Application of knockout NL895 E6-LIKE gene in increasing wood yield and method of knockout NL895 E6-LIKE gene
The NL895 E6-LIKE gene was knocked out through CRISPR/Cas9 editing technology, and a transgenic plant was constructed to increase the xylem and form layers, which solved the problem that traditional breeding was difficult to increase wood yield and achieved a significant increase in wood yield.
Patent Information
- Application Number
- CN202510582086.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-07
- Publication Date
- 2025-07-25
AI Technical Summary
Traditional breeding is difficult to meet the growing demand for wood, and existing studies have failed to clarify the direct relationship between the E6-LIKE gene and wood yield, xylem layers and formation layers.
The NL895 E6-LIKE gene was knocked out by CRISPR/Cas9 editing technology, and wood yield was improved by increasing the number of xylem layers and forming layers. Agrobacterium-mediated transformation method was used to construct transgenic plants with E6-LIKE gene editing mutations.
In knockout plants, the number of xylem layers and the number of formed layers increased significantly, which promoted the activity of the stem formation layer of poplar trees and improved wood yield.
Smart Images

Figure CN120366369A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and specifically relates to the application of knocking out the NL895 E6-LIKE gene in improving wood yield, and also relates to a method for improving wood yield. Background Art
[0002] Plant vascular tissue is a tissue system in plants responsible for material transport and mechanical support. It is an important tissue type formed during the evolutionary process of plants from aquatic to terrestrial growth, and is equivalent to the functions of blood vessels and bone tissues in animals (Du et al., 2023). The vascular tissue of annual herbaceous plants is mainly the primary vascular tissue system, which is composed of primary phloem and primary xylem differentiated from the primary meristem procambium stem cells and their daughter cells. On the basis of the primary vascular tissue formed by the primary procambium stem cells, perennial woody plants further evolve to form a secondary meristem - the vascular cambium (Du et al., 2023). The vascular cambium is the power center for the continuous thickening growth of plant stems. The secondary growth of trees depends on the continuous division and differentiation of cambium cells, and their differentiation to both sides forms secondary phloem and secondary xylem. The secondary xylem of forest trees is wood, which is widely used in papermaking, construction, bioenergy and other aspects. It is an important renewable resource and has extremely important economic value for human production and life (Plomion et al., 2001). With the rapid development of China's economy, the demand for wood is increasing day by day. However, due to the long growth cycle and high heterozygosity of forest trees, traditional breeding is difficult to meet the growing demand for wood. Therefore, exploring the key genes regulating wood and analyzing the molecular regulatory network of wood secondary development, and using molecular breeding methods to improve wood quality are considered to be one of the most effective ways to alleviate the contradiction between wood supply and demand.
[0003] At present, many studies have shown that the ubiquitin-proteasome pathway plays a crucial role in plant lignin production and vascular tissue formation. This pathway is carried out by a group of enzymes, including ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2), and ubiquitin ligase (E3). Related studies have also shown that E3 can recognize proteins modified by E6 as substrates and play some roles (Ciechanover et al., 1998). E3 ubiquitin protein can promote the development of the cambium in poplar by regulating WOX4. In poplar, DA1 regulates the expression level of WOX4 in a ubiquitin-dependent manner mediated by the E3 ubiquitin protein DA2, which has a negative impact on cambium development. However, in mutants with DA1 knocked out, DA2 can no longer ubiquitinate DA1, thereby increasing the expression level of WOX4 and having a positive impact on cambium development (Tang et al., 2022). The E3 ubiquitin protein UBC34 is involved in regulating lignin biosynthesis in poplar (Zheng et al., 2019). Another study found through ISSA experiments and in situ hybridization experiments that the E3 ubiquitin protein PtaRHE1 is developmentally regulated in the vascular tissue of poplar (Baldacci et al., 2015). However, there is currently no report on the direct relationship between the E6-LIKE gene and wood yield, the number of xylem layers, and the cambium. Summary of the Invention
[0004] In view of this, one of the purposes of the present invention is to provide an application of knocking out the NL895 E6-LIKE gene in improving wood yield; the second purpose of the present invention is to provide a method for improving wood yield.
[0005] To achieve the above objectives, the present invention provides the following technical solutions:
[0006] 1. Application of knocking out the NL895 E6-LIKE gene in improving wood yield, wherein the nucleotide sequence of the E6-LIKE gene is shown in SEQ ID NO.1.
[0007] Preferably, the knocking out in the present invention is based on the CRISPR / CAS9 editing technology to knock out the NL895 E6-LIKE gene.
[0008] Preferably, the sgRNA of the CRISPR / CAS9 editing technology in the present invention is shown in SEQ ID NO.2 and SEQ ID NO.3.
[0009] Preferably, the improvement of wood yield in the present invention is achieved by increasing the number of xylem layers or cambium layers in the stem to thicken the stem and improve wood yield.
[0010] 2. A method for increasing wood yield, which transforms the CRISPR / Cas9 gene editing vector of E6-LIKE into NL895 to obtain transgenic plants with E6-LIKE gene-edited mutations.
[0011] Preferably, the method for transforming NL895 is mediated by Agrobacterium.
[0012] Preferably, the Agrobacterium is Agrobacterium tumefaciens GV3101.
[0013] The beneficial effects of the present invention are as follows: The present invention provides the application of knocking out the E6-LIKE gene of NL895 in increasing wood yield. It is applicable to plants and is based on the large-scale genome editing technology of CRISPR / Cas9. A sub-library containing 116 highly expressed xylem genes is constructed in NL895 for screening, so as to obtain transgenic plants with E6-LIKE gene-edited mutations; in the knocked-out plants, the number of xylem layers and the number of cambium layers in the stem are significantly increased compared with the WT; this result shows that the activity of the poplar stem cambium and xylem differentiation are promoted after the deletion of E6-LIKE, and it can be used to increase the yield of NL895. Description of the Drawings
[0014] In order to make the objectives, technical solutions, and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:
[0015] Figure 1 It is the vector structure diagram of the gDNA expression cassette.
[0016] Figure 2 It is the identification of NL895 E6-LIKE knockout positive plants and the sequencing identification results of NL895 E6-LIKE transgenic plants.
[0017] Figure 3 It is the growth situation of the NL895 E6-LIKE knockout plant materials (A: Comparison of the growth of the knockout material and the wild type; B: Statistical analysis of the internode width of the knockout material and the wild type).
[0018] Figure 4 Phenotypic secondary development phenotypic analysis of NL895 E6-LIKE knockout plants (A: Toluidine blue staining of the knockout material and the wild type; B: Comparison of the plant height of the knockout material and the wild type; C: Analysis of the number of xylem layers of the knockout material and the wild type; D: Analysis of the cambium phenotype of the knockout material and the wild type; E: Analysis of the number of cambium layers of the knockout material and the wild type). Detailed Embodiments
[0019] The following further illustrates the present invention in conjunction with the drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the embodiments cited do not limit the present invention.
[0020] Example 1: Construction of a knockout vector and engineering bacteria containing the target sequence of the E6-LIKE gene
[0021] The gene knockout vector used in this study (BaiGe CRISPR / Cas vector, product number BGK012)
[0022] According to the E6-LIKE gene sequence of Populus deltoides cv. 'Nanlin895' (shown in SEQ ID NO.1), target sequences (shown in SEQ ID NO.2-3) capable of specifically knocking out this gene were designed
[0023] E6-LIKE:
[0024] ATGGCTCCCTCTCCAAGACTCATTTCCTTTCTCTTCCTCCTAGCCATTTTATCTGTGC
[0025] AAATCCATGCCAGAGAGAGCCAGTTCTTTAGCAAAGTCAGTGGCGCCACCACCAC
[0026] TCCCTCCACTACCACCATCAGCAACAATAACGCTCAAGATAAAACACTCCCCGGCA
[0027] AAGAAGAAGAAGGGTTGAGCAAGCAAGAACAAGATCCAGCCTTCATCCCAGACA
[0028] ACCAAAATGGTTATGGTCTATATGGTCAAGAAACCACCCAGTTCCCCACCACCACT
[0029] AAACTAGCTAATGCACCCTACACTACTACCACTAATTCCCAGCCATACAAGACCCA
[0030] AACCCAAAACCAAGAAAGCTACACCAATTATCCAACTGACACCACCACCAACACA
[0031] AACACCAACTACTACAGCAACAATGCTTATGATCAGGAGCAGCAACAAAACTTTG
[0032] GTGAAACAAGCCTTCAAGAAAGTGGATACACCAACATGGGGAACCAGAACAACA
[0033] ATTACTACTACAATGGTGCCAATAGCTACAGCAATGATGAGAAGCAAGGCATGAG
[0034] TGACACAAGGTACTTGGAAAAAGGGAAGTACTACTATGACCTGAAGGGTGAGAAC
[0035] AGTAACTACAACCCAAACCAGTACCAGCAGGACTCAAGAAACAACTACAATACTA
[0036] GAGGTTATTACAGCAACAACAACAACAACGAGAACTCCAAGTTCGAGTACAATAA
[0037] CTCCATGCAGAAGTACGACAACCAGGATGATTTCGAAGAGAGCAAGGAAGAGCAGTATGTGCCTTGA(SEQ ID NO.1)
[0038] T1-F: 5’-AATGGCTAGGAGGAAGAGAA-3’(SEQ ID NO.2)
[0039] T1-R: 5’-TTCTCTTCCTCCTAGCCATT-3’(SEQ ID NO.3)
[0040] (1) Synthesize primer sequences containing the T1-F and T1-R target sequences and specific vector adapters. Centrifuge the obtained primers at 8000 rpm for 2 minutes, and dissolve the primer pool in 1 / 5 TE to 10 ng / μl.
[0041] (2) Amplify the primer pool using KOD. The PCR system is shown in Table 1:
[0042] Table 1. PCR System
[0043]
[0044]
[0045] (3) Recover DNA by ethanol precipitation
[0046] (4) Enzyme digestion
[0047] Use the BsaI restriction endonuclease to ligate the target to, through a temperature cycling instrument (or PCR instrument), as Figure 1The BsaI restriction enzyme site of the small vector containing the gDNA expression cassette is shown. The reaction system is shown in Table 2, and the reaction conditions are: 37 °C, 3 h.
[0048] Table 2. PCR System
[0049]
[0050] (5) Ligation
[0051] Use T4 ligase to ligate the above digested products to the already modified vector. The reaction system is shown in Table 3, and the reaction conditions are: 16 °C for 8 h.
[0052] Table 3. PCR System
[0053]
[0054] (6) Transform the ligation product in step (5) into Escherichia coli DH5α competent cells and perform the Escherichia coli transformation process.
[0055] (7) Perform colony PCR experiments to screen for positive clones and sequence to determine the transfer efficiency.
[0056] Number the monoclonal colonies on the plate, and use a sterilized pipette tip to pick a small amount of bacterial cells into a PCR tube in turn as the amplification template. The amplification system is shown in Table 4. Additionally, use the gene gel recovery fragment and ddH2O as templates, and set positive and negative controls respectively.
[0057] Table 4. PCR System
[0058]
[0059] Set the reaction conditions as follows: pre-denaturation at 98 °C for 3 min; denaturation at 98 °C for 15 s; annealing at 56 °C for 20 s; extension at 72 °C for 20 s; a total of 35 cycles; final extension at 72 °C for 5 min; cooling and storage at 16 °C for 25 min. The products are detected by 1% agarose gel electrophoresis. Colonies that can amplify a band of the same size as the positive control are positive clones.
[0060] (8) Extraction of positive clone plasmids and verification by sequence determination
[0061] Resuspend the scraped colonies with ddH2O and transfer them to an LB liquid medium containing kanamycin or ampicillin, and culture them overnight at 37 °C with shaking at 200 rpm / min. Use the alkaline lysis plasmid large extraction kit from BioFlux company to extract the plasmids.
[0062] (9) Electrotransform the sub-library with a sequencing accuracy rate meeting the standard into Agrobacterium, and the operation is as follows:
[0063] 1) Take out the electroporation cuvette (originally soaked in 75% alcohol solution) in the laminar flow hood, place it on the laid paper towel, wash it 2 - 3 times with sterilized ddH2O, and then place it on the paper towel to dry for later use;
[0064] 2) Then take out the plasmid on ice, first dilute it with ddH2O in the laminar flow hood, 10 μL of plasmid and 50 μL of ddH2O;
[0065] 3) Then add the diluted plasmid into the Agrobacterium competent cells and gently pipette with a pipette;
[0066] 4) Aspirate the mixed plasmid + Agrobacterium competent cells and add them into the cleaned electroporation cuvette;
[0067] 5) Place it on the electroporator. Wait for the electroporator to beep. The time should be about 2 s and the voltage should be 4 - 5 V for the best effect;
[0068] 6) Then express the plasmid + Agrobacterium in the YEP empty culture medium in the electroporation cuvette. After culturing on a shaker for 4 - 5 h, spread it on a plate.
[0069] Example 2. Genetic transformation of NL895
[0070] (1) Two - step activation culture of Agrobacterium
[0071] 1) Inoculate the engineered strain (GV3101) E6 - LIKE - Cas9 on the YEP solid medium containing 40 mg / L rifampicin and 50 mg / L kanamycin by streaking, and culture it in a constant temperature incubator at 28 °C for 36 h; Pick a single colony and inoculate it into 10 mL of YEP + Rif + kan double - antibiotic liquid medium;
[0072] 2) Culture it at 28 °C with shaking at 200 rpm / min for 36 - 48 hours until the cell density reaches OD600 = 0.8 - 1.0;
[0073] 3) According to the ratio of 1:1000, aspirate 50 μL of the first - activated solution into 50 mL of fresh YEP + Rif + kan double - antibiotic liquid medium for the second - activated solution culture;
[0074] 4) Culture it at 28 °C with shaking at 200 rpm / min for 12 - 16 hours until the cell density reaches OD600 = 0.3 - 0.4 for later use.
[0075] (2) Preparation of Agrobacterium infection solution
[0076] 1) Use a 50 mL centrifuge tube to collect the second - activated solution, centrifuge at 4000 rpm / min for 8 min to collect the cells;
[0077] 2) Discard the culture medium supernatant, resuspend the Agrobacterium with 25 mL of WPM suspension containing AS, and pour the resuspension into a sterile glass bottle.
[0078] 3) Place the resuspension at 28 °C and shake it in the dark at 200 rpm / min for 1 - 2 hours to enhance the infectivity of Agrobacterium.
[0079] (3) Preparation of leaf discs
[0080] 1) In the laminar flow hood, burn the sterilized scissors, forceps, and surgical knife handle with the outer flame of an alcohol lamp for 15 seconds, and let them cool for later use.
[0081] 2) Use scissors to cut 5 - 6 leaves from healthy wild - type tissue - cultured seedlings and put them into a petri dish. Add sterile water with a volume of 1 / 3 of the petri dish to keep the leaves moist.
[0082] 3) Install the sterile surgical blade into the handle, burn it with the alcohol lamp flame for 15 s and then let it cool. Use the blade to evenly cut the leaves into square leaf discs with a side length of 0.5 cm. 2
[0083] (4) Infection
[0084] 1) Use forceps to pick up the leaf discs and put them into the Agrobacterium resuspension. Gently shake the glass bottle to evenly coat the leaf discs with the resuspension and incubate for 10 min.
[0085] 2) After the infection, carefully pick out the leaf discs with forceps and place them on sterile paper to absorb the excess infection solution on the leaf discs.
[0086] 3) Place the leaf discs flat on the co - culture plate, put them in a dark box, and culture them in the dark at 25 °C for 36 - 48 h.
[0087] (5) Selective culture of leaf discs
[0088] 1) After the dark culture, select the appropriate plant resistance according to the vector and prepare a selective medium containing antibiotics.
[0089] 2) Transfer the infected leaf discs to the selective medium in the laminar flow hood to induce callus. During this period, change the leaf discs to a new medium every seven days and continue to change for 3 - 4 weeks until white or light yellow callus grows at the edges of the leaf discs. The whole process is cultured at 25 °C in the dark.
[0090] (6) Induction of shoots from callus
[0091] Transfer the leaf discs with callus to a shoot - induction medium containing the corresponding antibiotics, and culture them under light at 8000 Lux and 25 °C for 5 - 6 weeks, changing the medium once a week. During this period, the callus will grow and expand fully. Around the 5th week, bud points will appear on the callus and multiple shoots will grow.
[0092] (7) Inducing rooting of clustered buds
[0093] When the clustered buds grow to about 5 cm, cut the buds with a sharp scissors, carefully insert the clustered buds into the rooting medium with forceps, and culture them under 8000 Lux and 25 °C light for about 10 days to obtain rooted seedlings. These are the candidate transgenic plants, and they can be transplanted and cultivated in soil only after being identified as positive in the follow-up.
[0094] Example 3. Knockout identification of E6-LIKE transgenic plants (e6-like)
[0095] (1) DNA extraction of WT and e6-like
[0096] 1) Prepare CTAB buffer and preheat it in a 65 °C water bath for later use;
[0097] 2) Take about 0.5 g of leaves of WT and e6-like, grind them into powder in liquid nitrogen, add 500 μL of the above preheated CTAB extraction solution, and mix well;
[0098] 3) Incubate in a 65 °C water bath for 45 min, gently shake and mix every 15 min during the process (gently), and mix a total of 3 times.
[0099] 4) After the water bath, cool to room temperature, add an equal volume of chloroform:isoamyl alcohol (24:1), gently invert and mix well, then let it stand for emulsification for 10 min; centrifuge at 4 °C, 12000 rpm / min for 10 min;
[0100] 5) Pipette the supernatant into a new sterile centrifuge tube, add an equal volume of -20 °C pre-cooled isopropanol and invert to mix well. White flocculent precipitate can be seen after mixing;
[0101] 6) Centrifuge at 4 °C, 12000 rpm / min for 10 min. Discard the supernatant, wash the precipitate twice with 500 μL of 75% (V / V) ethanol and once with 500 μL of absolute ethanol, and discard the liquid. Dry the precipitate in a 37 °C rotary evaporator until it becomes translucent;
[0102] 7) Add 25 μL of sterile water to dissolve the precipitate to obtain the crude DNA extracts of WT and e6-like leaf;
[0103] 8) Add about 1 μl of RNase to the crude DNA extract to remove RNA, and the reaction conditions are at 37 °C for 1 h;
[0104] 9) Store the DNA samples in a -20 °C refrigerator for later use.
[0105] (2) PCR amplification and knockout identification of positive plants
[0106] Using the CRISPR / Cas9 technology, a sub-library containing 116 highly expressed xylem genes was constructed in NL895 for screening, thereby obtaining transgenic plants with gene-edited mutations of E6-LIKE. Using E6-LIKE specific amplification primers, DNA of WT and e6-like was used as a template for amplification, and the amplified fragment was ligated to the pMD19 vector and then sequenced. The sequencing results for identifying the knockout are as Figure 2 shown. The results proved that the E6-LIKE gene was knocked out in the E6-LIKE transgenic plant e6-like.
[0107] Screening was carried out by amplifying using gene primers E6-LIKE-F and gene primer E6-LIKE-R. The designed specific primers had the following sequences:
[0108] E6-LIKE detection-F: 5’-TGGGTCTTGTATGGCTGG-3’ (SEQ ID NO.4);
[0109] E6-LIKE detection-R: 5’-TTCCCTCCAATTTCCACC-3’ (SEQ ID NO.5);
[0110] The PCR reaction system was the same as that in Table 5, and the reaction program was as follows: pre-denaturation at 94°C for 3 min, 1 cycle; denaturation at 94°C for 30 s, annealing for 30 s, extension at 72°C for 1 min, a total of 31 cycles; extension at 72°C for 10 min, and the amplified product was detected by 1% agarose gel electrophoresis.
[0111] Table 5. System of PCR reaction
[0112]
[0113]
[0114] Example 4. Phenotypic analysis of NL895 E6-LIKE knockout plants
[0115] Four-month-old tissue culture seedlings were transplanted into soil culture pots and grown in a greenhouse under long-day conditions (16 hours of light / 8 hours of darkness, light intensity 10000 Lux) at 25°C for several months ( Figure 3 in A). The plant height and stem diameter parameters of internodes 8-15 of WT and e6-like poplars were measured and statistically analyzed.
[0116] Among them, for plant height, three technical replicates were taken. Compared with WT, the average plant height of e6-like increased by 16.9 cm, and the percentage increase was 10.2%. The results are as Figure 4 shown in B;
[0117] Among them, for the stem diameter of internodes 8-15, three technical replicates were taken. At 8th , 9 th , 10 th , 11 th , 12 th , 13 th , 14 th , 15 th , there is a result that e6-like is higher than WT on average, and it is the highest at 11 th , 12 th , 13 th is the most significant, and the increased percentages are: 19.2%, 25%, 22% respectively. The results are as shown in Figure 3 shown in B in
[0118] Example 5. Phenotypic Analysis of Stem Secondary Development of E6-LIKE Knockout Transgenic Plants
[0119] In this study, stem transverse sections and staining observations were also carried out on NL895 E6-LIKE knockout plants and wild-type plants. The results are as shown in Figure 4 shown. Through the observation of toluidine blue staining of stem tissue sections, it was found that the number of stem xylem layers in the knockout plants was significantly higher than that of WT (30 technical replicates were taken for the stem xylem of WT and knockout plants, and the corresponding average values were calculated. The number of xylem layers in the knockout plants increased by 10 compared with WT, and the increased percentage was 50%). The number of cambium layers also increased significantly compared with WT (30 technical replicates were taken for the stem cambium of WT and knockout plants, and the corresponding average values were calculated. The number of cambium layers in the knockout plants increased by 4 compared with WT, and the increased percentage was 44%). This promoted the secondary development of the NL895 stem and enhanced its wood yield.
[0120] The above-mentioned embodiments are only preferred embodiments given to fully illustrate the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or transformations made by those skilled in the art on the basis of the present invention are all within the protection scope of the present invention. The protection scope of the present invention is subject to the claims.
Claims
1. Use of knocking out the NL895 E6-LIKE gene in increasing wood production, characterized in that: The nucleotide sequence of the E6-LIKE gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, wherein: The knockout is based on the CRISPR / CAS9 editing technology to knockout the NL895 E6-LIKE gene.
3. The application according to claim 1, wherein: The sgRNA of the CRISPR / CAS9 editing technology is shown by SEQID NO.2 and SEQ ID NO.
3.
4. The application according to claim 1, wherein: The improvement of wood yield is achieved by increasing the number of xylem layers or the number of cambium layers in the stem to thicken the stem and increase the wood yield.
5. A method for increasing wood production, characterized in that: The CRISPR / Cas9 gene editing vector of E6-LIKE is transformed into NL895 to obtain transgenic plants with E6-LIKE gene editing mutations.
6. The method according to claim 5, wherein: The method for transforming NL895 is mediated by Agrobacterium.
7. The method according to claim 6, wherein: The Agrobacterium is Agrobacterium tumefaciens GV3101.
Citation Information
Cited By
Application of PagUBC10a gene in regulation and control of growth and development of poplar
CN120944960A