Label oligonucleotide for quality control, reagent or kit, and preparation method and application thereof

Abstract

The invention discloses tag oligonucleotide for quality control, a reagent or a kit as well as a preparation method and application of the tag oligonucleotide. The optimal oligonucleotide tag sequence is finally obtained by randomly generating an oligonucleotide sequence and carrying out multiple screening under specific screening conditions. Based on the sequence, a specific primer and a corresponding probe are further designed, and a simple, rapid and high-specificity and high-sensitivity detection system is constructed. The obtained tag oligonucleotide sequence can be used as a uniform tag to be introduced into different pathogen nucleic acid standard substances or quality control products, so that the problem that different detection reagents have different detection efficiencies on different pathogens is effectively solved, the series of products are standardized, the quantitative result is accurate, and the optimization of a pathogen detection system is facilitated; meanwhile, the tag sequence is introduced into a positive nucleic acid quality control product, so that the problem of effective discrimination of a false positive result of a to-be-detected sample caused by positive quality control pollution can be effectively solved.

Description

Technical Field

[0001] The present invention relates to the field of gene detection, and particularly to labeled oligonucleotides for quality control, reagents or kits, a preparation method thereof, and applications thereof. Background Art

[0002] In the field of gene diagnosis, the application of quality control products plays a crucial role in ensuring the reliability and repeatability of experimental results. These quality control products usually contain target molecules with known concentrations and types, and are used to monitor various key steps in the experimental process, including sample processing, nucleic acid extraction, and amplification reactions. By comparing with the quality control products, researchers can evaluate the stability of experimental conditions, as well as the existence of operation errors or reagent problems.

[0003] However, the use of quality control products also brings some challenges. One of the main problems is the generation of false positive results. Positive control products are usually used to test the effectiveness of the detection process. However, positive control quality control products derived from the detection object may cause potential contamination during the operation process and trigger false positive results, resulting in negative samples being misdiagnosed as positive. Therefore, more effective and accurate methods are needed to distinguish true positive samples from false positive results caused by positive control products, which is of great significance for improving the accuracy of diagnosis and the effectiveness of patient treatment.

[0004] With the progress of technology, kits for detecting common pathogens emerge in an endless stream. For the same pathogen, since the sequences targeted for detection by different kits are not exactly the same, the designed primers and probes are also different. As a result, different kits often have different detection efficiencies when detecting the same pathogen. For example, through the comparison of seven domestic novel coronavirus nucleic acid detection kits, it is found that the average CT values of the amplification of the ORF1ab target gene by detection reagents produced by different manufacturers are not exactly the same. The same is true for the detection of the N target gene, and the CT values of the detection results of different reagents are not on the same level. In addition, there are kits that can simultaneously detect multiple pathogens through multiplex PCR technology, but different primers and probes are designed for different pathogens, which will further lead to inconsistent detection efficiencies.

[0005] Regarding the potential contamination that positive control products may bring, there are literature reports that two restriction enzyme sites, EcoRV and BamHI, are introduced into the quality control samples in the molecular diagnosis of Bacillus anthracis for identifying false positive amplification caused by quality control contamination. Subsequently, a quality control DNA (RNA) sequence containing a T7 promoter primer, a NotI restriction enzyme site, a detection primer and probe sequence, and a viral gene sequence synthesized artificially is used as a more sophisticated exogenous quality control that can be used in various molecular detection methods. The main objects included in these two are nucleic acid sequences that are the same or similar to the target sequence to be detected or 1-2 restriction enzyme sites.

[0006] In response to the problem that the results of different reagents detecting the same section or the same reagent detecting different sections are too different to be standardized due to different detection efficiencies, some studies have pointed out that several nucleic acid amplification fluorescence quantitative kits for hepatitis C virus in my country can be standardized using the second-generation standard developed by WHO as a reference: a linear regression is performed on the concentration of the standard and the concentration of the measured value, and the detection value (X) of reagents A, B, and C and the true value (Y) of the sample can be corresponded one by one through the regression equation within the linear range, and finally converted to the concentration of the standard. However, this method requires diluting the existing standard and measuring these standards of different concentrations multiple times, which is a cumbersome process. Moreover, only samples within the linear range of the regression equation can be standardized. However, if there is no internationally accepted standard for the target, standardization is still a problem.

[0007] The information in the background technology is only for illustrating the general background of the present invention and should not be regarded as admitting or suggesting in any form that such information constitutes the prior art known to a person skilled in the art. Summary of the invention

[0008] In order to effectively solve the difference in detection efficiency of different primers and probes for different pathogens, make the series of products standardized, comparable and traceable, and at the same time help optimize the pathogen detection system and effectively solve the identification of false positive results caused by positive quality control, the present invention obtains oligonucleotide tag sequences through specific screening conditions, and designs and screens corresponding primers and probes according to the tag sequences, constructs a detection system, and verifies the excellent performance of the system of the present invention in terms of sensitivity, precision and specificity. Specifically, the present invention includes the following contents.

[0009] In a first aspect of the present invention, a method for preparing a quality control label oligonucleotide is provided, comprising the following steps:

[0010] (1) generating candidate oligonucleotide sequences, and performing preliminary screening and shift alignment screening on the generated candidate oligonucleotide sequences to obtain tag sequences;

[0011] (2) obtaining a tag oligonucleotide having the tag sequence, and connecting it to a vector as a template, designing candidate primers and probes for the tag oligonucleotide, and constructing an amplification reaction system to further screen the primers and probes to obtain primers and probes for detection;

[0012] (3) Confirming the performance of the amplification reaction system to obtain a quality control labeled oligonucleotide.

[0013] In certain embodiments, according to the method for preparing a quality control label oligonucleotide of the present invention, the candidate oligonucleotide sequences generated in step (1) are 50-500 bp in length and 2-500 in number.

[0014] In certain embodiments, for the method for preparing a labeled oligonucleotide for quality control according to the present invention, the preliminary screening criteria in step (1) include GC content, the presence or absence of restriction enzyme sites, and the results of homology alignment.

[0015] In certain embodiments, for the method for preparing a labeled oligonucleotide for quality control according to the present invention, the shifted alignment screening in step (1) includes:

[0016] Select a sequence of a fixed length starting from the starting base of the candidate oligonucleotide sequences obtained from the preliminary screening, select a sequence of the fixed length again after a step shift interval length, and repeat this operation until the starting base can no longer be shifted backward, thereby obtaining multiple sequences of the fixed length;

[0017] Perform a second round of screening on the obtained multiple sequences of the fixed length respectively, and the screening criteria include GC content, Tm value, secondary structure score, and BLAT check.

[0018] In certain embodiments, for the method for preparing a labeled oligonucleotide for quality control according to the present invention, the fixed length is 2% - 50% of the length of the candidate oligonucleotide sequence, and the interval length is 2 - 20 bp.

[0019] In certain embodiments, for the method for preparing a labeled oligonucleotide for quality control according to the present invention, in step (2), the amplification reaction system includes a background signal reaction system containing a bovine serum albumin matrix and a simulated reaction system containing a negative plasma matrix, and step (2) includes a step of comparing the amplification results of the background signal reaction system and the simulated reaction system.

[0020] In a second aspect of the present invention, there is provided a labeled oligonucleotide for quality control, which is prepared by the method described in the first aspect.

[0021] In a third aspect of the present invention, there is provided a detection reagent or kit, which includes a template, primers, and probes, and optionally a reaction solution and a mixed enzyme solution, wherein the template includes the labeled oligonucleotide for quality control described in the second aspect.

[0022] In a fourth aspect of the present invention, there is provided the use of the labeled oligonucleotide for quality control described in the second aspect as a pathogen nucleic acid reference material or a quality control product.

[0023] In certain embodiments, the use includes one of the following:

[0024] For standardizing different products to make different products comparable and traceable;

[0025] For comparing the detection efficiency of the same detection reagent for different pathogens;

[0026] For comparing the detection efficiency of different detection reagents for the same pathogen; or

[0027] For solving the pollution problem caused by positive quality control.

[0028] The present invention randomly generates oligonucleotide sequences and performs multiple screening through strict screening conditions, and finally obtains the optimal oligonucleotide tag sequence. Based on such sequences, specific primers and corresponding probes are further designed to construct a detection system with high simplicity, rapidity, specificity and sensitivity. The obtained tag oligonucleotide sequences can be introduced as unified tags into nucleic acid reference materials or quality control products of different pathogens, effectively solving the differences in the detection efficiency of different detection reagents for different pathogens, standardizing series products and the accuracy of quantitative results, and helping to optimize the pathogen detection system; at the same time, introducing the tag sequence into the positive nucleic acid quality control product can also effectively solve the effective discrimination of false positive results of the test samples caused by positive quality control pollution. Brief Description of the Drawings

[0029] Figure 1 Generation and screening of oligonucleotide tag sequences.

[0030] Figure 2 Screening process of tag sequence primers, probes and annealing temperature.

[0031] Figure 3 Melting curves of four pairs of candidate primers of the tag sequence.

[0032] Figure 4 Primer pair 3 and its candidate probes.

[0033] Figure 5 Amplification results of different primer-probe combinations.

[0034] Figure 6 Probit curve of LOD analysis of the RNA detection method of the tag sequence.

[0035] Figure 7 Specificity results of the RNA detection method of the detection tag sequence.

[0036] Figure 8 Probit curve of LOD analysis of the DNA detection method of the tag sequence.

[0037] Figure 9 Specificity results of the DNA detection method of the detection tag sequence.

[0038] Figure 10 Detection results of reagent 1, 2, 3 and the tag sequence.

[0039] Figure 11 Detection results of reagent 1, 2, 3, 4 for ZIKV and the tag sequence.

[0040] Figure 12 Different groups of tag sequences and ZIKV detection results. Detailed implementation manners

[0041] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation on the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0042] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that the upper and lower limits of the range and each intermediate value therebetween are specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0043] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0044] [Preparation method]

[0045] In a first aspect of the present invention, a method for preparing a tag oligonucleotide for quality control is provided, which at least includes the following steps:

[0046] (1) Generate candidate oligonucleotide sequences, and perform preliminary screening and shifted alignment screening on the generated candidate oligonucleotide sequences to obtain tag sequences;

[0047] (2) Obtain tag oligonucleotides having the tag sequences, ligate them to a vector as a template, design candidate primers and probes for the tag oligonucleotides, construct an amplification reaction system to further screen the primers and probes, and obtain primers and probes for detection;

[0048] (3) Confirm the tag oligonucleotide for quality control according to the performance of the amplification reaction system.

[0049] Those skilled in the art should understand that the above numbers (1), (2), (3), etc. are only for the purpose of distinguishing different steps and do not imply the sequence order of the steps. As long as the purpose of the present invention can be achieved, the order of the above steps is not particularly limited. In addition, those skilled in the art should also understand that before and after the above steps (1)-(3), or between any of these steps, other steps or operations may be included, such as further optimizing and / or improving the method described in the present invention. Each step will be described in detail below.

[0050] Step (1):

[0051] Step (1) of the present invention is the step of obtaining a tag sequence, which includes generating a candidate oligonucleotide sequence, and performing preliminary screening and shifted alignment screening on the generated candidate oligonucleotide sequence to obtain the tag sequence.

[0052] The generation of the candidate oligonucleotide sequence in step (1) of the present invention is not limited. Generally, it is randomly and automatically generated. Any method or tool known in the art can be used for the specific random automatic generation method. The length of the candidate oligonucleotide sequence is not limited. Generally, it is the same as or longer than the length of the final required tag oligonucleotide for quality control. Exemplarily, the length of the candidate oligonucleotide sequence is 50-500 bp, for example, in the range of 60-550 bp, 70-500 bp, 80-450 bp, 90-400 bp, 100-350 bp, 105-300 bp, 110-250 bp, 115-200 bp, 120-150 bp. The number of candidate oligonucleotide sequences generated in the present invention is not limited. Generally, it is multiple, such as more than 5, more than 10, more than 20, more than 30, more than 40, more than 50, more than 60, more than 80, more than 100, more than 120, more than 150, more than 180, more than 200, more than 250, more than 300, more than 350, more than 400, more than 450, etc. The specific number is freely selected by the technician according to needs.

[0053] In step (1) of the present invention, the candidate oligonucleotide sequence is screened in two steps to obtain the tag sequence. The first screening is the preliminary screening. The indicators for the preliminary screening can be those known in the art. Examples of such indicators include but are not limited to GC content, the presence or absence of restriction enzyme sites, homology alignment results, etc. The present invention can use one or more of the above indicators. The threshold or range of each indicator is not limited and can be selected according to the specific situation or the nucleic acid to be detected.

[0054] In the present invention, for the GC content index, generally, the threshold or range of the GC content is between 45% and 55%. Excessive or too low GC content will affect subsequent amplification. By selecting the GC content within the above range, the influence on subsequent amplification can be minimized.

[0055] In the present invention, for the restriction site index, usually, a candidate oligonucleotide sequence without restriction sites is selected. In some specific embodiments, when nucleic acid detection does not involve restriction digestion or when the obtained quality control labeled oligonucleotide sequence does not need to be digested by restriction enzymes and is directly ligated to the vector, a candidate oligonucleotide sequence with restriction sites or without specific restriction sites can also be selected. In some specific embodiments, when nucleic acid detection or the obtained quality control labeled oligonucleotide sequence needs to be ligated to the vector through restriction digestion, a candidate oligonucleotide sequence without restriction sites is preferably selected.

[0056] In the present invention, for the homology alignment index, it refers to the sequence homology or similarity between the candidate oligonucleotide sequence and the nucleic acid to be detected or the target nucleic acid. The higher the homology, the higher the noise, and the worse the uniqueness or specificity of the tag sequence. Therefore, it is preferred that there is no homology alignment result or the homology alignment result is relatively low, such as less than 20%, less than 15%, less than 10%, less than 5%, less than 2%, etc. Homology alignment can be performed using methods known in the art. Exemplarily, it can be performed through, for example, the Nucleotide BLAST module of the online tool of NCBI. When the nucleic acid to be detected is a nucleic acid of a human-infecting pathogen, it is preferred to align the candidate oligonucleotide sequence with the sequences of all nucleic acids of human-infecting pathogens.

[0057] In step (1) of the present invention, after the candidate oligonucleotide sequence is preliminarily screened, the remaining sequences are further subjected to a secondary screening, namely, shifted alignment screening, which includes selecting a sequence of a fixed length starting from the starting base of the candidate oligonucleotide sequence obtained by the preliminary screening, selecting a sequence of a fixed length again after a stepwise interval length, and repeating this operation until the starting base can no longer move backward, thereby obtaining a plurality of sequences of a fixed length.

[0058] In the present invention, the position of the starting base is not limited and can be any base at any position of the candidate oligonucleotide sequence. Counting from the 5' end to the 3' end direction, the starting base can be any base on the 5' end side, such as any one of the first 20 bases, the first 10 bases, or the first 5 bases on the 5' end side. In some embodiments, the starting base is the first base at the 5' end. Similarly, when counting from the 3' end to the 5' end direction, it can be treated similarly. In some embodiments, the starting base of the present invention can also be any base at the middle position.

[0059] In the present invention, the selected fixed length is not limited and is generally determined according to the length of the candidate oligonucleotide sequence. Usually, it is 2%-50% of its length, such as 3%, 4%, 5%, 6%, 8%, 10%, 12%, 14%, 16%, 18%, 20%, 25%, 30%, 35%, 40%, 45%, etc. Examples of the fixed length include but are not limited to 10pb, 15pb, 20pb, 25pb, 30pb, 35pb, 40pb, 45pb, 50pb, 55pb, 60pb, and even longer, etc.

[0060] In the present invention, the spacer length refers to the length distance selected again after moving in a certain direction after the previous selection. The spacer length is generally less than the fixed length, for example, it is 1%-90% of the fixed length, such as 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, etc. The specific length is not limited, and exemplary lengths include but are not limited to 3pb, 5pb, 6pb, 8pb, 10pb, 12pb, 14pb, 16pb, 18pb, 20pb, 25pb, etc.

[0061] In the present invention, the direction of stepping or moving is not limited. Usually, it is from one end of the candidate oligonucleotide sequence to the other end. In some embodiments, it can also move from the middle position of the candidate oligonucleotide sequence to both sides respectively.

[0062] In the present invention, multiple fragments of the fixed length are obtained by shifting, and each fragment is respectively subjected to secondary screening. The indicators during screening include but are not limited to GC content, Tm value, secondary structure score, BLAT check, etc. Similar to the GC content index in step (1), the threshold of the GC content in step (2) is not limited either. Usually, however, the upper limit value of its range is greater than the upper limit value in step (1). For example, it is below 75%, below 70%, below 65%, below 60%, below 55%, below 50%, etc.

[0063] In the present invention, the Tm value as the screening indicator in step (2) is not limited, and generally, a range of 40-70°C is sufficient, such as 45-70°C, 50-65°C, 40-65°C, 45-65°C, 50-60°C, etc.

[0064] In the present invention, the secondary structure scoring, which is a screening index in step (2), refers to an index of the secondary structure situation and the secondary structure stability in a fragment of a fixed length. Among them, the number of secondary structures can be reflected by assigning 1 point each time a hairpin structure or a dimer structure appears in the fragment of the fixed length; the stability of the secondary structure is measured by using the free energy ΔG value. The smaller the free energy, the more stable the structure. For example, when the free energies of the inevitable secondary structures including the hairpin structure and the dimer structure in the candidate oligonucleotide displacement comparison fragment are below the threshold (ΔG < -4.5 kcals / mol), it indicates that the secondary structure formed by the fragment is very stable and is not conducive to the achievement of the object of the present invention. Therefore, sequences below the threshold are additionally scored, for example, 2 points. In some embodiments, the secondary structure score of the present invention is the sum of the secondary structure number and the stability score as the total score. The lower the total score, the more favorable it is.

[0065] In the present invention, the BLAT check, which is a screening index in step (2), refers to performing a homology comparison between a fragment of a fixed length and a nucleic acid to be detected or a target nucleic acid, such as a nucleic acid sequence of a common human infectious pathogen, and taking the sequence with a comparison score (score value) lower than the threshold as a sequence without homology. On the contrary, if there is homology, it needs to be deleted.

[0066] Step (2):

[0067] Step (2) of the present invention includes obtaining a tag oligonucleotide having the tag sequence, ligating it to a vector as a template, designing candidate primers and probes for the tag oligonucleotide, constructing an amplification reaction system to further screen the primers and probes, and obtaining the primers and probes for detection.

[0068] In the present invention, the tag oligonucleotide refers to a short nucleic acid molecule or fragment having the tag sequence shown in step (2) obtained by known means such as artificial synthesis. After ligating the tag oligonucleotide to a vector, it is used as an amplification template. The specific ligation method is not limited, and any method known in the art can be used for ligation. Candidate primers and probes for the tag oligonucleotide are designed by known means. Usually, there are multiple groups of candidate primers and probes, so as to screen the optimal combination through the following amplification reaction. The design of the candidate primers or probes here is carried out in a conventional manner.

[0069] In the present invention, the amplification reaction system refers to a system used to verify the amplification effect, which generally includes a background signal reaction system and a mock reaction system. In the present invention, the background signal reaction system uses a reaction system containing bovine serum albumin (BSA) as the matrix, and the concentration of bovine serum albumin is not limited as long as it is an appropriate concentration that can effectively reduce non-specific background signals. Exemplarily, its concentration is below 10%, such as 8%, 6%, 5%, 4%, 3%, 2%, etc. 5% BSA can reduce the interference of non-specific background signals, so it is preferred. The mock reaction system of the present invention contains negative plasma (i.e., the plasma does not contain nucleic acids of common blood-borne pathogens) as the matrix to better simulate the complex environment of clinical or real samples. In the present invention, the matrices in both the background signal reaction system and the mock reaction system can be used for gradient dilution of the template. The background signal reaction system and the mock reaction system of the present invention may further contain a template, primers, and probes.

[0070] In the present invention, the performance of a method, or a labeled oligonucleotide and its primers and probes, is verified by comparing the amplification effects obtained from both the background signal reaction system and the mock reaction system.

[0071] Step (3):

[0072] Step (3) of the present invention is to confirm the labeled oligonucleotide for quality control according to the performance of the amplification reaction system. The performance of the amplification reaction system is comprehensively evaluated including amplification efficiency, comparison between BSA and plasma matrix, and product specificity.

[0073] The performance of the amplification reaction system of the present invention is achieved jointly by the labeled oligonucleotide for quality control and its primers and probes. Therefore, the performance of the amplification reaction system can not only screen out the optimal labeled oligonucleotide for quality control, but also obtain the optimal reaction system based on the labeled oligonucleotide for quality control, and this system is also the optimal system for subsequent detection. From this perspective, the method for preparing the labeled oligonucleotide for quality control of the present invention can also be understood as a method for establishing a quality control detection system.

[0074] [Labeled oligonucleotide for quality control]

[0075] In the second aspect of the present invention, there is provided a labeled oligonucleotide for quality control, which is prepared by the method described in the first aspect.

[0076] In the present invention, the term "label oligonucleotide for quality control" is sometimes abbreviated as "the label oligonucleotide of the present invention", and refers to a short nucleotide sequence used as a label to distinguish the nucleic acid to be detected in the standard or quality control product of the nucleic acid to be detected. The length of the label oligonucleotide of the present invention is not limited, generally 50-500 bp, such as in the range of 60-550 bp, 70-500 bp, 80-450 bp, 90-400 bp, 100-350 bp, 105-300 bp, 110-250 bp, 115-200 bp, 120-150 bp.

[0077] [Reagent or kit for detection]

[0078] In the third aspect of the present invention, there is provided a reagent or kit for detection, which comprises a template, primers and probes, and optionally a reaction solution and a mixed enzyme solution. Among them, the template contains the label oligonucleotide for quality control described in the second aspect of the present invention.

[0079] In the present invention, the template refers to the substrate for amplifying the label oligonucleotide for quality control, which is usually a nucleic acid molecule containing the label oligonucleotide for quality control and a vector. The specific form of the vector is not limited, including but not limited to plasmids, etc. Any known plasmid can be used. The template is usually obtained by ligating the screened synthetic label oligonucleotide with the vector. The means of ligating nucleic acid molecules are known in the art, and reference can be made to public publications such as the fourth edition of "Molecular Cloning: A Laboratory Manual" of Cold Spring Harbor.

[0080] In the present invention, the primers and probes generally refer to the optimized primers and probes after screening obtained by the preparation method described in the first aspect.

[0081] In the reagent or kit of the present invention, in addition to the label oligonucleotide and its primers and probes, it may also include precautions related to regulating the manufacture, use or sale of diagnostic kits in the form stipulated by government agencies. In addition, the kit of the present invention may also be provided with detailed instructions for use, storage and troubleshooting. The kit may optionally be set in a device suitable for robotic operation preferably for high-throughput settings.

[0082] In certain embodiments, the components of the reagent or kit of the present invention (for example, the standard oligonucleotide and its primers, probes, etc.) may be provided as dry powder. When the reagent and / or component is provided as dry powder, the powder can be restored to its original state by adding a suitable solvent. It is expected that the solvent can also be set in another container. The container usually includes at least one vial, test tube, flask, bottle, syringe and / or other container means, and the solvent can be placed in aliquots optionally. The kit may also include means for a second container for containing a sterile, pharmaceutically acceptable buffer and / or other solvents.

[0083] In certain embodiments, the components of the reagent or kit of the present invention may be provided in solution form, such as in the form of an aqueous solution. When present in an aqueous solution state, the concentration or content of these components can be conveniently determined by those skilled in the art according to different requirements. For example, for storage purposes, the concentration of an oligonucleotide, for example, may be present in a relatively high form, and when in a working state or in use, the concentration can be reduced to a working concentration by diluting the above-mentioned relatively high-concentration solution, for example.

[0084] The reagent or kit of the present invention may further comprise other reagents or components. For example, DNA polymerase, various dNTPs, and ions such as Mg required for performing PCR 2+ etc. These other reagents or components are known to those skilled in the art and can be easily obtained from public publications such as the fourth edition of "Molecular Cloning: A Laboratory Manual" of Cold Spring Harbor.

[0085] When there is more than one component present in the reagent or kit of the present invention, the reagent or kit will also typically include second, third, or other additional containers for separately placing the other components. Additionally, combinations of various components can be included in the container.

[0086] The reagent or kit of the present invention may further include components for maintaining or preserving DNA, such as reagents for preventing nucleic acid degradation. Such components may be, for example, RNase-free or nucleases with RNase resistance protection. Any composition or reagent described herein may be a component of the kit.

[0087] [Use]

[0088] In a fourth aspect of the present invention, there is provided the use of a labeled oligonucleotide for quality control as a pathogen nucleic acid reference material or quality control product.

[0089] In certain embodiments, the use of the present invention is for standardizing different products. By introducing the screened oligonucleotide tag sequences into different pathogen nucleic acid reference materials or quality control products, the problem of different detection efficiencies of detection reagents from different manufacturers for different pathogens can be effectively solved, making a series of products standardized, comparable, and traceable, and helping to optimize the pathogen detection system; at the same time, it can effectively solve the effective discrimination of false positive results caused by the contamination of negative samples by positive quality control products.

[0090] In some embodiments, the application of the present invention is to solve the problem of different detection efficiencies of detection reagents for different pathogens. For example, a pseudovirus containing a tag sequence RNA, dengue virus (DENV), Zika virus (ZIKV), and chikungunya virus (CHIKV) (a four-part nucleic acid fragment constructed in one RNA sequence, with a ratio of 1:1:1:1) is diluted with negative plasma and then subjected to nucleic acid extraction. The collected eluate is used as the template for final amplification. Three triple detection kits (capable of simultaneously detecting ZIKV, DENV, and CHIKV) and the tag sequence RNA detection method are used to detect ZIKV, DENV, CHIKV, and the tag sequence respectively.

[0091] In some embodiments, the application of the present invention is to solve the problem of different detection efficiencies of different detection reagents for the same pathogen. For example, a pseudovirus containing a tag sequence RNA and a Zika virus (ZIKV) sequence (a two-part nucleic acid fragment constructed in one RNA sequence, with a ratio of 1:1) is diluted with negative plasma and then subjected to nucleic acid extraction. The collected eluate is used as the template for final amplification. A kit capable of detecting ZIKV and the obtained tag sequence RNA detection method are used to detect ZIKV and the tag sequence respectively.

[0092] In some embodiments, the application of the present invention is to solve the pollution problem caused by positive controls. For example, the tag oligonucleotide sequence of the present invention can be added as a unique pollution monitoring sequence after the pathogen sequence to be detected contained in the currently commonly used positive control product, forming a new anti-pollution type control product. When the detection result of the sample to be detected is positive and there is doubt about the result and a recheck is required, the detection method of the present invention is used to detect the sample again. When the tag sequence result is negative, it indicates that the positive result of the sample to be detected is a true positive; when the tag sequence result is positive, it indicates that the positive control product has been mixed into the sample to be detected, causing pollution, and a new sample needs to be collected for detection.

[0093] Example 1

[0094] I. Generation and screening of oligonucleotide tag sequences

[0095] 1. Automatic generation of oligonucleotide sequences

[0096] First, use the online tool sequence generation website http: / / www.detaibio.com / sms2 / random dna.html to randomly generate 50 oligonucleotide sequences of 200 bp.

[0097] 2. Screening of randomly generated oligonucleotide sequences

[0098] 2.1 Preliminary screening

[0099] Perform a round of preliminary step-by-step screening on the above-generated 50 oligonucleotide sequences, and the screening conditions are as follows in sequence:

[0100] (1) GC content screening: The GC content is between 45% and 55%;

[0101] (2) Restriction site inspection: There are no restriction sites or few restriction sites, which does not affect subsequent insertion into the vector;

[0102] (3) Pathogen homology comparison: Use the Nucleotide BLAST module of the online tool https: / / blast.ncbi.nlm.nih.gov / Blast.cgi of the online tool NCBI to perform BLAST comparison on the obtained oligonucleotide sequences, and screen according to the output results. It is required that the comparison results show no homology with the nucleic acid sequences of common human infectious pathogens.

[0103] Results of the first round of screening: After the first round of screening in sequence, the following 4 sequences are left for selection, which are respectively denoted as tag sequences A, B, C, and D.

[0104] Tag sequence A. >random sequence 44 consisting of 200 bases. (No restriction sites)

[0105] ggactctacttgtaaactcaataacgtctttcctacagggtctgtcgcgcttatcgttat

[0106] ccatagtcttcgcggagtcggctgagctactggctttgactaaaccagttagacttggct

[0107] aaccacccgtcaacacttcggatgaactctttatgagagatagttaatgaacgcacggag

[0108] gacttgtcttccggtgtata(SEQ ID NO.1)

[0109] Tag sequence B. >random sequence 45 consisting of 200 bases. (No restriction sites)

[0110] cttatagcgtaagcacatcgtagttctacccggtctgaaaaagccagcaattcgtagatt

[0111] cgagagcaaccctaaacaagccatgccgctggagggcatcttagaacctaatgggggctt

[0112] atggacgccactacgcgaagtctaccctgggcaaggggtcaactcgaagcctgcttcgag

[0113] ctggtcacactcaccacgac(SEQ ID NO.2)

[0114] Tag sequence C.>random sequence 35 consisting of 200 bases.(Apal1)

[0115] gctcacgtctgcgagacacctacatccgtgtgagcgtatgtgagtcggcctacgaaccct

[0116] attacgctgatctaagcactgctagatcactagggtaacccgttgggacttgggatttat

[0117] tataatacttgcgtgcacgagcatttactcctaaaaagtgggtcttcttagatgtgcagg

[0118] ttagacaggctgtctgcgat(SEQ ID NO.3)

[0119] Tag sequence D.>random sequence 36 consisting of 200 bases.(Bal1)

[0120] ctttgcctcaccgcaatctaaatgtcgggaaaggacgacctgcgcctcaccaggcgctaa

[0121] attcaacaaggcatccgcttactggggatatatggccacaatttgatggactcagtcggg

[0122] cttttaggctctcatccattctgtggtaaactgcgtatttagaggcttaccttccttcta

[0123] aggagtcgtcacgcattcgc(SEQ ID NO.4)

[0124] 2.2 Shift Alignment

[0125] To further screen and obtain the optimal tag sequence therefrom, shift alignment is used for secondary screening: for each tag sequence, a 20-bp fragment is sequentially taken from the first base for further screening. For each 20-bp fragment taken, the position of the starting base is shifted 5 bp backward next time, and this operation is repeated until the starting base can no longer be shifted backward.

[0126] The conditions for secondary screening are as follows: for each 20-bp fragment

[0127] (1) GC content screening: GC content ≤ 70%;

[0128] (2) Tm value screening: Tm value is between 40°C and 70°C;

[0129] (3) Secondary structure scoring screening: When there are internally complementary sequences in the oligonucleotide, intramolecular or intermolecular secondary structures may be formed according to the base complementary pairing principle. Common secondary structures include stem-loop structures (or hairpin structures) and dimer structures. The simpler the secondary structure, the more conducive to the hybridization of the oligonucleotide. Therefore, in order to screen for those with simpler secondary structures, Primer Premier5 software was used to analyze all 20-bp fragments obtained by shift alignment of each candidate sequence. To screen more intuitively, the present invention introduces a scoring system: 1 point is manually assigned each time a hairpin structure or a dimer structure appears.

[0130] The stability of the secondary structure is also very important. There are also many factors affecting the stability of the secondary structure. Usually, the free energy ΔG value is used to measure it, and this value reflects the relative stability of the base pairs inside the double-stranded structure. The smaller the free energy, the more stable the structure, especially the secondary structure, and the less conducive to hybridization. The present invention limits the free energy of the inevitable secondary structure to above -4.5 kcal / mol. If the free energy ΔG of the secondary structure of this shift comparison fragment includes a hairpin structure and a dimer structure and is negative and the absolute value > 4.5, it indicates that the secondary structure formed by this fragment is very stable and not conducive to hybridization, and an additional 2 points are assigned.

[0131] Finally, the scores obtained are added up and the total score is calculated. The lower the score, the simpler the secondary structure.

[0132] (4) BLAT check: Check for homology with nucleic acid sequences of common human infectious pathogens: Use the online tool https: / / genome.ucsc.edu / cgi-bin / hgBlat for BLAT alignment, select score 20 as the threshold. When it is above 20, homology is determined to exist, and when score < 20, it is considered that there is no homology with the genome to be aligned.

[0133] Results of the second-round screening:

[0134] (1) GC content screening: There is a 20-bp fragment in Sequence D with a GC content > 70% (cgacctgcgcctcaccaggc, GC content is 75%), so it is excluded first.

[0135] (2) Tm value screening: The Tm value range of all 20-bp fragments of Sequence A is 40°C - 66°C; the Tm value range of all 20-bp fragments of Sequence B is 50°C - 70°C; the Tm value range of all 20-bp fragments of Sequence C is 42°C - 61°C. Therefore, the Tm values of all 20-bp fragments of the three candidate tag sequences A, B, and C all meet the conditions, and no candidate sequence is excluded based on the Tm value.

[0136] (3) Secondary structure scoring screening: As shown in Table 1, among the 37 20-bp fragments of Sequence A, a total of 16 have hairpin structures, among which 1 has a negative ΔG value and an absolute value > 4.5; 28 have dimer structures, among which 23 have a negative ΔG value and an absolute value > 4.5. Finally, the candidate sequence A scores 92 points; among the 37 20-bp fragments of Sequence B, a total of 21 have hairpin structures, among which 2 have a negative ΔG value and an absolute value > 4.5; 32 have dimer structures, among which 25 have a negative ΔG value and an absolute value > 4.5. Finally, the candidate sequence B scores 107 points; among the 37 20-bp fragments of Sequence C, a total of 27 have hairpin structures, among which 0 have a negative ΔG value and an absolute value > 4.5; 34 have dimer structures, among which 28 have a negative ΔG value and an absolute value > 4.5. Finally, the candidate sequence C scores 117 points; thus, the order from low to high score is A < B < C. Therefore, first further exclude the candidate sequences B and C with more complex secondary structure sequences.

[0137] Table 1: Secondary structure scoring table for candidate tag sequences A, B, and C

[0138]

[0139] (4) BLAT check: After aligning the 37 20-bp fragments of Sequence A, it is found that each 20-bp fragment has no cross with the nucleic acids of common human infectious pathogens (score < 20 for all), which meets the requirements. Therefore, there is no need to return to the previous level to select the sequence with the second-lowest score.

[0140] Thus, finally, the tag sequence A is selected as the oligonucleotide sequence finally adopted in the present invention, and the full length of the sequence is as follows:

[0141] ggactctacttgtaaactcaataacgtctttcctacagggtctgtcgcgcttatcgttat

[0142] ccatagtcttcgcggagtcggctgagctactggctttgactaaaccagttagacttggct

[0143] aaccacccgtcaacacttcggatgaactctttatgagagatagttaatgaacgcacggag

[0144] gacttgtcttccggtgtata

[0145] II. Establishment and Optimization of the Label Sequence Amplification Reaction System

[0146] 1. Screening of Primers and Probes for Label Sequences

[0147] Based on the label sequences obtained through multiple screenings using the above strict screening conditions, 4 pairs of upstream and downstream primers and 6 corresponding probes were designed using Oligo7 software and screened from two aspects: Tm value and the score automatically calculated by the software, as shown in Tables 2 and 3 below.

[0148] Table 2: Candidate Primers for the Label Sequence Detection System

[0149]

[0150] Table 3: Candidate Probes for the Label Sequence Detection System

[0151]

[0152] The finally selected label sequence was ligated into the MMLV-based pQCXIG plasmid, and the selected label sequence was denoted as Label. Thus, the plasmid pQCXIG-Label ligated with the label sequence was constructed. Using this plasmid as a template, amplification and screening were carried out using the above primer and probe combinations.

[0153] (1) Screening of Primers

[0154] First, the pQCXIG-Label plasmid was preliminarily quantified using the spectrophotometer method. Taking the process of simulating the detection of blood-borne pathogens as an example, the template was serially diluted with 5% bovine serum albumin (BSA) and negative plasma as matrices respectively. 5% BSA was used as a matrix because BSA can reduce the interference of non-specific background signals and is a relatively simple and stable matrix to evaluate the detection effect of pure templates under ideal conditions. Dilution with negative plasma was used to better simulate the complex environment of clinical or real samples to evaluate the performance of the detection system under conditions close to actual samples. If the amplification results are relatively consistent after serial dilution with these two matrices, it proves that the detection method is relatively stable. Except for screening primers diluted with 5% BSA and negative plasma and comparing them here, the rest were diluted with negative plasma to better simulate the real environment of samples containing blood-borne pathogens.

[0155] Use the highly specific qPCR reagent TB Premix Ex Taq TM II (Tli RNaseH Plus) (manufacturer: Takara, catalog number: RR820B), and amplification was carried out using the dye method with four pairs of primers to be selected respectively. Comprehensive evaluation was carried out from three dimensions: amplification efficiency, comparison between BSA and plasma matrices, and product specificity.

[0156] The results are shown in Tables 4 and 5. First, from the perspective of amplification efficiency, for primer pairs 1 and 3, whether diluted with BSA or negative plasma, the amplification efficiency is within the recommended reasonable range of 90%-110%, and the effect is relatively good. Second, from the comparison between BSA and plasma matrices, after primer pairs 1 and 3 amplified the same template diluted with BSA or negative plasma respectively, the difference in CT values obtained was relatively smaller, and the effect was relatively good. Finally, from the perspective of product specificity, for primer pair 3, the melting curve of the products amplified from different concentrations of templates was single, and the Tm values were exactly the same, with the best effect.

[0157] Therefore, comprehensively, only for primer pair 3, the melting curves of the products amplified from different concentrations of templates completely overlapped, and the Tm values were exactly the same, indicating that the products were homogeneous; and there was no obvious difference in Ct values between the BSA group and the plasma group, and the amplification efficiencies were both between 90% and 110%. So primer pair 3 was selected and added to the final system.

[0158] Table 4: CT values and amplification efficiencies of candidate primers amplified by label sequence 4

[0159]

[0160] Table 5: Tm values (°C) of amplification products of candidate primers by label sequence four

[0161]

[0162] (2) Screening probes

[0163] Since the most suitable primer pair 3 was screened out in the previous step, the size of the final product was 109 bp, and the range of candidate probes was also limited to P1, P2, and P3. Figure 4 Primer pair 3 and its candidate probes are shown.

[0164] After gradient dilution of the template with negative plasma, the system primer pair 3 was combined with probes P1, P2, and P3 respectively, and the Probe qPCR reagent Premix Ex Taq TM (Probe qPCR) (manufacturer: Takara, product number: RR390B) was used for amplification. The results are shown in Table 6. From the amplification results, the CT value of probe P2 was the lowest and the effect was the best. Therefore, probe P2 was selected and added to the final system.

[0165] Table 6: Amplification CT value results of candidate probes for tag sequences

[0166]

[0167] (3) Screening the final concentrations of primers and probes

[0168] After gradient dilution of the template with negative plasma, primer final concentrations of 0.2 μM, 0.4 μM, 0.6 μM and probe final concentrations of 0.1 μM, 0.3 μM, 0.6 μM were selected for permutation and combination, and the template was amplified using the 2×Eagle Premix (PCR) reaction solution (brand: Beijing Jinnuomei, product number: SJ-PCR002). Comprehensive evaluation was carried out from three dimensions: amplification results, fitting curves, and amplification efficiency.

[0169] The results are as Figure 5 and Table 7 show. Considering the height of the amplification curve, the combination of primer final concentration of 0.6 μM and probe final concentration of 0.3 μM had appropriate signal values, relatively forward CT values, high amplification efficiency (99.38%, within the range of 90%-110%), and good linearity of the fitting curve (R 2 = 0.9983). Therefore, the combination of primer final concentration of 0.6 μM and probe final concentration of 0.3 μM was selected and added to the final system.

[0170] Table 7: Fitting curve coefficients, R 2 , amplification efficiency

[0171]

[0172] (4) Screening annealing temperature

[0173] After fixing the concentrations of the primers and probes, the annealing temperature was further screened: a temperature gradient was set between 56 °C and 64 °C: 56 °C, 58 °C, 60 °C, 62 °C, 64 °C, as the annealing temperatures to be screened. According to the final concentrations of the primers and probes fixed above, the template that had been serially diluted with negative plasma was amplified using the 2×Eagle Premix (PCR) reaction solution (brand: Beijing Jinnuomei, product number: SJ-PCR002). The results are shown in Table 8. Considering the fitting curve and amplification efficiency comprehensively, when the annealing temperature of the system was 62 °C, both the linearity of the fitting curve and the amplification efficiency were good (R 2 = 0.987, the amplification efficiency was 105.076%, within the range of 90% - 110%). Therefore, the final annealing temperature of the system was selected as 62 °C.

[0174] Table 8: Coefficients of the fitting curve, R 2 , amplification efficiency

[0175]

[0176] After a series of screenings, the primer pair 3 and the probe P2 were finally selected and added to the final amplification reaction system, with the annealing temperature of the system being 62 °C.

[0177] 2. Establishment of the tag sequence detection system

[0178] After the above screenings of the primer and probe concentrations and the annealing temperature of the detection system, in order to improve the sensitivity of the final reaction system, the finally optimized tag sequence detection system used the 5×Eagle Buffer reaction solution and the 5×Eagle mixed enzyme solution (brand: Beijing Jinnuomei, product number: SJ-PCR026), which contained all the components required for the amplification reaction except for the primers, Taqman probes, and templates. According to the 50 μL system, the primers, probes, 5×Eagle Buffer reaction solution, and 5×Eagle mixed enzyme solution of the tag sequence were added to the same tube of the PCR system as shown in Table 9, and the samples to be tested were amplified. (The detection systems and amplification reaction conditions for DNA and RNA were the same).

[0179] Table 9: Tag sequence detection system (for 1 person)

[0180]

[0181] The experimental reaction conditions were:

[0182]

[0183] III. Performance verification of the tag sequence amplification reaction system

[0184] After connecting different pathogen sequences to an expression vector containing a tag sequence by methods such as homologous recombination, pseudovirus particles containing RNA tag sequences and pseudovirus particles containing DNA tag sequences can be obtained through cell culture or in vitro preparation, etc., which can be used for the standardization and contamination monitoring of nucleic acid detection of pathogens with RNA as the genome and nucleic acid detection of pathogens with DNA as the genome, respectively.

[0185] In this example, the performance verification of sensitivity (LOD), precision, and specificity of the detection methods for tag sequence RNA and tag sequence DNA was carried out respectively. The results showed that the detection methods for tag sequence RNA and tag sequence DNA both had good sensitivity (LOD was 8.268 copies / mL, 95% CI (6.265, 13.117) and 4.991 copies / mL, 95% CI (3.267, 10.578) respectively) and precision (the within - batch and between - batch coefficient of variation in the laboratory was less than 2%), and there was no cross - reaction with common pathogens.

[0186] 1. Nucleic acid extraction

[0187] Taking blood - borne pathogens as an example in this example, in order to simulate the situation of real samples of blood - borne pathogens, pseudovirus particles containing tag sequence RNA and pseudovirus particles containing tag sequence DNA were diluted with negative plasma, and after nucleic acid extraction, amplification detection was carried out. The nucleic acid extraction kit (manufacturer: Suzhou Newbio Biotechnology Co., Ltd.) was used for extraction: 1.2 mL of the sample was taken in a 2 mL centrifuge tube for pretreatment, 15 μL of proteinase K and 10 μL of polyA were added successively and then shaken well, and the EZbead System - 32 nucleic acid extractor was used for extraction. After treatment with the extraction solution, wash solution A and wash solution B, finally 100 μL of nucleic acid template was eluted.

[0188] 2. Performance verification of the detection method for tag sequence RNA

[0189] (1) Sensitivity (LOD)

[0190] Collect the pseudovirus particles containing tag sequence RNA, use digital PCR quantification to quantify this pseudovirus (stock solution concentration: 1.5×10 5 copies / mL) and use negative plasma for serial dilution, and finally obtain pseudovirus particle samples with concentrations from 1.5 copies / mL to 18.75 copies / mL. The eluate obtained after nucleic acid extraction was used as the final template for detection. The detection was repeated 7 - 8 times a day for 3 consecutive days. The specific detection results are shown in Table 13. The detection results were analyzed by the Probit probability method to determine the specific value of LoD.

[0191] Table 10: Original Results of the Lowest Detectable Limit (LOD) of the Labeled Sequence RNA Detection Method

[0192]

[0193] After calculating the number of detected and total copies at the corresponding concentrations, the data was imported into SPSS for analysis. Finally, the LoD of the labeled sequence RNA was found to be 8.268 copies / mL, with a 95% CI of (6.265, 13.117). The corresponding Probit curve is as shown in Figure 6 shown.

[0194] (2) Precision

[0195] Pseudovirus particles containing labeled sequence RNA that had been quantified using digital PCR (stock concentration: 1.5×10 5 copies / mL) were diluted to 300 copies / mL and 30 copies / mL with negative plasma and used as high- and low-concentration samples for precision verification. All samples were continuously tested for 3 days, with 5 experiments performed each day, and the within-run and between-run precisions within the laboratory were calculated. The results showed that the within-run and between-run precisions for both high and low concentrations were less than 2%.

[0196] Table 11: Precision Results of the Labeled Sequence RNA Detection Method

[0197]

[0198] (3) Specificity

[0199] Using pseudovirus particles containing labeled sequence RNA as samples, after dilution and extraction with negative plasma, amplification was performed synchronously using kits for other common pathogens and the labeled sequence RNA detection system. The results are as shown in Figure 7 shown. The results showed that except for Figure 7 specific amplification of the F labeled sequence, the remaining pathogens, such as hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), dengue virus (DENV), and chikungunya virus (CHIKV), all showed negative results. This indicates that the labeled sequence RNA detection method has high specificity and no cross-reactivity with other common pathogens.

[0200] 3. Performance Verification of the Labeled Sequence DNA Detection Method

[0201] (1) Sensitivity (LOD)

[0202] Pseudovirus particles containing labeled sequence DNA were collected, and digital PCR was used to quantify the pseudovirus (stock concentration: 2×10 8(copies / mL) and serially diluted with negative plasma to finally obtain pseudovirus samples with concentrations ranging from 0.50 copies / mL to 12.50 copies / mL. The eluate obtained after nucleic acid extraction was used as the final template for detection. The detection was repeated 6 - 7 times a day for 3 consecutive days, and the specific detection results are shown in Table 12. The detection results were analyzed using the Probit probability method to determine the specific value of LoD.

[0203] Table 12: Original Results of the Lowest Detection Limit (LoD) of the Label Sequence DNA Detection Method

[0204]

[0205]

[0206] After calculating the number of detected and total copies at the corresponding concentrations, the data was imported into SPSS for analysis. Finally, the LoD of the label sequence DNA was found to be 4.991 copies / mL, with a 95% CI of (3.267, 10.578), and the corresponding Probit curve is as Figure 8 shown.

[0207] (2) Precision

[0208] Pseudovirus particles containing the label sequence DNA that had been quantified using digital PCR (stock concentration: 2×10 8 copies / mL) were diluted to 500 copies / mL and 50 copies / mL with negative plasma and used as high - and low - concentration samples for precision verification, respectively. All samples were continuously detected for 3 days, with 5 experiments conducted each day, and the within - batch and between - batch precisions within the laboratory were calculated. The results showed that the within - batch and between - batch precisions for both high - and low - concentration samples were less than 2%.

[0209] Table 13: Precision Results of the LoD Analysis of the Label Sequence DNA Detection Method

[0210]

[0211] (3) Specificity

[0212] Using pseudovirus particles containing the label sequence DNA as samples, after dilution and extraction with negative plasma, amplification was carried out synchronously using kits for other common pathogens and the label sequence DNA detection system, and the results are as Figure 9 shown. The results showed that except Figure 9Except for the specific amplification of the F tag sequence, the other pathogens, such as hepatitis B virus (HBV), hepatitis D virus (HDV), human T-lymphotropic virus (HTLV), Anaplasma, Babesia, etc., all showed negative results. This indicates that the DNA detection method of this tag sequence has high specificity and no cross-reaction with other common pathogens.

[0213] Example 2

[0214] This example is an application example of a randomly generated oligonucleotide tag sequence and its detection method.

[0215] The introduction of randomly generated oligonucleotide tag sequences into nucleic acid reference materials or quality control products of different pathogens can effectively solve the problem of different detection efficiencies of detection reagents from different manufacturers for different pathogens, standardize series products, make them comparable and traceable, and help optimize the pathogen detection system; at the same time, it can effectively solve the effective identification of false positive results caused by the contamination of negative samples by positive quality control products.

[0216] I. Randomly generated oligonucleotide tag sequences can be used to solve the problem of different detection efficiencies of detection reagents for different pathogens

[0217] The pseudovirus containing tag sequence RNA, dengue virus (DENV), Zika virus (ZIKV), and chikungunya virus (CHIKV) (the four nucleic acid fragments are constructed in one RNA sequence, with a ratio of 1:1:1:1) was diluted with negative plasma and then nucleic acid extraction was performed. The collected eluate was used as the template for final amplification. Three triple detection kits (which can simultaneously detect ZIKV, DENV, and CHIKV) and the tag sequence RNA detection method established in this example were used to detect ZIKV, DENV, CHIKV, and the tag sequence respectively, and the experiment was repeated three times.

[0218] The specific detection results are shown in Table 14 and Figure 10As shown. Theoretically, when the 4 fragments are connected together in a 1:1:1:1 ratio, the concentrations of different fragments in the same sample are exactly the same, and the detected CT values should also be the same. However, it was found that when detecting three different pathogens, Zika virus (ZIKV), Dengue virus (DENV), and Chikungunya virus (CHIKV), using the same kit, the CT values were all different, indicating that the detection efficiency of the kit for these three pathogens is not exactly the same. In this example, the introduction of the tag sequence can help optimize the reagent to have the same detection efficiency when detecting different pathogens (such as the difference between the CT values detected by the tag sequence is basically the same), thus effectively solving this problem. In addition, when using primers and probes in different detection methods for absolute quantification of different pathogens by digital PCR, differences in amplification efficiency will also lead to differences in absolute quantification results, thus making the authenticity and reliability of the quantification results doubtful. After inserting the tag sequence obtained in Example 1 into the target sequence and performing 1:1 ligation, when quantifying pseudoviruses containing nucleic acids of different pathogens, only the primers and probes in the tag sequence detection method can be used for absolute quantification detection, ultimately making the quantification results of different pathogens more accurate and comparable.

[0219] Table 14: Detection Results of Reagents 1, 2, 3 and Tag Sequence

[0220]

[0221] II. Randomly Generated Oligonucleotide Tag Sequences are Used to Solve the Different Detection Efficiencies of the Same Pathogen by Different Detection Reagents

[0222] The pseudovirus containing the tag sequence RNA and Zika virus (ZIKV) sequence (the two nucleic acid fragments are constructed in one RNA sequence, with a ratio of 1:1) was diluted with negative plasma and then nucleic acid extraction was performed. The collected eluate was used as the template for final amplification. A kit capable of detecting ZIKV and the tag sequence RNA detection method established in Example 1 were used to detect ZIKV and the tag sequence respectively.

[0223] The specific detection results are shown in Table 15 and the scatter plot Figure 11 As shown. Theoretically, the detection results of different reagents when detecting the same sample should be similar. However, it was found that when using reagents 1, 2, 3, and 4 to detect equal amounts of ZIKV respectively, there were significant differences in the CT values detected by each reagent. The introduction of the tag sequence in Example 1 can help identify the differences in the detection efficiency of the same pathogen between different reagents, thus helping to better optimize the reagents.

[0224] Table 15: Detection Results of Reagents 1, 2, 3, 4 for ZIKV and Tag Sequence

[0225]

[0226] III. Randomly generated oligonucleotide tag sequences can be used to solve the contamination problem caused by positive controls

[0227] To specifically illustrate the feasibility of the tag sequence and its detection method in Example 1 in the field of anti-contamination quality control products, three different groups of samples were set up: In Group 1, pseudoviruses containing only Zika virus RNA were mixed into negative plasma to simulate a real ZIKV nucleic acid positive sample; in Group 2, pseudoviruses containing tag sequence RNA and Zika virus (ZIKV) RNA were mixed into negative plasma to simulate the situation where a positive control contaminates a negative sample when it is used as a positive control; Group 3 was negative plasma for dilution to simulate a real negative sample.

[0228] Nucleic acid extraction was performed on the three groups of samples simultaneously, and the collected eluate was used as the template for final amplification. At the same time, the tag sequence RNA and ZIKV RNA were detected synchronously. The results showed that the ZIKV detections in both Group 1 and Group 2 were positive results, and the ZIKV detection in Group 3 was a negative result; while the detection of the tag sequence showed that only the detection of the tag sequence in Group 2 was a positive result.

[0229] It can be seen that the tag sequence in Example 1 can be added as a specific contamination monitoring sequence after the pathogen sequence to be detected included in the currently commonly used positive control products to form a new anti-contamination type quality control product. When the test result of the sample to be tested is positive and there is doubt about the result and a retest is required, the sample is tested again using the tag sequence detection method established in Example 1. When the tag sequence result is negative, it indicates that the positive result of the sample to be tested is a true positive; when the tag sequence result is positive, it indicates that the positive control product has been mixed into the sample to be tested, causing contamination, and a new sample needs to be collected for testing.

[0230] Table 16: Detection results of tag sequences and ZIKV in different groups

[0231]

[0232] Although the present invention has been described with reference to exemplary embodiments, it should be understood that the present invention is not limited to the disclosed exemplary embodiments. Various adjustments or changes can be made to the exemplary embodiments of the specification of the present invention without departing from the scope or spirit of the present invention. The scope of the claims should be interpreted as broadly as possible to cover all modifications and equivalent structures and functions.

Claims

1. A method for preparing a labeled oligonucleotide for quality control, characterized in that, It includes the following steps: (1) Generate candidate oligonucleotide sequences, and perform preliminary screening and shifted alignment screening on the generated candidate oligonucleotide sequences to obtain tag sequences; (2) Obtain tag oligonucleotides with the tag sequences, ligate them to a vector as a template, design candidate primers and probes for the tag oligonucleotides, construct an amplification reaction system to further screen the primers and probes, and obtain primers and probes for detection; (3) Confirm quality control tag oligonucleotides according to the performance of the amplification reaction system.

2. The preparation method of the labeled oligonucleotide for quality control according to claim 1, characterized in that, In step (1), the length of the generated candidate oligonucleotide sequences is 50 - 500 bp, and the number is 2 - 500.

3. The preparation method of the labeled oligonucleotide for quality control according to claim 1, characterized in that, The preliminary screening indicators in step (1) include GC content, the presence or absence of restriction enzyme sites, and homology alignment results.

4. The preparation method of the labeled oligonucleotide for quality control according to claim 1, wherein The shifted alignment screening in step (1) includes: Select a sequence of a fixed length starting from the starting base of the candidate oligonucleotide sequences obtained by the preliminary screening, select a sequence of the fixed length again after a stepwise interval length, and repeat this operation until the starting base can no longer move backward, thereby obtaining multiple sequences of the fixed length; Perform secondary screening on the obtained multiple sequences of the fixed length respectively, and the screening indicators include GC content, Tm value, secondary structure score, and BLAT check.

5. The preparation method of the labeled oligonucleotide for quality control according to claim 4, characterized in that, The fixed length is 2% - 50% of the length of the candidate oligonucleotide sequences, and the interval length is 2 - 20 bp.

6. The preparation method of the labeled oligonucleotide for quality control according to claim 1, characterized in that, In step (2), the amplification reaction system includes a background signal reaction system containing a bovine serum albumin matrix and a simulated reaction system containing a negative plasma matrix, and step (2) includes a step of comparing the amplification results of the background signal reaction system and the simulated reaction system.

7. A quality control tag oligonucleotide prepared by the method according to any one of claims 1 - 6.

8. A reagent or kit for detection, characterized in that, It contains a template, primers and probes, and optionally reaction solution and mixed enzyme solution, wherein the template contains the quality control tag oligonucleotide according to claim 7.

9. Use of the quality control tag oligonucleotide according to claim 7 as a pathogen nucleic acid reference material or quality control product.

10. The application according to claim 9, wherein The use includes one of the following: For standardizing different products to make them comparable and traceable; For comparing the detection efficiencies of the same detection reagent for different pathogens; For comparing the detection efficiencies of different detection reagents for the same pathogen; or For solving the pollution problem caused by positive quality control.

Images