Application of CsCPK11 gene in cucumber powdery mildew resistance

Abstract

The invention relates to the technical field of gene engineering, in particular to application of a CsCPK11 gene in cucumber powdery mildew resistance, and the CsCPK11 gene is a nucleotide sequence capable of coding the following protein (a) or (b): (a) a protein composed of an amino acid sequence as shown in SEQ ID NO: 2; and (b) a protein which is derived from (a) and has the same enzyme activity, wherein one or more amino acid sequences are substituted, deleted or added into the amino acid sequence in (a). According to the present invention, by analyzing the anti-disease gene contained in the cucumber and instantaneously silencing the CsCPK11 gene through the VIGS, the new gene related to the cucumber powdery mildew is found, such that the important significance is provided for the analysis of the molecular mechanism of the cucumber powdery mildew resistance and the cultivation of the cucumber with the powdery mildew resistance.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to application of a CsCPK11 gene in powdery mildew resistance of cucumber. Background Art

[0002] Cucumber powdery mildew is caused by infection by Erysiphe leucoderma and Erysiphe leucoderma. In production, powdery mildew, downy mildew and wilt are known as the three major diseases of cucumber. Powdery mildew occurs in all regions, especially under facility cultivation conditions. High crop planting density, poor ventilation and light transmission, increased nitrogen fertilizer application, high temperature and high humidity, etc., exacerbate the damage of powdery mildew. It usually occurs severely in the middle and late growth stages, causing leaf dryness and even premature pulling of seedlings. The symptoms are white powdery mildew spots on young leaves, tender stems, flower buds, etc., which gradually expand and become thick and dense, and soon become connected, covering the green tissue of the plant, seriously affecting the photosynthesis of the cucumber plant, and thus affecting the quality and yield of the fruit. In traditional production, people mainly control powdery mildew by spraying pesticides or cultivating disease-resistant varieties with R genes. However, excessive application of pesticides will cause environmental pollution. Therefore, the use of biological technology to study the disease resistance mechanism of powdery mildew and provide treatment guidance is of great significance in the selection and breeding of disease-resistant varieties.

[0003] Breeding disease-resistant varieties has become the preferred method for controlling powdery mildew. In cucumber, there are not many powdery mildew resistance genes reported and applied. Summary of the invention

[0004] The present invention analyzes the disease-resistant genes contained in cucumbers and transiently silences the CsCPK11 gene through VIGS, thereby discovering the disease-resistant genes related to cucumber powdery mildew.

[0005] One of the purposes of the present invention is to protect the application of CsCPK11 gene in cucumber powdery mildew resistance, wherein the CsCPK11 gene is a nucleotide sequence capable of encoding the following (a) or (b) protein:

[0006] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2;

[0007] (b) A protein derived from (a) in which the amino acid sequence in (a) is substituted, deleted or added with one or more amino acid sequences and has the same enzymatic activity.

[0008] Furthermore, the nucleotide sequence of the CsCPK11 gene is selected from any one of the following (a) or (b):

[0009] (a) the nucleotide sequence is a DNA sequence as shown in SEQ ID NO: 1;

[0010] (b) A nucleotide sequence that has more than 90% homology with the DNA sequence in (a) and encodes the above-mentioned protein.

[0011] The second object of the present invention is to protect the application of the quantitative detection primers for detecting the expression of the above-mentioned CsCPK11 gene in screening cucumber powdery mildew resistant varieties.

[0012] Furthermore, the nucleotide sequences of the quantitative detection primers are as shown in SEQ ID NO: 6-7.

[0013] The third object of the present invention is to protect the application of the silencing sequence of the CsCPK11 gene in changing the resistance of cucumber to powdery mildew, and the nucleotide sequence of the silencing sequence is as shown in SEQ ID NO: 3.

[0014] The fourth object of the present invention is to protect the application of the vector and engineering bacteria containing the above-mentioned silencing sequence in changing the resistance of cucumber to powdery mildew.

[0015] Furthermore, the engineering bacteria include but are not limited to Escherichia coli and Agrobacterium. The vector is the pV190 vector.

[0016] The fifth object of the present invention is to protect a method for changing the resistance of cucumber to powdery mildew, and the method includes the following steps:

[0017] Design the silencing sequence of the gene according to the cucumber CsCPK11 gene on the website https: / / vigs.solgenomics.net / , and design and synthesize the primers required for constructing the vector according to the silencing sequence;

[0018] Perform PCR amplification on the CsCPK11 silencing sequence using the primers, and recover and ligate the amplified product by enzyme digestion, so as to insert the CsCPK11 silencing sequence between the multiple cloning sites of the vector plasmid and construct a VIGS gene silencing vector;

[0019] Then infect cucumber seeds with the constructed VIGS gene silencing vector, culture and transplant them to obtain plants with reduced resistance.

[0020] Furthermore, the nucleotide sequence of the silencing sequence is as shown in SEQ ID NO: 3, and the primer sequences required for constructing the vector are as shown in SEQ ID NO: 4-5.

[0021] The sixth object of the present invention is to protect a method for improving the resistance of cucumber to powdery mildew, and the method is to overexpress the CsCPK11 gene.

[0022] By analyzing the disease-resistant genes contained in cucumbers and through VIGS transient silencing, new genes related to cucumber powdery mildew were discovered and identified, which is of great significance for analyzing the molecular mechanism of cucumber powdery mildew resistance and cultivating cucumbers with powdery mildew resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is the vector map of pV190-CsCPK11 constructed in Example 1;

[0024] Figure 2 It is the qRT-PCR quantification result after VIGS silencing of the CsCPK11 gene in the example;

[0025] Figure 3 It is the disease infection situation of the leaves of wild-type plants and CsCPK11 gene-silenced plants;

[0026] Figure 4 It is the powdery mildew disease index of wild-type and CsCPK11 gene-silenced plants;

[0027] Figure 5 It is the overexpression vector map of the CsCPK11 gene in Example 2;

[0028] Figure 6 It is the field powdery mildew phenotype of CsCPK11 overexpressing plants in Example 2;

[0029] Figure 7 It is the powdery mildew disease index of CsCPK11 overexpressing plants;

[0030] Figure 8 It is the expression level of CsCPK11 in CsCPK11 overexpressing plants. DETAILED DESCRIPTION OF THE INVENTION

[0031] The present invention will be further described in detail below with reference to specific embodiments, so that those skilled in the art can understand the present invention more clearly. The following embodiments are only used to illustrate the present invention, but not to limit the scope of the present invention. Based on the specific embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative work belong to the protection scope of the present invention.

[0032] In the embodiments of the present invention, unless otherwise specified, all raw material components are commercially available products well-known to those skilled in the art; in the embodiments of the present invention, if not specifically specified, the technical means used are all conventional means well-known to those skilled in the art.

[0033] Unless otherwise specified, the reagents used in the embodiments of the present invention are all commercially available products. For the experimental methods without specific conditions noted in the following embodiments, they are generally carried out under conventional conditions, such as the conditions described in "Molecular Cloning: A Laboratory Manual" (New York: Cold Spring Harbor Laboratory Press, 1989) edited by Sambrook et al., or according to the conditions recommended by the manufacturer.

[0034] Key materials and their descriptions:

[0035] pV190: Gifted by Researcher Gu Qinsheng from Zhengzhou Fruit Tree Research Institute, Chinese Academy of Agricultural Sciences. This vector was published in the journal "Plant Methods" in 2020. Paper link: https: / / doi.org / 10.1186 / s13007-020-0560-3;

[0036] E. coli competent cells DH5α and Agrobacterium tumefaciens GV3101 were both purchased from Beijing Tsingke Biotechnology Co., Ltd.;

[0037] Reverse transcription kit HiScript II Q RT SuperMix for qPCR (+gDNA wiper); PCR amplification enzyme 2×Taq Master Mix; Fluorescent quantitative dye ChamQ Universal SYBR qPCR Master Mix were all purchased from Nanjing Novozymes Biotech Co., Ltd.;

[0038] All the amplification primers used were synthesized by Beijing Tsingke Biotechnology Co., Ltd.;

[0039] Please refer to Table 1 for the English abbreviations in the text, and Table 2 for the preparation methods of the hormones added to the medium:

[0040] Table 1 English abbreviations

[0041]

[0042]

[0043] Table 2 Preparation methods of various hormones in the medium

[0044]

[0045] Example 1 Obtaining of CsCPK11 gene-silenced plants

[0046] (1) Construction of VIGS gene-silencing vector

[0047] Design of CsCPK11 gene silencing sequence: Enter the CsCPK11 gene sequence on the website https: / / vigs.solgenomics.net / , select the reference genome as the genome of Cucurbitaceae and Cucumis, and design the CsCPK11 silencing sequence. Among them,

[0048] The nucleotide sequence of the coding region of the CsCPK11 gene is as follows: ATGGGGAATTGTTGCGTTG CCCCACCTCGGAACCCCGAGGATCAGAACAAAGGAAAGAGGAAGAAGAAGCCGAATCCCTTTTCAGTTGATTACGGTGTGAACCACTTCGCCGGCGGCAACGGCGGCAGCCATAAGCTAACCGTTTTGACCAACCCTACCGGCTGTGAAATCGGGCTTCAATACGAATTGGGTCGGGAGCTTGGCCGAGGGGAGTTTGGAATTACGCATCTATGTACCGATAAGGTTACCGGGGAGAAGTTTGCGTGTAAATCGATTTCCAAGAAGAAGCTGAGAACCGCTATAGATATTGAGGATGTTCGGCGGGAGGTTCAGATTATGAGACATTTGCCTAAGCATCAGAACATTGTGAGTTTGAAGGATACGTTTGAAGACGATAACGCTG

[0049] TTCATTTGGTTATGGAGCTTTGCGAAGGGGGTGAGTTATTTGATCGGAT

[0050] TGTGGCTCGGGGTCACTATACAGAACGTGCTGCTGCTGTTGTCACGAA

[0051] GACCATTGTTGAAGTTGTTCAGATGTGTCACAAGCAGGGTGTCATGCA

[0052] TCGGGACCTTAAACCAGAGAACTTTTTGTTCGGAAACAAGAAGGAAA

[0053] ATGCACCATTGAAGGCAATAGATTTTGGTTTGTCAGTGTTCTTTAAACC

[0054] TGGTGAAAGATTCAATGAAATTGTTGGTAGTCCATATTACATGGCTCCC

[0055] GAGGTTCTAAAACGAAATTATGGCCCAGAAGTAGATGTTTGGAGTGCT

[0056] GGAGTTATACTCTACATTTTACTTTGCGGTGTCCCACCATTTTGGGCTGA

[0057] AACTGAACAAGGAGTTGCACAGGCAATTATACGGTCGGTTATAGATTTC

[0058] AAGAGAGACCCTTGGCCTAAAGTTTCAGATAATGCAAAAGACCTTGTG

[0059] AGAAAGATGCTTGATCCTGATCCGAAGCGACGGCTGACTGCACAAGG

[0060] AGTGCTTGATCATCCATGGTTACAAAATGTAAAGAAAGCTCCTAATGTC

[0061] TCCTTGGGAGAAACAGTGAGAGCAAGACTTAAGCAGTTTTCTGTAATG

[0062] AACAAGCTGAAGAAAAGAGCTCTTAGGGTAATTGCTGAGCACTTGTCA

[0063] GTTGAGGAAGTTGCCGGTATAAAAGAGGGATTTGAAAAGATGGATACC

[0064] GGCAATAAAGGGAAAATTAACATAGACGAGTTACGAGTAGGTTTACAT

[0065] AAGTTAGGCCATCAAATTGCAGATGCAGATCTTCAAATTCTGATGGAAG

[0066] CTGGTGATGCAGACAATGACGGATATCTAGACTGCAGAGAATTTGTAG

[0067] CTATTTCTGTTCACCTCAGGAGAATGGGCGACGACGAAGAGCATCTAA

[0068] GAAAAGCCTTCGATTTCTTTGATCAAAACCTGAGTGGTTATATAGAAAT

[0069] TGAAGAACTACGATCTACCTTAGCCGATGAAATTGATGAAAATAGCGA

[0070] GGAAGTGATTAACGCCATTATTAATGATGTTGACACAGATAAGGACGGC

[0071] CGAATAAGCTATGATGAATTTGCAGCAATGATGAAGGCAGGCACAGAT

[0072] TGGAGGAAAGCATCAAGACAGTATTCTCGAGAACGGTTCAATAGCTTG

[0073] AGTCTGAACTTGATGAGAGATGGATCATTGCAGTTAAAACAATGA(SEQ ID NO:1);

[0074] The amino acid sequence of the protein encoded by the CsCPK11 gene is as follows: MGNCCVAPPRNPEDQNKGKRKKKPNPFSVDYGVNHFAGGNGGSHKLTVLTNPTGCEIGLQYELGRELGRGEFGITHLCTDKVTGEKFACKSISKKKLRTAIDIEDVRREVQIMRHLPKHQNIVSLKDTFEDDNAVHLVMELCEGGELFDRIVARGHYTERAAAVVTKTIVEVVQMCHKQGVMHRDLKPENFLFGNKKENAPLKAIDFGLSVFFKPGERFNEIVGSPYYMAPEVLKRNYGPEVDVWSAGVILYILLCGVPPFWAETEQGVAQAIIRSVIDFKRDPWPKVSDNAKDLVRKMLDPDPKRRLTAQGVLDHPWLQNVKKAPNVSLGETVRARLKQFSVMNKLKKRALRVIAEHLSVEEVAGIKEGFEKMDTGNKGKINIDELRVGLHKLGHQIADADLQILMEAGDADNDGYLDCREFVAISVHLRRMGDDEEHLRKAFDFFDQNLSGYIEIEELRSTLADEIDENSEEVINAIINDVDTDKDGRISYDEFAAMMKAGTDWRKASRQYSRERFNSLSLNLMRDGSLQLKQ (SEQ ID NO:2);

[0075] The CsCPK11 silencing sequence is as follows: ATACGTTTGAAGACGATAACGCTGTTCATT TGGTTATGGAGCTTTGCGAAGGGGGTGAGTTATTTGATCGGATTGTGGCTCGGGGTCACTATACAGAACGTGCTGCTGCTGTTGTCACGAAGACCATTGTTGAAGTTGTTCAGATGTGTCACAAGCAGGGTGTCATGCATCGGGACCTTAAACCAGAGAACTTTTTGTTCGGAAACAAGAAGGAAAATGCACCATTGAAGGCAATAGATTTTGGTTTGTCAGTGTTCTTTAAACCTGGTGAAAGATTCAATGAAATTGTTGGTAGTCCAT (SEQ ID NO:3).

[0076] Primers were designed based on the CsCPK11 silencing sequence, and the primer sequences are as follows: (5’-3’) CsCPK11-F: ACTTTACTTAATGGATCCATACGTTTGAAGACGATAACGCTG (SEQ ID NO:4); CsCPK11-R: AGACCTATAACTGGATCCCATGGACTACCAACAA TTTCATTGAATC (SEQ ID NO:5). Cucumber RNA was extracted, and a reverse transcription system was prepared in an RNAse free centrifuge tube. The reaction system is as follows: RNAse free ddH2O 10 μL, 4×gDNAwiper Mix 4 μL, template RNA 2 μL, 5×HiseripⅡqRT super MixⅡ 4 μL. First, RNAse free ddH2O, gDNA wiper Mix, and template RNA were mixed and placed at 42 °C for 2 min (reaction in a PCR instrument). Then, 5×HiscripⅡqRT super MixⅡ was added to the above reaction for reverse transcription. The reaction program is as follows: 50 °C for 15 min, 85 °C for 5 s, to obtain the cucumber cDNA template.

[0077] Using the cucumber cDNA obtained by the above reverse transcription as a template, amplification was carried out with the primers designed according to the silencing sequence. The fragment length was approximately 300 bp. The amplification system and program are shown in Table 8 below:

[0078] Table 8 PCR reaction system and conditions

[0079]

[0080] Agarose gel electrophoresis detection: Weigh 0.5 g of agarose and place it in a conical flask. Add 25 mL of 1×TAE solution and heat it in a microwave oven until the agarose is completely melted. Place the inner tank in a horizontal position and put in the comb. Pour the agarose gel solution cooled to about 65 °C onto the inner tank glass plate. Let it stand at room temperature until the gel is completely solidified, and gently pull out the comb vertically to prepare a 2% agarose gel. Place the gel and the inner tank in the electrophoresis tank. Use a 10 μL micropipette to add DL 2000 DNA Marker (as a control) and the above PCR amplification product into the small slots of the gel plate. After loading the samples, apply an electric current for electrophoresis, and set the voltage to 100 V. After electrophoresis, take out the gel, stain it with a fluorescent nucleic acid gel staining solution for about 20 min, and perform ultraviolet development through a gel imaging system. A band with a size of approximately 300 bp can be observed, indicating that the target fragment has been successfully amplified.

[0081] Purification and recovery of PCR products: Use a PCR product purification kit (QIAGEN, QIAquick PCR Purification Kit (50), 28104) for purification and recovery. The operation is as follows according to the instructions: Add the PCR product into a 2 mL centrifuge tube, add Buffer PB with a volume 5 times that of the PCR product, and mix well. Place the adsorption column in a 2 mL centrifuge tube, and add the above well-mixed solution into the adsorption column. Centrifuge at 12000 rpm for 1 min, and discard the filtrate. Place the adsorption column back into the 2 mL centrifuge tube, add 750 μL Buffer PE into the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the filtrate. Place the adsorption column back into the 2 mL centrifuge tube, centrifuge again at 12000 rpm for 1 min, and discard the filtrate. Place the adsorption column in a clean 1.5 mL centrifuge tube and let it stand for 5 min. Add 30 μL Buffer EB (heated to 65 °C to improve the elution efficiency) to the center of the adsorption column, let it stand at room temperature for 1 min, and centrifuge at 12000 rpm for 1 min. Obtain the recovered PCR liquid product. The concentration of the recovered fragment liquid is 110 ng / μL.

[0082] Digestion and ligation of the amplified product: After obtaining the PCR amplified product, establish the following digestion-ligation system:

[0083] Table 9 Digestion-ligation system

[0084]

[0085] Transformation of Escherichia coli: Take 20 μL of the ligation system in a laminar flow hood and add it to 100 μL of Escherichia coli competent cell DH5α. Flick gently to mix. Incubate on ice for 5 min, then place it in a water bath at 42 °C for heat shock for 90 s. Immediately after that, incubate on ice for 3 min. Add 1 mL of LB solution and mix well; culture it on a shaker at 37 °C and 220 rpm for 30 min. Spread approximately 200 μL of the transformed bacteria evenly on a solid LB + kana plate. Seal the plate and invert it in an incubator at 37 °C for 1 day. After single colonies grow out, pick a single clone plaque and inoculate it into an LB + 50 mg / L kana liquid medium. Culture it on a shaker at 37 °C and 220 rpm for 30 min. Send the single clone bacterial liquid to Qingke Biotechnology Company for sequencing and use the geneious software for sequence alignment. Correct alignment indicates successful construction of the VIGS silencing vector ( Figure 1 ).

[0086] Agrobacterium transformation: The correctly sequenced expression vector plasmid returned by Qingke Company was transferred into Agrobacterium tumefaciens GV3101 to prepare for subsequent cucumber VIGS infection experiments. Take 2 μL of the plasmid in a laminar flow hood and add it to 100 μL of Agrobacterium tumefaciens GV3101 competent cells, and gently flick to mix. After mixing, ice-bath for 5 min, freeze in liquid nitrogen for 1 min, and then quickly place it in a water bath at 37 °C for 5 min. Add 800 μL of LB medium and culture it on a shaker at 28 °C and 220 rpm for 2 h. Centrifuge at 12000 rpm for 1 min to concentrate the bacterial solution, add 200 μL of LB liquid medium to resuspend, mix well, and evenly spread it on a solid medium of LB + 50 mg / L Kana, and incubate in the dark at 28 °C for 2 d. Pick out the Agrobacterium monoclonal colonies and shake the bacteria in LB + 50 mg / L kana + 25 mg / L rif liquid for 12 h, and store the bacterial solution in a -80 °C ultra-low temperature refrigerator for later use.

[0087] (2) VIGS infection experiment

[0088] Soak cucumber seeds (germplasm CG0003, see the literature Qi J, Liu X, Shen D, Miao H, Xie B, Li X, Zeng P, Wang S, Shang Y, Gu X et al (2013) A genomic variation map provides insights into the genetic basis of cucumber domestication and diversity. Nat Genet 45: 1510 - 1515), soak the seeds in warm water at 55 °C for 15 - 30 min, and measure the temperature with a thermometer.

[0089] Peel the seeds: Keep the seeds moist throughout the peeling process. Place the peeled seeds in a dish with a moist gauze on both the top and bottom, and incubate in an incubator at 28 °C for 24 h for germination.

[0090] Shake the bacteria: Add the bacterial solution and the culture medium to a conical flask. Bacterial solution: Culture medium = 1:1000. Culture medium: LB + 50 mg / L kana + 25 mg / rif; The volume ratio of Kana to LB and the volume ratio of rif to LB are both 1:1000, and shake in a shaker for about 24 h.

[0091] Infection: Transfer the shaken bacteria to a 50 mL large centrifuge tube, centrifuge in a centrifuge at 6000 rpm for 8 - 10 min, and discard the supernatant. Prepare the MAA resuspension solution as follows:

[0092] Table 10 MAA resuspension solution

[0093] Reagent Stock solution concentration Volume Water 1000 mL <![CDATA[MgCl2]]> 1M 10 mL MES 0.5M 20 mL AS 20 mg / mL 1 mL

[0094] Among them, the preparation method of MES is as follows: Add 10.6625 g of MES to 100 mL of water.

[0095] Pour a little of the prepared MMA solution into the bacteria to resuspend the Agrobacterium tumefaciens. Use MMA as a control to adjust the OD value to 0.35 - 0.4. Put the cut seeds into the bacterial solution and sonicate at 40 w for 30 s, then vacuum at -10 kPa for 10 min. Transfer the seeds to vermiculite containing the bacterial solution and co-culture in an incubator at 23 °C for 4 d.

[0096] Transplanting: Wait until the seeds emerge and grow to about 3 cm - 5 cm, then transplant the seedlings into a 50-hole plug tray, transfer them from the incubator to a phytotron, with weak light (turn off one or two fluorescent tubes), cover the lid to keep moisture. When it grows to the three-leaf and one-heart stage, transfer it to a flower pot and inoculate with powdery mildew fungus, and observe its phenotype.

[0097] (3) Detection of CsCPK11 expression level by qRT-PCR

[0098] Extract cucumber tissue RNA and perform reverse transcription according to the method described in Example 2, and then perform qRT-PCR. qRT-PCR primer design: Use Geneious to design quantitative experimental primers for CsCPK11. When designing the primers, the GC content should be maintained at 40% - 60%. The designed primer sequences are as follows (5’-3’): Q-F: TGACGGATATCTAGACTGCAGA (SEQ ID NO:6); Q-R: CATCGGCTAAGGTAGATCGTAG (SEQ ID NO:7).

[0099] qRT-PCR template: Use the cDNA obtained by the above reverse transcription as the template, and Q-F and Q-R as primers for qRT-PCR. The qRT-PCR reaction system is: ChamQ Universal SYBR qPCR Master Mix 5 μL, forward primer (10 μM) 0.5 μL, reverse primer (10 μM) 0.5 μL, template cDNA 1 μL, ddH2O 3 μL. The qRT-PCR results are as Figure 2 shown.

[0100] (4) Identification of powdery mildew resistance of CsCPK11 gene-silenced plants

[0101] To determine the powdery mildew resistance of CsCPK11 gene-silenced plants, when the wild-type and CsCPK11 gene-silenced plants grew to the stage of three true leaves and one heart leaf, a spore suspension was evenly sprayed onto the leaf surface using a sprayer or a watering can. Fourteen days after inoculation with powdery mildew fungus, the powdery mildew disease index of the plants was observed and counted. The disease levels were divided into 6 levels (0, 1, 3, 5, 7, 9). 0, the leaf is clean without any lesions; 1, a small number of fine and blurred powdery spots, and the lesion area accounts for less than 5% of the leaf area; 3, the powdery layer is thin, and the lesion area accounts for more than 5% and less than 30% of the leaf area; 5, the powdery layer is thick, and the lesion area accounts for more than 30% and less than 50% of the leaf area; 7, the powdery layer is thick, and the lesion area accounts for more than 50% and less than 70% of the leaf area; 9, the powdery layer is thick, and the lesion area accounts for more than 70% and less than 90% of the leaf area. After investigating and recording the disease levels of the wild-type and mutants, the disease index was calculated using the following formula: Disease index = [Σ (number of diseased leaves at each level × representative value at each level) / total number of leaves investigated × representative value of the highest level] × 100. It was found that the powdery mildew on the leaves of CsCPK11 gene-silenced plants was more severe than that of the wild-type ( Figure 3 ), and the disease index was higher than that of the wild-type ( Figure 4 ), indicating that silencing the CsCPK11 gene reduced the disease resistance of cucumber to powdery mildew fungus. In summary, through the VIGS gene silencing technology, the present invention discovered a disease resistance gene related to cucumber powdery mildew. After silencing the CsCPK11 gene, the powdery mildew resistance level of cucumber plants was significantly reduced.

[0102] Example 2 Obtaining of CsCPK11 stable transgenic materials

[0103] (1) Primers CsCPK11-F2 and CsCPK11-R2 were designed according to the CsCPK11 gene sequence. RNA was extracted and reverse transcribed and PCR amplified according to the method described in Example 1. Using the cucumber cDNA obtained by reverse transcription as a template, amplification was performed with primers CsCPK11-F2 and CsCPK11-R2, and the fragment length was 1608 bp. Among them, the primers were:

[0104] CsCPK11-F2: AACACGGGGGACTCTAGAATGGGGAATTGTTGCGTTGC (SEQ ID NO:8);

[0105] CsCPK11-R2: AGTTCTGGATCCTCTAGATTGTTTTAACTGCAATGATCCAT CTCTC (SEQ ID NO:9). The reaction system and conditions are shown in Table 11 below:

[0106] Table 11 PCR reaction system and conditions

[0107]

[0108] After subjecting the above PCR products to agarose gel electrophoresis, the PCR products were purified and recovered. The concentration of the recovered fragment solution was 113 ng / μL.

[0109] (2) The following digestion-ligation system was established for the above-obtained PCR amplification products. See Table 12 for details:

[0110] Table 12 Digestion-ligation system

[0111]

[0112]

[0113] (3) Transformation of Escherichia coli: Take 5 μL of the ligation system in a laminar flow hood and add it to 100 μL of Escherichia coli competent DH5α cells. Gently flick to mix evenly. Incubate on ice for 5 min, then place in a 42°C water bath for heat shock for 90 s. Immediately after that, incubate on ice for 3 min. Add 1 mL of LB solution and mix well; culture in a shaker at 37°C and 220 rpm for 30 min. Spread approximately 200 μL of the transformed bacteria evenly on a solid LB + kana plate. Seal the plate and invert it in a 37°C incubator for 1 day. After single colonies grow out, pick a single monoclonal plaque and inoculate it into an LB + Kana liquid medium, and culture in a shaker at 37°C and 220 rpm for 30 min. Send the monoclonal bacterial liquid to Qingke Biotechnology Company for sequencing and perform sequence alignment using the geneious software. If the alignment is correct, it indicates that the overexpression vector construction is successful( Figure 5 ).

[0114] (4) Agrobacterium transformation: Transfer the correctly sequenced expression vector plasmid returned by Qingke Company into Agrobacterium tumefaciens GV3101 to prepare for obtaining stable transgenic CsCPK11 plants in cucumbers. Take 2 μL of the plasmid in a laminar flow hood and add it to 100 μL of Agrobacterium tumefaciens GV3101 competent cells. Gently flick to mix evenly. After mixing, incubate on ice for 5 min, then place in liquid nitrogen for 1 min, and then quickly place it in a 37°C water bath for 5 min. Add 800 μL of LB medium and culture in a shaker at 28°C and 220 rpm for 2 h. Centrifuge at 12000 rpm for 1 min to concentrate the bacterial liquid, add 200 μL of LB liquid medium to resuspend, mix well, and spread it evenly on a solid LB + kana medium. Incubate in the dark at 28°C for 2 days. Pick out the Agrobacterium monoclonal plaque and shake the bacteria in an LB + kana + rif liquid medium for 12 h, and store the bacterial liquid in a -80°C ultra-low temperature refrigerator for later use.

[0115] (5) Obtaining stable transgenic CsCPK11 plants

[0116] Sowing: Select cucumber seeds (germplasm CU2) with plump grains and consistent sizes. Soak the cucumber seeds in 55°C warm water for more than 30 min. After removing the shells, disinfect the seeds (immerse the seeds in 75% ethanol for surface disinfection for 30 s, then soak in 0.5% NaClO for disinfection for 15 min, and finally rinse with sterile water 6 times). Sow the disinfected seeds on the seed germination medium and perform germination culture in the dark (culture temperature is 28°C).

[0117] Preparation of explants: When the sown seeds have germinated for about 36 to 48 hours, the seed coat begins to fall off and clear vascular bundle ridges appear on the cotyledons, place the seeds on filter paper in a clean bench. Moisten the filter paper with IM liquid, cut off about 1 / 3 of the cotyledons at the distal end, remove the hypocotyl, separate the two cotyledons, and each cotyledon will form a U-shaped wound at the proximal end. Use a nano brush (KITA Nanotek brush, NANO-1-003) to gently scrape the explant on the back near the U-shaped cut end. Scrape 4-5 times along the direction from the distal axis to the proximal axis to obtain the explant.

[0118] Agrobacterium infection: Pick positive Agrobacterium colonies and place them in 1 mL of liquid LB medium containing 50 mg / L Kan and 25 mg / L rif and shake at 28°C (200 r / min) for 24 hours. Transfer the shaken bacteria to 15 mL of liquid LB medium and culture them overnight at a ratio of 1:1000 to reach OD600 0.6-0.8. Centrifuge at 6000 r / min for 8 minutes to collect Agrobacterium and dilute and resuspend them with IM liquid medium to OD600 0.2. Add 0.1% As and culture them on a shaker at 50 r / min in the dark for 1 hour. Then divide the bacterial liquid into two portions and put them into two conical flasks. Put the prepared explants into a conical flask containing the infection solution, and use an ultrasonic cleaner (KQ-500DE) to ultrasonically treat the conical flask containing the explant and Agrobacterium suspension for 10 seconds at a power of 100 W. During this time, the flask was gently shaken to prevent the explants from sinking to the bottom. The explants were then transferred to a 20 mL medical syringe, 15 mL of another agrobacterium suspension was added, the air in the syringe was expelled, and the distal end of the syringe was sealed with a rubber cap. The plunger was slowly pulled from the 15 mL mark to the 20 mL mark for 90 seconds, during which time gentle shaking was maintained.

[0119] Co-cultivation: After vacuum operation, drain the Agrobacterium suspension and transfer the explants to a culture dish with dry filter paper. Drain the liquid on the surface of the explants and culture them in the dark at 23°C on the co-cultivation medium with filter paper for 4 days. Use a fluorescent stereo microscope or a handheld fluorescent protein observation lamp LUYOR-3415RG (Shanghai Luyang Biotechnology Co., Ltd.) to observe the luminescence of the fluorescent protein and evaluate the infection quality.

[0120] Differentiation culture: After co-culture, the explants were rinsed with sterile water for 8 times, and the liquid attached to the surface was dried with sterilized absorbent paper, and then transferred to the differentiation medium, and the explants were inserted into the medium slightly obliquely. Subculture was performed on the differentiation medium every 10 days or so, and explants containing transgenic regenerated buds were selected at the 7th week, 9th week, and 11th week of differentiation, respectively, and placed in tissue culture bottles containing differentiation medium and trimmed appropriately.

[0121] Rooting culture: When the transgenic regenerated shoots grow to 2 - 4 cm in length, transfer them to tissue culture bottles containing rooting medium.

[0122] Seedling transplantation: Appropriately harden off the transgenic plants with well-developed roots when they grow to the bottle mouth, and then transplant them into sterilized substrate. Cultivate the strong seedlings in an artificial climate chamber, and then plant them in the field or plastic flower pots until the seeds are harvested (for transgenic plants such as Figure 6 ).

[0123] (6) Conduct disease index investigation and analysis according to the powdery mildew inoculation method and disease index investigation method described in Example 1. The results are as Figure 7 shown, as can be seen from Figure 7 .

[0124] (7) Detect the expression level of CsCPK11 in the stable transgenic CsCPK11 plants by QRT-PCR. The extraction, reverse transcription of the tissue RNA of the transgenic plants and the primers are the same as those in Example 1. The detection results are as Figure 8 shown.

[0125] From the above results, it can be seen that the plants overexpressing CsCPK11 show higher resistance to powdery mildew.

[0126] It is necessary to point out here that the above embodiments are only for further elaboration and explanation of the technical solutions of the present invention, and do not further limit the technical solutions of the present invention. The method of the present invention is only a preferred implementation solution and is not used to limit the protection scope of the present invention. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Application of the CsCPK11 gene in cucumber powdery mildew resistance, characterized in that, The CsCPK11 gene is a nucleotide sequence capable of encoding the following protein (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2; (b) a protein derived from (a) with one or several amino acid sequences substituted, deleted or added and having the same enzyme activity.

2. The application according to claim 1, wherein The nucleotide sequence of the CsCPK11 gene is selected from any one of the following (a) or (b): (a) a DNA sequence with the nucleotide sequence shown in SEQ ID NO: 1; (b) a nucleotide sequence having a homology of more than 90% with the DNA sequence in (a) and encoding the protein described in claim 1.

3. Application of the quantitative detection primer for detecting the expression of the CsCPK11 gene described in claim 1 in screening cucumber powdery mildew resistant varieties.

4. The application according to claim 3, wherein The nucleotide sequence of the quantitative detection primer is shown in SEQ IDNO: 6-7.

5. Application of the silencing sequence of the CsCPK11 gene in altering the powdery mildew resistance of cucumbers, characterized in that, The nucleotide sequence of the silencing sequence is shown in SEQ ID NO:

3.

6. Application of the vector and engineering bacteria containing the silencing sequence described in claim 5 in changing the resistance of cucumber to powdery mildew.

7. The application according to claim 5, characterized in that, The engineering bacteria include but are not limited to Escherichia coli, Agrobacterium, and / or the vector is the pV190 vector.

8. A method for changing the resistance of cucumber to powdery mildew, characterized in that, The method includes the following steps: Design the silencing sequence of the gene according to the cucumber CsCPK11 gene on the website https: / / vigs.solgenomics.net / , and design and synthesize the primers required for constructing the vector according to the silencing sequence; Perform PCR amplification on the CsCPK11 silencing sequence using the primers, recover and enzymatically ligate the amplification product, so as to insert the CsCPK11 silencing sequence between the multiple cloning sites of the vector plasmid and construct a VIGS gene silencing vector; Then infect cucumber seeds with the constructed VIGS gene silencing vector, culture and transplant to obtain plants with reduced resistance.

9. The method according to claim 8, characterized in that The nucleotide sequence of the silencing sequence is shown in SEQ ID NO: 3, and the primer sequences required for constructing the vector are shown in SEQ ID NO: 4-5.

10. A method for improving the resistance of cucumbers to powdery mildew, characterized in that, The method is to overexpress the CsCPK11 gene.

Images