Tobacco protein kinase NtCRK15 and application of gene of tobacco protein kinase NtCRK15 in response of tobacco to low-temperature stress

By overexpressing NtCRK15 protein kinase and its genes in tobacco, overexpression vectors and gene editing strains are constructed, the problem of tobacco sensitivity to low temperature is solved, the cold tolerance in tobacco seedlings is improved, and gene resources are provided for molecular breeding.

CN120366379APending Publication Date: 2025-07-25HENAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510567089.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-07-25

AI Technical Summary

Technical Problem

Tobacco is sensitive to low temperatures, existing cultivation measures are costly and are not suitable for large-scale promotion. No cold resistance function of CRKs gene in tobacco has been reported.

Method used

By overexpressing the tobacco protein kinase NtCRK15 and its genes, overexpression vectors and gene editing lines were constructed to determine their subcellular localization in tobacco cells and regulate the cold tolerance of tobacco.

Benefits of technology

The cold tolerance of transgenic plants in the seedling stage was improved, and the knockout of NtCRK15 reduced the cold tolerance of mutant plants in the seedling stage, providing a genetic resource for molecular breeding to create new germplasm of low-temperature tobacco.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366379A_ABST
    Figure CN120366379A_ABST
Patent Text Reader

Abstract

The invention discloses application of tobacco protein kinase NtCRK15 and a gene thereof in response to low-temperature stress of tobacco, and relates to the technical field of functional gene and plant gene breeding, the amino acid sequence of the protein kinase NtCRK15 is shown as SEQ ID NO.1, and the protein is located on a cell membrane. According to the invention, overexpression of the NtCRK15 improves the cold resistance of a transgenic plant in the seedling stage, and knockout of the NtCRK15 reduces the cold resistance of a mutant plant in the seedling stage, which indicates that the NtCRK15 positively regulates the cold resistance of tobacco. The research result provides excellent gene resources and application basis for creating new low-temperature-resistant tobacco germplasm through a molecular breeding technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the application of a tobacco protein kinase NtCRK15 and its gene in tobacco response to low temperature stress, and belongs to the technical field of plant genetic engineering. Background Art

[0002] Low temperature freezing disasters are mainly caused by the invasion of strong cold air and cold waves from the polar regions, resulting in a continuous multi-day temperature drop, which is an agricultural meteorological disaster that damages crops due to excessively low environmental temperatures and reduces yields. Tobacco ( Nicotiana tabacum ), a thermophilic cash crop, is relatively sensitive to low temperatures. When the temperature is lower than 12 °C, its emergence rate decreases. In the early spring season, the frequent occurrence of cold snaps inhibits the growth of tobacco seedlings in the production areas. Specifically, the plants are short, the number of effective leaves is reduced, the leaves are narrow and long, and early flowering occurs severely, greatly affecting the yield and quality of tobacco leaves. Although there are certain cultivation measures in production to improve the cold tolerance of tobacco seedlings at the seedling stage, the management cost is high and it is not suitable for large-scale popularization and application. CRKs protein kinases are cysteine-rich receptor-like kinases and are a large subgroup among the members of the RLKs family. CRKs are widely involved in regulating plant immune responses, abiotic stresses, and the balance between growth and stress. Under low temperature stress, the gene expression levels of cucumber CsCRK2 , CsCRK6 , CsCRK7 , CsCRK9 , CsCRK10 and CsCRK15 increase; in rubber trees, the transcript abundance of CRKs changes due to cold stress; under low temperature treatment, compared with the control, the survival rates of the single mutant of rice oscrk13 and the triple mutant of oscrk34 / 37 / 38 are significantly lower than those of the wild type, indicating that these CRKs genes positively regulate the cold tolerance of rice. The above research results indicate that the CRKs family may be involved in the regulation of low temperature stress. However, the cold tolerance function of the CRKs gene in tobacco has not been reported. Summary of the Invention

[0003] The purpose of the present invention is to provide the application of a tobacco protein kinase NtCRK15 and its gene in tobacco response to low temperature stress, so as to provide a basis for cultivating tobacco varieties with low temperature tolerance and solve the problem of poor cold tolerance of existing tobacco seedlings at the seedling stage.

[0004] The present invention achieves the above purpose through the following technical solutions: The application of a tobacco protein kinase NtCRK15 in tobacco response to low temperature stress, wherein the gene sequence of the protein kinase NtCRK15 is as shown in SEQ ID NO.1.

[0005] Application of a gene encoding tobacco protein kinase NtCRK15 in tobacco response to low temperature stress, wherein the amino acid sequence of the encoded protein is as shown in SEQ ID NO.2.

[0006] Preferably: the protein kinase NtCRK15 is localized to the cell membrane.

[0007] Preferably: a method for determining the subcellular localization of NtCRK15 in tobacco cells, comprising the following steps: (1) Find the coding region sequence of the gene on the NCBI website according to the gene serial number of NtCRK15, and design primers. The specific primer sequences are as follows: NtCRK15-CDS-F is as shown in SEQ ID NO.7; NtCRK15-CDS-R is as shown in SEQ ID NO.8; (2) Using the cDNA of common tobacco K326 as a template, perform amplification with high-fidelity enzyme PrimeSTAR®, then perform agarose gel electrophoresis, and recover the DNA product with a length of about 2100 bp; (3) Ligate the DNA product to the PLB vector, and transform it into Escherichia coli TOP10 competent cells. After identification by colony PCR, select positive clones for sequencing. After sequence alignment, select the bacterial solution with the correct sequence for plasmid extraction; (4) Using the pCAMBIA2300 vector carrying the GFP tag, adopt the method of homologous recombination, add KpnI and BamHI restriction enzyme sites, and construct the NtCRK15-2300 fusion expression vector. The primer sequences are as follows: NtCRK15-2300-F is as shown in SEQ ID NO.9: NtCRK15-2300-R is as shown in SEQ ID NO.10: Using the cloning vector NtCRK15-PLB as a template, perform PCR amplification with primers NtCRK15-2300-F and primers NtCRK15-2300-R, and recover the PCR product; (5) At the same time, double-digest the pCAMBIA-2300 vector with KpnI and BamHI enzymes, and recover the vector. Ligate the recovered vector with the recovered PCR product, transform it into Escherichia coli TOP10 competent cells. After identification by colony PCR, select positive clones for sequencing. After sequence alignment, select the bacterial solution with the correct sequence for plasmid extraction; (6)The constructed vector NtCRK15-2300 was transferred into Agrobacterium tumefaciens EHA105 by the freeze-thaw method, and kanamycin and rifampicin were used for screening. Positive clones were picked, and the positive clones were cultured in liquid. Subsequently, tobacco leaves were injected. After 2-3 days of culture, the subcellular localization of NtCRK15 was observed using a laser confocal microscope.

[0008] Preferably, the application is to improve the cold tolerance of tobacco seedlings by overexpressing the protein kinase NtCRK15.

[0009] Preferably, the method for establishing the overexpression vector of the protein kinase NtCRK15 includes the following steps: The overexpression vector was constructed by homologous recombination, and the primers were designed as follows: NtCRK15-OE-F (SEQ ID NO.11): AACACGGGGGACTTTGCAACATGGCGTCTGCTCTAGCTTTAAGCAG NtCRK15-OE-R (SEQ ID NO.12): TGAAGACAGAGCTAGTTACATCATCGGGGTGATTGAATTGATAAAGTGACATC PCR amplification was performed to obtain the PCR amplification product, and gel recovery was carried out. It was ligated to the digested pBWA(V)HS vector to construct the pBWA(V)HS-NtCRK15 overexpression vector.

[0010] The present invention also provides a method for constructing an NtCRK15 gene editing line, including the following steps: Two target sites on the exon of NtCRK15, sgRNA-1 (SEQ ID NO.13): CTGCCAAAGCTGCATTGACGAGG sgRNA-2 (SEQ ID NO. 14): CCTCCACCCTGGACTACTCAGGT were concatenated to the AtU26 vector, and finally fused with the pHSbdcas9i vector by enzymatic digestion and ligation. The beneficial effects of the present invention:

[0011] The present invention found that overexpression NtCRK15 improved the cold tolerance of transgenic plant seedlings, and knockout NtCRK15 reduced the cold tolerance of mutant plant seedlings, indicating NtCRK15Positively regulate the cold tolerance of tobacco. The results of this study provide excellent gene resources and application basis for creating new germplasms of low-temperature-tolerant tobacco through molecular breeding techniques. Brief Description of the Drawings

[0012] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0013] Figure 1 For NtCRK15 Expression pattern under low-temperature stress; Figure 2 For NtCRK15 Expression pattern in different tissues; Figure 3 For NtCRK15 Subcellular localization in tobacco cells; Figure 4 For NtCRK15 Identification of overexpression and gene-edited lines; Figure 5 For NtCRK15 Phenotypic identification of overexpression lines and gene-edited lines; Figure 6 For NtCRK15 Determination of physiological indexes of overexpression lines and gene-edited lines. Detailed Embodiments

[0014] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the drawings in the embodiments of the present invention. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0015] Example 1, NtCRK15 Expression pattern under low-temperature stress Six-week-old common tobacco variety K326 ( Nicotiana tobacumThe L. cv. K326 was placed in an 8 °C incubator for low-temperature treatment. After 0 h, 3 h, 6 h, 12 h, 24 h, 36 h, and 48 h of treatment, the leaves at the second-to-last position (3 biological replicates) were taken, and the main veins of the leaves were cut off. After wrapping them with tin foil, they were immediately placed in an -80 °C refrigerator for storage. After the samples were taken, they were ground with liquid nitrogen to extract RNA. Referring to the instruction manual of the HiScript Q RTSuperMix for qPCR(+gDNA wiper) kit from Nanjing Novozymes Biotech Co., Ltd., the RNA was reverse-transcribed to obtain cDNA. Then, quantitative primers were designed to detect NtCRK15 the expression under low-temperature stress, and the results are as Figure 1 shown.

[0016] The primer sequences are as follows: qRT-NtCRK15-F (SEQ ID NO.3): CTGGCTTATCGCAGTCCTGT qRT-NtCRK15-R (SEQ ID NO.4): TTGTGGAAGCGTTTGAGGGT qRT-NtACTIN-F (SEQ ID NO.5): CTCCCACATGCTATTCTCCGTTTG qRT-NtACTIN-R (SEQ ID NO.6): TTCCTGTTCATAGTCGAGAGCA Figure 1 The results showed that NtCRK15 gene expression was induced by low temperature, specifically showing a trend of first increasing and then decreasing, and its expression level was the highest after 24 h of cold stress.

[0017] Example 2, NtCRK15 Expression pattern in different tissues The roots, stems, middle leaves, flower buds, and flowers of K326 at the mature stage were taken, wrapped with tin foil, ground with liquid nitrogen, and RNA was extracted. Referring to the instruction manual of the HiScript Q RT SuperMix for qPCR(+gDNA wiper) kit from Novozymes, the RNA was reverse-transcribed to obtain cDNA. Then, quantitative primers were designed to detect the expression levels in different tissues NtCRK15 and the results are as Figure 2 shown.

[0018] Figure 2 The results indicated that NtCRK15 the expression was tissue-specific and the highest in leaves.

[0019] Example 3,NtCRK15 Subcellular localization in tobacco cells According to NtCRK15 the gene sequence number, find the coding region sequence of the gene on the NCBI website and design primers. The specific primer sequences are as follows: NtCRK15-CDS-F (SEQ ID NO.7): ATGGCGTCTGCTCTAGCTTTAAG NtCRK15-CDS-R (SEQ ID NO.8): TCATCGGGGTGATTGAATTGATAAA Using the cDNA of common tobacco K326 as a template, amplify it with the high-fidelity enzyme PrimeSTAR®, then perform agarose gel electrophoresis, and recover the DNA product with a length of about 2100 bp. Then ligate the DNA product to the PLB vector and transform it into Escherichia coli TOP10 competent cells. After identifying the bacterial liquid by PCR, select positive clones for sequencing. Through sequence alignment, select the bacterial liquid with the correct sequence for plasmid extraction. Then use the pCAMBIA2300 vector carrying the GFP tag, and by the method of homologous recombination, add KpnI and BamHI restriction enzyme sites to construct the NtCRK15-2300 fusion expression vector. The primer sequences are as follows: NtCRK15-2300-F (SEQ ID NO.9): TCATTTGGAGAGAACACGGGGGACGAGCTCGGTACCATGGCGTCTGCTCTAGCTTTAAG NtCRK15-2300-R (SEQ ID NO.10): GCCCTTGCTCACCATGGTGTCGACTCTAGAGGATCCTCGGGGTGATTGAATTGATAAAGT Using the cloning vector NtCRK15-PLB as a template, PCR amplification was performed with primers NtCRK15-2300-F and NtCRK15-2300-R, and the PCR product was recovered. Meanwhile, the pCAMBIA-2300 vector was double-digested with KpnI and BamHI enzymes, and the vector was recovered. The recovered vector was ligated with the recovered PCR product, transformed into Escherichia coli TOP10 competent cells. After identification by colony PCR, positive clones were selected for sequencing. Through sequence alignment, the bacterial liquid with the correct sequence was selected for plasmid extraction. The constructed vector NtCRK15-2300 was transferred into Agrobacterium tumefaciens EHA105 (purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd.) by the freeze-thaw method, and kanamycin and rifampicin screening were carried out. Positive clones were picked, and the positive clones were cultured in liquid, and then injected into tobacco leaves. After 2-3 days of culture, the subcellular localization of NtCRK15 was observed using a laser confocal microscope.

[0020] The results are as Figure 3 shown, NtCRK15 is localized in the cell membrane. Example 4. Identification of NtCRK15 overexpression and gene editing lines

[0021] The overexpression vector was constructed using the homologous recombination method, and the primers were designed as follows: NtCRK15-OE-F (SEQ ID NO.11): AACACGGGGGACTTTGCAACATGGCGTCTGCTCTAGCTTTAAGCAG NtCRK15-OE-R (SEQ ID NO.12): TGAAGACAGAGCTAGTTACATCATCGGGGTGATTGAATTGATAAAGTGACATC PCR amplification was performed to obtain the PCR amplification product, which was then gel-purified and ligated with the digested pBWA(V)HS vector to construct the pBWA(V)HS-NtCRK15 overexpression vector. Overexpression tobacco plants were obtained by the leaf disc method. RNA was extracted from two of the lines (OE-4 and OE-7) and reverse-transcribed, and then the expression levels in the two lines were detected by fluorescence quantitative PCR. The results showed that the expression levels of NtCRK15 in the two transgenic lines were significantly higher than those in the wild type ( NtCRK15 A). Figure 4 A).

[0022] In addition to creating NtCRK15 overexpression tobacco lines, gene editing lines of NtCRK15 were also created. Two target sites on the exon of NtCRK15: sgRNA-1 (SEQ ID NO.13): CTGCCAAAGCTGCATTGACGAGG sgRNA-2 (SEQ ID NO. 14): CCTCCACCCTGGACTACTCAGGT It was concatenated to the AtU26 vector and finally fused with the pHSbdcas9i vector by restriction enzyme digestion and ligation methods.

[0023] Multiple gene-edited lines were obtained by the leaf disc method, and two of them (ko-8 and ko-12) were identified. For the two target sites, the following detection primers were designed: check-F (SEQ ID NO.15): AACCGCTTGCTGTACAGATCA check-R (SEQ ID NO.16): CATAAATTGTTTTGGCCGCGAA The genomic fragment was amplified, and after obtaining the fragment, it was sequenced, and then the sequenced fragment was aligned with the corresponding fragment of the wild-type K326. The results showed that compared with the wild type, base insertions and deletions occurred in the editing site regions of the two gene-edited plants respectively ( Figure 4 B).

[0024] Example 5 NtCRK15 Phenotypic identification of overexpression lines and gene-edited lines The wild-type K326, NtCRK15 transgenic overexpressing tobacco (OE-4 and OE-7) (T3 generation) and NtCRK15 gene-edited tobacco (ko-8 and ko-12) seeds (T3 generation) were planted in seedling pots. After growing for 10 d, they were transferred to nutrient pots, with 4 plants planted in each pot, and placed on a light culture rack for cultivation. After growing for 15 d, normal temperature (25°C) and low temperature (1°C) treatments were carried out. The results are as Figure 5 shown in A. Under normal conditions, the wild-type plants, the two overexpression lines and the two gene-edited lines grew well and there were no differences among them; after 6 h of low-temperature stress treatment, the leaf margins of the wild-type plants curled and showed mild wilting; there were no obvious changes in the leaves of the two overexpression lines; while the leaf margins of the two gene-edited lines curled more and the degree of leaf wilting was heavier ( Figure 5 A). In addition, the wild-type plants, the two overexpression lines and the two gene-edited lines of tobacco seedlings that had grown for 60 d were also subjected to low-temperature (1°C) treatment. The results are as Figure 5As shown in Figure B, before cold stress treatment (i.e., at 0 h of treatment), there were no obvious differences among wild-type plants, two overexpression lines, and two gene-edited lines. After 4 h of low-temperature treatment, there were no obvious changes in the wild-type line and the overexpression lines, while the leaves of the gene-edited lines showed slight wilting; after 6 h of treatment, the wild-type line showed wilting, the overexpression lines were in good condition, and the leaves of the gene-edited lines were severely wilted. The above results indicate that NtCRK15 positively regulates the cold tolerance of tobacco.

[0025] Example 6, NtCRK15 Determination of physiological indexes of overexpression lines and gene-edited lines The physiological indexes of wild-type plants, two overexpression lines, and two gene-edited lines grown for 60 d in Example 5 were measured at different times (0 h, 2 h, 4 h, 6 h) of low-temperature stress. DAB and NBT staining showed that during the low-temperature treatment, compared with the leaves of wild-type plants, NtCRK15 the accumulation of reactive oxygen species (ROS) in the leaves of the two overexpression lines was lower, while the accumulation of reactive oxygen species (ROS) in the leaves of the gene-edited lines was higher ( Figure 6 A-6B), which was consistent with the results of the contents of hydrogen peroxide (H2O2) and superoxide anion (O2 - ·) in the leaves of each line during low-temperature stress ( Figure 6 C-6D). In addition, after 2 h, 4 h, and 6 h of low-temperature treatment, NtCRK15 the MDA content and relative electrical conductivity of the leaves of the two overexpression lines were significantly lower than those of wild-type plants, while NtCRK15 the two gene-edited lines showed the opposite ( Figure 6 E-6F). In addition, during the low-temperature stress process, NtCRK15 the activities of antioxidant enzymes (POD, SOD, and CAT) in the two overexpression lines were significantly higher than those of wild-type plants, while the activities of antioxidant enzymes in the leaves of their gene-edited lines were significantly lower than those of wild-type plants ( Figure 6 G-6I). The above results indicate that NtCRK15 may improve the cold tolerance of tobacco by activating the antioxidant system. Since osmotic adjustment substances play an important role in plant response to cold stress, the contents of proline, soluble protein, and soluble sugar in different lines were subsequently measured. The results showed that NtCRK15 the contents of proline, soluble protein, and soluble sugar in the two overexpression lines were significantly higher than those of wild-type plants, while NtCRK15 the contents of proline, soluble protein, and soluble sugar in the two gene-edited lines were significantly lower than those of wild-type plants ( Figure 6 J-6L), indicating that NtCRK15It may respond to low-temperature stress by participating in the regulation of osmoregulatory substances.

[0026] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Application of a tobacco protein kinase NtCRK15 in tobacco response to low temperature stress, wherein the gene sequence of the protein kinase NtCRK15 is shown as SEQ ID NO.

1.

2. Application of a gene encoding a tobacco protein kinase NtCRK15 in tobacco response to low temperature stress, wherein the amino acid sequence of the encoded protein is shown as SEQ ID NO.

2.

3. The application according to claim 1, wherein: The protein kinase NtCRK15 is located in the cell membrane.

4. The application according to claim 3, wherein: Method for determining the subcellular localization of NtCRK15 in tobacco cells, comprising the following steps: (1) Find the coding region sequence of the gene on the NCBI website according to the gene serial number of NtCRK15 and design primers. The specific primer sequences are as follows: NtCRK15-CDS-F is shown as SEQ ID NO.7; NtCRK15-CDS-R is shown as SEQ ID NO.8; (2) Using the cDNA of common tobacco K326 as a template, perform amplification with the high-fidelity enzyme PrimeSTAR®, then perform agarose gel electrophoresis, and recover the DNA product with a length of about 2100 bp; (3) Connect the DNA product to the PLB vector and transform it into Escherichia coli TOP10 competent cells. After identifying by colony PCR, select positive clones for sequencing. After sequence alignment, select the bacterial solution with the correct sequence for plasmid extraction; (4) Using the pCAMBIA2300 vector carrying a GFP tag, adopt the method of homologous recombination, add KpnI and BamHI restriction enzyme sites to construct the NtCRK15-2300 fusion expression vector. The primer sequences are as follows: NtCRK15-2300-F is shown as SEQ ID NO.9: NtCRK15-2300-R is shown as SEQ ID NO.10: Using the cloning vector NtCRK15-PLB as a template, perform PCR amplification with primers NtCRK15-2300-F and NtCRK15-2300-R, and recover the PCR product; (5) At the same time, double-digest the pCAMBIA-2300 vector with KpnI and BamHI enzymes and recover the vector. Connect the recovered vector with the recovered PCR product, transform it into Escherichia coli TOP10 competent cells. After identifying by colony PCR, select positive clones for sequencing, and then perform sequence alignment. Select the bacterial solution with the correct sequence for plasmid extraction; (6) The constructed vector NtCRK15-2300 is transferred into Agrobacterium tumefaciens EHA105 by the freeze-thaw method, screened with kanamycin and rifampicin, pick positive clones, perform liquid culture on the positive clones, then inject tobacco leaves, and after culturing for 2 - 3 d, observe the subcellular localization of NtCRK15 using a laser confocal microscope.

5. The application according to claim 1, wherein: The application is to improve the cold tolerance of tobacco seedlings by overexpressing the protein kinase NtCRK15.

6. The application according to claim 5, wherein: The method for establishing the overexpression vector of the protein kinase NtCRK15 comprises the following steps: Use the method of homologous recombination to construct the overexpression vector, and design primers as follows: NtCRK15-OE-F is shown in SEQ ID NO. 11: NtCRK15-OE-R is shown in SEQ ID NO. 12: Perform PCR amplification to obtain the PCR amplification product, perform gel extraction, and ligate it with the digested pBWA(V)HS vector to construct the pBWA(V)HS-NtCRK15 overexpression vector.

7. A method for constructing an NtCRK15 gene-edited strain, characterized in that: It includes the following steps: Two target sites on the NtCRK15 exon, sgRNA-1 is shown in SEQ ID NO. 13, sgRNA-2 is shown in SEQ ID NO. 14: are concatenated onto the AtU26 vector, and finally fused with the pHSbdcas9i vector by enzymatic digestion and ligation methods.