constructing the overexpression vector according to claim 5, wherein: Based on the Gateway system, an entry vector pDONR207- was constructed through BP reaction AhSUT4 , and then a plant expression vector pK7WG2.0- driven by the CaMV 35S promoter was constructed through LR reaction AhSUT4 .
7. Use of the overexpression vector as described in claim 5 in enhancing the sweetness of plants, characterized in that: The plant is Arabidopsis thaliana.
8. Use of the overexpression vector according to claim 5 in cultivating high-sweet peanut varieties.
9. A method for enhancing the sweetness of plants, characterized in that: Transforming the overexpression vector according to claim 5 into a plant by the agrobacterium-mediated flower dipping method, and the plant is Arabidopsis thaliana.