Haploid molecular marker Chr19156236840 related to oil content of peanuts and application of haplotype molecular marker Chr19156236840

Abstract

The invention discloses a haplotype molecular marker Chr19156236840 related to the oil content of peanuts and application of the haplotype molecular marker Chr19156236840, and belongs to the field of molecular marker assisted breeding. The nucleotide sequence of the haplotype molecular marker Chr19156236840 is as shown in SEQ ID NO.1, G / T polymorphism exists at the position of a basic group at the 99th site of the sequence of the haplotype molecular marker Chr19156236840-G, and the haplotype molecular marker Chr19156236840-T comprises two haplotypes, namely Chr19156236840-G and Chr19156236840-T. The oil content of the seeds of the homozygous strain containing the Chr19156236840-G haplotype is obviously higher than that of the seeds of the homozygous strain containing the Chr19156236840-T haplotype. When the haplotype molecular marker is used for detecting peanut germplasm seedling materials, the oil content of the seeds can be accurately and efficiently predicted without waiting for peanut results, and the selection efficiency of peanut breeding is greatly improved.

Description

Technical Field

[0001] The present invention relates to the field of molecular marker-assisted breeding, and particularly to a haplotype molecular marker Chr19_156236840 related to peanut oil content and its application. Background Art

[0002] Peanut (Arachis hypogaea L.) is an important oil crop, and its oil content is a key target trait for genetic improvement.

[0003] Molecular marker-assisted selection technology provides a new approach for high-oil peanut breeding. Early genotype identification can be achieved through DNA analysis of seedling leaves, but no haplotype combination significantly associated with oil content has been established in the existing technology. Currently, commercially available gene chips lack specific marker loci for peanut oil content traits, making it difficult to meet the needs of precision breeding.

[0004] The existing genetic improvement of peanut oil content mainly faces the following technical bottlenecks: (1) lack of molecular markers tightly linked to high oil content traits; (2) failure to construct a high-density haplotype map covering the entire genome; (3) inability of existing detection methods to achieve rapid and accurate prediction of oil content at the seedling stage. These problems severely restrict the breeding efficiency of high-oil peanut varieties.

[0005] Therefore, developing a new molecular marker system and establishing an efficient and accurate early prediction method for oil content are of great significance for accelerating the breeding process of high-oil peanuts. Summary of the Invention

[0006] The purpose of the present invention is to provide a haplotype molecular marker Chr19_156236840 related to peanut oil content and its application to solve the problems existing in the above-mentioned prior art. By using the haplotype molecular marker provided by the present invention to detect peanut germplasm seedling materials, the high or low oil content of its seeds can be accurately and efficiently predicted without waiting for peanuts to bear fruit after planting, greatly improving the selection efficiency of peanut breeding.

[0007] To achieve the above purpose, the present invention provides the following solutions:

[0008] The present invention provides a haplotype molecular marker Chr19_156236840 related to peanut oil content. The nucleotide sequence of the haplotype molecular marker Chr19_156236840 is shown in SEQ ID NO.1, and there is a G / T polymorphism at the 99th base of the sequence, including two haplotypes: Chr19_156236840-G and Chr19_156236840-T.

[0009] The present invention also provides the use of a reagent for detecting the haplotype molecular marker Chr19_156236840 in identifying the oil content of peanut seeds, whether it is high or low.

[0010] Optionally, if the peanut to be tested is a homozygous line containing the Chr19_156236840-G haplotype, then the peanut to be tested is a peanut with a high oil content;

[0011] If the peanut to be tested is a homozygous line containing the Chr19_156236840-T haplotype, then the peanut to be tested is a peanut with a low oil content.

[0012] The present invention also provides the use of a reagent for detecting the haplotype molecular marker Chr19_156236840 in the early prediction of the oil content of peanut seeds, whether it is high or low.

[0013] Optionally, the leaves of the early-stage plants of the peanut to be tested are detected. If the leaves are detected to be a homozygous line containing the Chr19_156236840-G haplotype, then it is predicted that the peanut to be tested is a peanut with a high oil content;

[0014] If the leaves are detected to be a homozygous line containing the Chr19_156236840-T haplotype, then it is predicted that the peanut to be tested is a peanut with a low oil content.

[0015] The present invention also provides the use of a reagent for detecting the haplotype molecular marker Chr19_156236840 in molecular marker-assisted breeding of high-oil-content peanuts.

[0016] Optionally, the leaves of the early-stage plants of the peanut to be tested are detected. If the leaves are detected to be a homozygous line containing the Chr19_156236840-G haplotype, then it is predicted that the peanut to be tested is a peanut with a high oil content;

[0017] If the leaves are detected to be a homozygous line containing the Chr19_156236840-T haplotype, then it is predicted that the peanut to be tested is a peanut with a low oil content;

[0018] Select homozygous lines containing the Chr19_156236840-G haplotype for cultivation.

[0019] Optionally, the reagent includes primers for amplifying the haplotype molecular marker Chr19_156236840.

[0020] Optionally, the primers include KASP primers, and the KASP primers are composed of an upstream primer F1 as shown in SEQ ID NO.2, an upstream primer F2 as shown in SEQ ID NO.3, and a common downstream primer as shown in SEQ ID NO.4.

[0021] The present invention discloses the following technical effects:

[0022] The present invention has developed and obtained for the first time a haplotype molecular marker Chr19_156236840 related to peanut oil content. By using this haplotype molecular marker to detect peanut germplasm seedling materials, the high or low oil content of its seeds can be accurately and efficiently predicted without waiting for peanuts to bear fruit after planting, greatly improving the selection efficiency of peanut breeding.

[0023] The SNP locus of the present invention has a clear position, is not affected by the environment, has stronger purposefulness, less actual detection workload, higher efficiency, and lower cost, and is of great significance for accelerating the breeding process of high-oil peanuts. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0025] Figure 1 is the phenotype of 184 peanut germplasms;

[0026] Figure 2 is the distribution of significant SNP loci identified by GWAS on 20 chromosomes;

[0027] Figure 3 is a schematic Venn diagram, where A is the co-localization of significant loci of linoleic acid, oil content, oleic acid and palmitic acid, and B is the co-localization of significant loci of amino acids, leucine, methionine, threonine and protein;

[0028] Figure 4 is the GWAS mapping of peanut seed oil content (A) and the LD-block analysis diagram linked to the screened loci;

[0029] Figure 5 is the gene structure diagram of AhZT2LDC;

[0030] Figure 6 is the difference in oil content (A), amino acid difference (C) and protein content difference of different haplotypes of Chr19_156236840. "***" indicates a significant difference between the two haplotypes (P<0.001). DETAILED DESCRIPTION OF THE INVENTION

[0031] A detailed description of various exemplary embodiments of the present invention will now be given. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0032] It should be understood that the terms described in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0033] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0034] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are merely exemplary.

[0035] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0036] Example 1: Mapping of major QTL and identification of haplotypes

[0037] 1. Biological materials and phenotypic analysis

[0038] 184 peanut germplasms from home and abroad, among which 119 varieties represent varieties from 13 provinces and regions such as Shandong, Henan, Guangdong, and Fujian; 47 are preserved by the Germplasm Resources Institute of Shandong Academy of Agricultural Sciences, and 18 are foreign varieties, that is, varieties introduced from abroad such as the United States and India.

[0039] Using the 184 peanut germplasms collected from home and abroad as a natural population ( Figure 1) The information of 19 traits including fatty acid content of this natural population in 2018 and 2022 was obtained by a near-infrared detector (including oil content, protein content, 6 fatty acids and 11 amino acids). Among them, 13 traits showed normal or nearly normal distributions (arachidic acid, behenic acid, stearic acid, protein, amino acids, proline, histidine, valine, isoleucine, threonine, arginine, lysine and phenylalanine); 6 traits showed skewed distributions (oil content, oleic acid, linoleic acid, palmitic acid, histidine, methionine) (Table 1). The genotypes of this population were detected using the Affymetrix 'Axiom_Arachis2' 48K SNP array chip.

[0040] Table 1 Variation of fatty acids and amino acids in 184 peanut varieties

[0041]

[0042] 2. SNP screening

[0043] Using genotype and phenotype information, 91 SNPs significantly associated with 19 phenotypes were identified by GWAS. Among them, 39 SNPs were related to at least two traits. These significant SNPs were distributed on 20 chromosomes, as shown in Table 2.

[0044] Table 2 SNPs significantly associated with 19 traits such as fatty acids and amino acids located by GWAS

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052] Figure 2 Further shows the distribution number of significant SNP loci identified by GWAS on 20 chromosomes. From Figure 2 and Table 2, it can be seen that chromosomes 13, 19 and 9 contain the most significant SNPs, with 41, 29 and 24 respectively. In contrast, chromosome 15 has only one significant SNP.

[0053] Seventeen SNPs were co-localized with oleic acid, linoleic acid and palmitic acid traits, and the phenotypic variation explained (MarkerR2) ranged from 6.1% to 14.2%, and the -log(p) values ranged from 3.02 to 5.30 (Table 2, Figure 3 A). Eight SNPs were co-localized with protein and amino acid traits, and the effect values ranged from 6.2% to 14.3%, and the -log(p) values ranged from 3.00 to 5.28 (Table 2, Figure 3 B). Thirteen SNPs were related to both fatty acid and amino acid traits, and the effect values ranged from 6.1% to 18.5%, and the -log(p) values ranged from 3.01 to 5.17. In addition, the effect values of the significant SNPs co-localized with oil content and palmitic acid were between 8% and 9.4%, and the -log(p) values ranged from 3.10 to 3.51 (Table 2, Figure 3 ).

[0054] Figure 4 Figure 5 shows the GWAS mapping of peanut seed oil content. Figure 5 A in Figure 5 shows that three SNPs on chromosomes chr01 and chr19 are related to peanut seed oil content, but the markers AX-176816934 and AX-176793317 are located in the intergenic region, while the marker AX-177638375 is located 41 bp downstream of the AhZT2LDC gene ( Figure 5 ). The AhZT2LDC gene encodes a SEC61 transporter protein, which is closely related to lipid metabolism. The AX-177638375 marker may control peanut seed oil content by regulating the expression of the AhZT2LDC gene. There is a G / T mutation at this SNP locus, and the genotypes include CC, CT and TT. The gene fragment sequence containing this SNP variation site is shown in SEQ ID NO.1 and is denoted as the haplotype molecular marker Chr19_156236840.

[0055] SEQ ID NO.1:

[0056] CTTAGTTCTGCTATGTTTCGTCTATTTTGTTTTGTTTTTTTTTTTCCTTCAGTCATCTCTGGGAGCATTACAGTGAGATTTAGAATGTAAAATTTTTA K ACCTCGACACATTGCTTTGATTTAGGATTAAGGACGCAAAAAATTGAGGAATTGCAGTTTTGCTTTTAGACTTTGTTAACCTTGAATTTGGGGAAGGGGTCTG。

[0057] The 99th base of the sequence shown in SEQ ID NO.1 is a SNP site, and there is G / T polymorphism at this site.

[0058] 3. Haplotype effect

[0059] To confirm the phenotypic effect of significant SNP sites, haplotype analysis was performed using a natural population composed of 184 domestic and foreign peanut germplasms.

[0060] As Figure 6 shown, there are two haplotypes at this site: Chr19_156236840-G and Chr19_156236840-T. The average oil content of seeds in the homozygous lines containing the Chr19_156236840-G haplotype is 52.8%, and the average oil content of seeds in the homozygous lines containing the Chr19_156236840-T haplotype is 50.5%. In addition, the average amino acid / protein content of seeds in the homozygous lines containing the Chr19_156236840-G haplotype is 20.9% / 25.1%, and the average amino acid / protein content of seeds in the homozygous lines containing the Chr19_156236840-T haplotype is 23.9% / 27.7%. The homozygous lines containing the Chr19_156236840-G haplotype can increase the seed oil content by 2.3%, and the homozygous lines containing the Chr19_156236840-T haplotype can increase the seed amino acid / protein content by 3% / 2.6%.

[0061] Example 2 Molecular marker-assisted breeding

[0062] 1. Primer design for amplifying molecular markers

[0063] Design KASP primers for amplifying the sequence fragment shown in SEQ ID NO.1. The specific primer information is as follows:

[0064] Forward primer F1: GAAGGTGACCAAGTTCATGCT GATTTAGAATGTAAAATTTTTAC, SEQ IDNO.2;

[0065] Forward primer F2: GAAGGTCGGAGTCAACGGAT GATTTAGAATGTAAAATTTTTAT, SEQ IDNO.3;

[0066] Universal reverse primer R: CAGACCCCTTCCCCAAATTCA, SEQ ID NO.4.

[0067] 2. Application of molecular markers

[0068] To verify the practicability of this molecular marker, 166 peanut germplasms were reselected (including 52 from Shandong, 18 from Zhejiang, 18 from Hebei, 17 from Sichuan, 15 from Jilin, 39 from other domestic varieties, and 7 from foreign varieties). The genomic DNA of peanut leaves was extracted, and the peanut germplasms were amplified with the designed amplification primers to determine their genotypes. The amplification system: 1 μL of DNA, 5 μL of 2×KASPMaser MIX, 0.1 μL of upstream primer F1, 0.1 μL of downstream primer F2, 0.3 μL of downstream universal primer R, and 3.5 μL of ddH2O. The amplification program: 94°C for 15 min; [94°C for 30 s, 61 - 55°C for 60 s (-0.6 per cycle), 20 cycles]; [94°C for 30 s, 55°C for 60 s, 26 cycles].

[0069] Meanwhile, the oil content of peanut germplasm seeds was measured, and the results are shown in Table 3.

[0070] Table 3 Different genotypes of 166 peanut germplasms at the SNP locus and seed oil content

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077] The data in Table 3 show that the oil content of seeds identified as GG genotype at the SNP locus in 166 peanuts (with an average of 55.78% in 2023 and 53.93% in 2024) was significantly higher than that of TT genotype (with an average of 53.48% in 2023 and 51.49% in 2024). This is consistent with the results of Example 1, proving that the haplotype molecular marker Chr19_156236840 has a relatively high accuracy in identifying the oil content of peanut seeds.

[0078] The above-described embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should fall within the protection scope determined by the claims of the present invention.

Claims

1. A haplotype molecular marker Chr19_156236840 related to peanut oil content, characterized in that, The nucleotide sequence of the haplotype molecular marker Chr19_156236840 is shown in SEQ ID NO.1, and there is a G / T polymorphism at the 99th base of the sequence, including two haplotypes: Chr19_156236840-G and Chr19_156236840-T.

2. Use of a reagent for detecting the haplotype molecular marker Chr19_156236840 recited in claim 1 in identifying the oil content of peanut seeds.

3. The application according to claim 2, wherein If it is detected that the peanut to be tested is a homozygous line containing the Chr19_156236840-G haplotype, then the peanut to be tested is a peanut with a high oil content; If it is detected that the peanut to be tested is a homozygous line containing the Chr19_156236840-T haplotype, then the peanut to be tested is a peanut with a low oil content.

4. Use of a reagent for detecting the haplotype molecular marker Chr19_156236840 recited in claim 1 in early predicting the oil content of peanut seeds.

5. The application according to claim 4, characterized in that Detect the leaves of the early-stage plant of the peanut to be tested. If it is detected that the leaves are a homozygous line containing the Chr19_156236840-G haplotype, then predict that the peanut to be tested is a peanut with a high oil content; If it is detected that the leaves are a homozygous line containing the Chr19_156236840-T haplotype, then predict that the peanut to be tested is a peanut with a low oil content.

6. Use of a reagent for detecting the haplotype molecular marker Chr19_156236840 recited in claim 1 in molecular marker-assisted breeding of high-oil-content peanuts.

7. The application according to claim 6, wherein Detect the leaves of the early-stage plant of the peanut to be tested. If it is detected that the leaves are a homozygous line containing the Chr19_156236840-G haplotype, then predict that the peanut to be tested is a peanut with a high oil content; If it is detected that the leaves are a homozygous line containing the Chr19_156236840-T haplotype, then predict that the peanut to be tested is a peanut with a low oil content; Select a homozygous line containing the Chr19_156236840-G haplotype for cultivation.

8. The application according to claim 2, claim 4 or claim 6, characterized in that, The reagent includes primers for amplifying the haplotype molecular marker Chr19_156236840.

9. The application according to claim 8, wherein The primers include KASP primers, and the KASP primers are composed of an upstream primer F1 shown in SEQ ID NO.2, an upstream primer F2 shown in SEQ ID NO.3, and a common downstream primer shown in SEQ ID NO.4.

Images