Application of knockout Nanlin 895 poplar TRM gene in increasing wood yield and method of knockout Nanlin 895 poplar TRM gene

Abstract

The invention discloses an application of a transmembrane protein gene (TRANSMEMBRANE, TRM) for knocking out Popus deltoids * P.eurameracana cv.' nalin895 ', NL895) in increasing the yield of wood and a method of the transmembrane protein gene (TRANSMEMBRANE, TRM) for knocking out Popus deltoids * P.eurameracana cv.' nalin895', NL895) in increasing the yield of wood. The method comprises the following steps: obtaining a trm knockout transgenic plant by adopting a CRISPR / Cas9 editing technology; the number of xylem layers in the knocked-out plant is obviously increased, and the number of formed layers is also obviously increased; the result shows that the activity of the stem cambium of the poplar and the xylem differentiation are promoted after the TRM is deleted, and the method has important significance on development and utilization of the poplar.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and specifically relates to the application of knocking out the TRM gene of Populus deltoides cv. 'Nanlin895' in improving wood yield, and also relates to a method for improving wood yield. Background Art

[0002] Plant vascular tissue is a tissue system in plants responsible for material transport and mechanical support. It is an important tissue type formed during the evolutionary process of plants from aquatic to terrestrial growth, and is equivalent to the functions of blood vessels and bone tissues in animals (Du et al., 2023). The vascular tissue of annual herbaceous plants is mainly the primary vascular tissue system, which is composed of primary phloem and primary xylem differentiated from the procambium stem cells of the primary meristem and their daughter cells. On the basis of the primary vascular tissue formed by the procambium stem cells of annual herbaceous plants, perennial woody plants further evolved into a secondary meristem - the vascular cambium (Du et al., 2023). The vascular cambium is the power center for the continuous thickening growth of plant stems. The secondary growth of trees depends on the continuous division and differentiation of cambium cells, and their differentiation to both sides forms secondary phloem and secondary xylem. The secondary xylem of forest trees is wood, which is widely used in many aspects such as papermaking, construction, and bioenergy. It is an important renewable resource and has extremely important economic value for human production and life (Plomion et al., 2001). With the rapid development of China's economy, the demand for wood is increasing day by day. However, due to the long growth cycle and high heterozygosity of forest trees, traditional breeding is difficult to meet the growing demand for wood. Therefore, exploring the key genes regulating wood and analyzing the molecular regulatory network of wood secondary development, and using molecular breeding methods to improve wood quality are considered to be one of the most effective ways to alleviate the contradiction between wood supply and demand.

[0003] Transmembrane proteins are located at the interface between cells and the external environment and have many important functions (Kraffe et al., 2007). Transmembrane proteins are involved in the exchange and transmission of plant hormones, signaling molecules, and various substrates and metabolites between cells (Funakoshi et al., 2006). Many transmembrane proteins are ion channels (Kelkar et al., 2007), which transport or remove ions and toxic molecules from cells. Transmembrane proteins have many other functions: some anchor the membrane to the actin cytoskeleton on both sides (Saier et al., 2000), some recognize chemical signals in the surrounding environment and transmit them into the cell (Clark et al., 2005), and some act as enzymes (Ehlers et al., 1991). Each type of cell membrane contains different proteins that perform specific functions. Current research shows that transmembrane proteins play a role in the vegetative and reproductive growth of plants, are involved in plant hormone regulation-related pathways, and also respond to abiotic stresses in plants. In Arabidopsis thaliana, the transmembrane protein ALF5 is involved in the development of its lateral roots (Diener et al., 2001), PgTIP1 is highly expressed in ginseng roots (Lin et al., 2007), and overexpression of this protein significantly promotes root growth (An et al., 2018). Summary of the Invention

[0004] In view of this, one object of the present invention is to provide the use of knocking out the NL895 TRM gene in improving wood yield; another object of the present invention is to provide a method for improving the wood yield of NL895.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] 1. The use of knocking out the NL895 TRM gene in improving wood yield, wherein the NL895 TRM gene is knocked out, and the nucleotide sequence of the TRM is shown in SEQ ID NO.1.

[0007] Preferably, the method for knocking out the NL895 TRM gene in the present invention adopts the CRISPR / Cas9 editing technology.

[0008] Preferably, the sgRNA used in the CRISPR / Cas9 editing technology in the present invention is shown in SEQ ID NO.2 and SEQ ID NO.3.

[0009] Preferably, the improvement of wood yield in the present invention is achieved by increasing the number of xylem layers and the number of cambium layers in the stem to improve wood yield.

[0010] 3. Method for increasing the wood yield of NL895, comprising the following steps: transforming the CRISPR / Cas9 gene editing vector of TRM into NL895 to obtain a transgenic plant with TRM gene-edited mutations.

[0011] Preferably, in the present invention, the method for transforming NL895 is mediated by Agrobacterium.

[0012] Preferably, in the present invention, the Agrobacterium is Agrobacterium tumefaciens GV3101.

[0013] The beneficial effects of the present invention are as follows: The present invention provides the application of knocking out the NL895 TRM gene in increasing wood yield. By using a large-scale genome editing technology applicable to plants and based on CRISPR / Cas9 editing to knock out the TRM gene in NL895, a transgenic plant with TRM gene-edited mutations is obtained; the number of xylem layers and the number of cambium layers in the knocked-out plants are significantly increased compared with those of the WT; this result indicates that the activity of the poplar stem cambium and xylem differentiation are promoted after the deletion of TRM, and it can be used for the cultivation of excellent poplar varieties. Description of the Drawings

[0014] In order to make the objectives, technical solutions, and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:

[0015] Figure 1 It is the vector structure diagram of the gDNA expression cassette;

[0016] Figure 2 It is the identification of positive plants with NL895 TRM knocked out (A: Sequencing identification results of NL895 TRM transgenic plants).

[0017] Figure 3 It is the growth situation of the NL895 TRM knockout plant materials (A: Comparison of the growth of the knockout materials and the wild type; B: Statistical analysis of the internode width of the knockout materials and the wild type).

[0018] Figure 4 It is the phenotypic secondary development phenotypic analysis of the NL895 TRM knockout plants (A: Toluidine blue staining of the knockout materials and the wild type; B: Comparison of the plant heights of the knockout materials and the wild type; C: Analysis of the number of xylem layers of the knockout materials and the wild type; D: Analysis of the cambium phenotype of the knockout materials and the wild type; E: Analysis of the number of cambium layers of the knockout materials and the wild type). Detailed Embodiments

[0019] The present invention will be further described below with reference to the drawings and specific embodiments, so that those skilled in the art can better understand the present invention and implement it, but the examples given are not intended to limit the present invention.

[0020] Example 1: Construction of a plant expression vector

[0021] The gene knockout vector used in this study (Baige CRISPR / Cas vector, product number BGK012)

[0022] According to the TRM gene sequence of Populus deltoides cv. 'Nanlin895' (shown in SEQ ID NO.1), target sequences (shown in SEQ ID NO.2 - 3) capable of specifically knocking out this gene were designed.

[0023] TRM:

[0024] ATGTTGGGGTTGAGATTAACTGAGTTGACAAGAAATAATGCATATCAACGGCACTG

[0025] TACCAGTCTTTCATCCTGGTGTAAAGCTTTTATGCACCTTGGCGCACTGCTTTTGTT

[0026] TCTTTTAAGATCTTTTTCTACACAAGTTGATGACTTAGTTTGTGAGATTTATTTTCTTGATCAGCCACGATAG(SEQ ID NO.1)

[0027] T1 - F: 5’ - GAAACAAAAGCAGTGCGCCA - 3’(SEQ ID NO.2);

[0028] T2 - R: 5’ - TGGCGCACTGCTTTTGTTTC - 3’(SEQ ID NO.3);

[0029] (1) Synthesize primer sequences containing T1 - F and T1 - R target sequences and specific vector adapters. Centrifuge the obtained primers at 8000 rpm for 2 minutes, and dissolve the primer pool in 1 / 5 TE to 10 ng / μl;

[0030] (2) Amplify the primer pool using KOD. The PCR system is as follows:

[0031] Table 1. PCR system

[0032]

[0033] (3) Recover DNA by ethanol precipitation

[0034] (4) Enzyme digestion

[0035] Using BsaI restriction endonuclease, connect the target to the following through a temperature - cycling instrument (or PCR instrument) Figure 1The restriction enzyme cleavage site of BsaI on the small vector containing the gDNA expression cassette is shown. The reaction system is shown in Table 2, and the reaction conditions are: 37 °C for 3 h.

[0036] Table 2. PCR System

[0037]

[0038]

[0039] (5) Ligation

[0040] Use T4 ligase to ligate the above restriction enzyme digestion products to the already modified vector. The reaction system is shown in Table 3, and the reaction conditions are: 16 °C for 8 h.

[0041] Table 3. PCR System

[0042]

[0043] (6) Transform the ligation product in step (5) into Escherichia coli DH5α competent cells to carry out the Escherichia coli transformation process.

[0044] (7) Conduct colony PCR experiments to screen for positive clones and sequence to determine the transformation efficiency.

[0045] Number the monoclonal colonies on the plate, and use a sterilized pipette tip to sequentially pick a small amount of bacterial cells into a PCR tube as the amplification template. The amplification system is shown in Table 4. Additionally, use the gene gel recovery fragment and ddH2O as templates, and set positive and negative controls respectively.

[0046] Table 4. PCR System

[0047]

[0048] Set the reaction conditions as follows: pre-denaturation at 98 °C for 3 min; denaturation at 98 °C for 15 s; annealing at 56 °C for 20 s; extension at 72 °C for 20 s; a total of 35 cycles; final extension at 72 °C for 5 min; cooling and preservation at 16 °C for 25 min; detect the products by 1% agarose gel electrophoresis. Colonies that can amplify a band of the same size as the positive control are positive clones.

[0049] (8) Extraction of positive clone plasmids and verification by sequence determination

[0050] Resuspend the scraped colonies with ddH2O and transfer them to an LB liquid medium containing kanamycin or ampicillin. Incubate overnight at 37 °C with shaking at 200 rpm / min, and use the alkaline lysis plasmid large extraction kit from BioFlux company for plasmid extraction.

[0051] (9) Transform the sub-library with qualified sequencing accuracy into Agrobacterium by electroporation as follows:

[0052] 1) Take out the electroporation cuvette (originally soaked in 75% alcohol solution) in the laminar flow hood, place it on the laid paper towel, wash it 2 - 3 times with sterilized ddH2O, and then place it on the paper towel to dry for later use;

[0053] 2) Then take out the plasmid on ice, first dilute it with ddH2O in the laminar flow hood, 10 μL of plasmid and 50 μL of ddH2O;

[0054] 3) Then add the diluted plasmid into the Agrobacterium competent cells and gently pipette;

[0055] 4) Aspirate the mixed plasmid + Agrobacterium competent cells and add them into the cleaned electroporation cuvette;

[0056] 5) Place it on the electroporator. Wait for the electroporator to beep. The time should be about 2 s, and the voltage should be 4 - 5 V for the best effect;

[0057] 6) Then express the plasmid + Agrobacterium competent cells in the YEP blank culture medium in the electroporation cuvette, and plate after shaking culture for 4 - 5 h.

[0058] Example 2: Genetic transformation of NL895

[0059] (1) Activation culture of Agrobacterium

[0060] 1) Inoculate the engineered strain (GV3101) TRM - Cas9 on the YEP solid medium containing 40 mg / L rifampicin and 50 mg / L kanamycin, and culture it in a constant temperature incubator at 28 °C for 36 h; Scrape all the Agrobacterium colonies on the solid medium and inoculate them into 50 mL of YEP + Rif + kan double - antibiotic liquid medium;

[0061] 2) Culture it with shaking at 28 °C and 200 rpm / min for 36 - 48 hours until the cell density reaches OD600 = 0.8 - 1.0;

[0062] 3) According to the ratio of 1:1000, aspirate 50 μL of the first - activated liquid into 50 mL of fresh YEP + Rif + kan double - antibiotic liquid medium for secondary - activated liquid culture;

[0063] 4) Culture it with shaking at 28 °C and 200 rpm / min for 12 - 16 hours until the cell density reaches OD600 = 0.3 - 0.4 for later use.

[0064] (2) Preparation of Agrobacterium infection solution

[0065] 1) Collect the second activated solution using a 50 mL centrifuge tube, centrifuge at 4000 rpm / min for 8 min, and collect the bacterial cells;

[0066] 2) Discard the supernatant of the culture medium, resuspend the Agrobacterium using 25 mL of WPM resuspension containing AS, and pour the resuspension into a sterile glass bottle;

[0067] 3) Place the resuspension at 28 °C and shake it in the dark at 200 rpm / min for 1 - 2 hours to enhance the infection activity of Agrobacterium.

[0068] (3) Leaf disc preparation

[0069] 1) In the laminar flow hood, burn the sterilized scissors, forceps, and surgical knife handle with the outer flame of an alcohol lamp for 15 seconds, and let them cool for later use;

[0070] 2) Cut 5 - 6 healthy leaves from the wild - type tissue - cultured seedlings using scissors and place them in a petri dish. Add 1 / 3 volume of sterile water to the dish to keep the leaves moist;

[0071] 3) Install the sterile surgical blade into the handle, burn it with the alcohol lamp flame for 15 s and then let it cool. Use the blade to cut the leaves evenly into 0.5 cm 2 square leaf discs.

[0072] (4) Infection

[0073] 1) Use forceps to pick up the leaf discs and place them into the Agrobacterium resuspension. Gently shake the glass bottle to evenly coat the leaf discs with the resuspension and infect for 10 min;

[0074] 2) After the infection, carefully pick out the leaf discs with forceps and place them on sterile paper to absorb the excess infection liquid on the leaf discs;

[0075] 3) Place the leaf discs flat on the co - culture plate, put them in a dark box, and culture them in the dark at 25 °C for 36 - 48 h.

[0076] (5) Selection culture of leaf discs

[0077] 1) After the dark culture, select the appropriate plant resistance according to the vector and prepare a selection medium containing antibiotics;

[0078] 2) Transfer the infected leaf discs to the selection medium in the laminar flow hood to induce callus; During this period, change the leaf discs to a new medium every seven days and continue to change for 3 - 4 weeks until white or light yellow callus grows on the edges of the leaf discs; The whole process is cultured at 25 °C in the dark environment.

[0079] (6) Induction of callus to sprout

[0080] Transfer the leaf discs with callus to the shoot induction medium containing the corresponding antibiotics, and culture them under light at 8000 Lux and 25 °C for 5 - 6 weeks, changing the medium once a week. During this period, the callus will grow and expand fully. Around the 5th week, bud points will appear on the callus, and multiple shoots will grow.

[0081] (7) Root induction of multiple shoots

[0082] When the multiple shoots grow to about 5 cm, cut the shoots with a sharp scissors, and carefully insert the multiple shoots into the rooting medium with forceps. Culture them under light at 8000 Lux and 25 °C for about 10 days to obtain rooted seedlings. These are the candidate transgenic plants, and they can be transplanted into soil for cultivation only after being identified as positive in the follow-up.

[0083] Example 3. Knockout identification of TRM transgenic plants (trm)

[0084] (1) DNA extraction of wild type and TRM transgenic NL895

[0085] 1) Prepare CTAB buffer and preheat it in a 65 °C water bath for later use;

[0086] 2) Take about 0.5 g of leaves from wild type and trm transgenic plants, grind them into powder in liquid nitrogen, and add 500 μL of the above preheated CTAB extraction solution, and mix well;

[0087] 3) Incubate in a 65 °C water bath for 45 min, and gently shake and mix every 15 min (gently) during the process, for a total of 3 times.

[0088] 4) After the water bath, cool to room temperature, add an equal volume of chloroform:isoamyl alcohol (24:1), gently invert and mix well, then lay flat for emulsification for 10 min. Centrifuge at 4 °C, 12000 rpm / min for 10 min;

[0089] 5) Pipette the supernatant into a new sterile centrifuge tube, add an equal volume of -20 °C pre-cooled isopropanol and invert to mix well. White flocculent precipitates can be seen after mixing;

[0090] 6) Centrifuge at 4 °C, 12000 rpm / min for 10 min. Discard the supernatant, wash the precipitate twice with 500 μL of 75% (V / V) ethanol and once with 500 μL of absolute ethanol, and discard the liquid. Dry the precipitate in a 37 °C rotary evaporator until it becomes translucent;

[0091] 7) Add 25 μL of sterile water to dissolve the precipitate to obtain the crude DNA extracts of wild type and TRM transgenic plant leaves;

[0092] 8) Add about 1 μl of RNase to the DNA crude extract to remove RNA, and the reaction conditions are at 37 °C for 1 h;

[0093] 9) Store the DNA sample in a -20 °C refrigerator for future use.

[0094] (2) PCR amplification and knockout identification of positive plants

[0095] Use the CRISPR / Cas9 technology to construct a sub-library containing 103 highly expressed genes in vessels in NL895 for screening, so as to obtain transgenic plants with gene editing mutations of TRM. Use the specific amplification primers of TRM, and use the DNA of WT and trm as templates for amplification. After ligating the amplified fragments to the pMD19 vector, sequence them. The knockout results identified by sequencing are as Figure 2 shown. The results prove that the TRM gene has been knocked out in the TRM transgenic plant trm.

[0096] Use the gene primers TRM-F and TRM-R for screening by primer amplification. The designed specific primers have the following sequences:

[0097] TRM detection-F: 5’-AATGCTTACCCAGTGTCT-3’ (SEQ ID NO.4);

[0098] TRM detection-R: 5’-CAAAACTATCGTGGCTGA-3’ (SEQ ID NO.5);

[0099] The PCR reaction system is the same as Table 5. The reaction program: pre-denaturation at 94 °C for 3 min, 1 cycle; denaturation at 94 °C for 30 s, annealing for 30 s, extension at 72 °C for 1 min, a total of 31 cycles; extension at 72 °C for 10 min, and detect the amplified product by 1% agarose gel electrophoresis.

[0100] Table 5. System of PCR reaction

[0101]

[0102] Example 4. Phenotypic analysis of NL895 TRM knockout plants

[0103] Transfer 4-month-old tissue culture seedlings to soil culture pots and grow them in a greenhouse under long-day conditions (16 hours of light / 8 hours of darkness, light intensity 10000 Lux) at 25 °C for several months ( Figure 3 in A). Measure and statistically analyze the plant height and internode width parameters of WT and TRM transgenic poplars.

[0104] Among them, three technical replicates were taken for plant height. Compared with WT, the average plant height of trm increased by 13.5 cm, and the increase percentage was 8%. The results are as Figure 4 shown in B;

[0105] Among them, the stem diameters at internodes 8 - 15 were taken with three technical replicates, at 8 th , 9 th , 10 th , 11 th , 12 th , 13 th , 14 th , 15 th , there was a result that the trm was higher than that of the WT in all cases, and at 8 th , 9 th , 10 th , 12 th were the most significant, and the increased percentages were: 17%, 18%, 14%, 17% respectively. The results are as shown in Figure 3 shown in B.

[0106] Example 5. Analysis of the phenotypic characteristics of the secondary development of the stem of the TRM - knockout transgenic plants

[0107] In this study, stem cross - sections and staining observations were also carried out on the NL895 TRM - knockout plants and the wild - type plants. The results are as shown in Figure 4 . Through the observation of toluidine blue staining of the stem tissue sections, it was found that the number of xylem layers in the stem of the knockout plants was significantly higher than that of the WT (30 technical replicates were taken for the stem xylem of the WT and the knockout plants, and the corresponding average values were calculated. The number of xylem layers in the knockout plants increased by 9 compared with the WT, and the increased percentage was 45%). The number of cambium layers also increased significantly compared with the WT (30 technical replicates were taken for the stem cambium of the WT and the knockout plants, and the corresponding average values were calculated. The number of cambium layers in the knockout plants increased by 4 compared with the WT, and the increased percentage was 44%). This promoted the secondary development of the NL895 stem and enhanced its wood production.

[0108] The above - mentioned embodiments are only preferred embodiments cited to fully illustrate the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or transformations made by those skilled in the art on the basis of the present invention are all within the protection scope of the present invention. The protection scope of the present invention is subject to the claims.

Claims

1. Use of knocking out the NL895 TRM gene in increasing wood yield, characterized in that: The knockout of the NL895 TRM gene, and the nucleotide sequence of the TRM is shown in SEQ ID NO.

1.

2. Use of knocking out the NL895 TRM gene according to claim 1 in increasing wood yield, characterized in that: The method for knocking out the NL895 TRM gene uses the CRISPR / Cas9 editing technology.

3. Use of knocking out the NL895 TRM gene according to claim 1 in increasing wood yield, characterized in that: The sgRNA used in the CRISPR / Cas9 editing technology is shown by SEQ ID NO.2 and SEQ ID NO.

3.

4. Use of knocking out the NL895 TRM gene according to claim 1 in increasing wood yield, characterized in that: The improvement of wood yield is achieved by increasing the number of xylem layers and the number of cambium layers in the stem.

5. A method for increasing the wood yield of NL895, characterized in that, It includes the following steps: transforming the CRISPR / Cas9 gene editing vector of TRM into NL895 to obtain a transgenic plant with edited and mutated TRM gene.

6. The method according to claim 5, wherein: The method for transforming NL895 is mediated by Agrobacterium.

7. The method according to claim 6, wherein: The Agrobacterium is Agrobacterium tumefaciens GV3101.

Images