A KASP marker combination for identifying rare and exotic varieties of Cymbidium goeringii with multiple perianth segments, its application, primers, and kit.

Abstract

This invention relates to the field of molecular breeding, and in particular to a KASP marker combination for identifying Cymbidium goeringii varieties with multiple perianth segments and unique flowers, its application, primers, and kits. The KASP markers include one or more of KASP1, KASP2, and KASP3. The three KASP markers designed and developed in this invention can be used for the selection and breeding of Cymbidium goeringii germplasm and hybrid offspring with multiple perianth segments. They can accurately distinguish between Cymbidium goeringii varieties with more than six perianth segments and normal Cymbidium goeringii varieties. This molecular marker combination can play a role in large-scale early screening of germplasm, providing effective assistance for molecular breeding of Cymbidium goeringii flower types.

Description

Technical Field

[0001] This invention relates to the field of molecular breeding, and in particular to a KASP marker combination for identifying multi-petaled and unique-flowered varieties of Cymbidium goeringii, its application, primers, and kits. Background Technology

[0002] Cymbidium sinense, a typical representative of Chinese orchids, is highly favored by consumers in China and the East Asian cultural sphere due to its flowering period coinciding closely with the Chinese Lunar New Year, earning it the elegant name "New Year's Orchid." Morphological appreciation is a core element of the Cymbidium sinense evaluation system, with the morphological differentiation characteristics of its floral organs not only being a key indicator for variety identification but also directly affecting its market value. A typical Cymbidium sinense flower consists of six tepals: three sepals, two petals, and one specialized lip. Based on the morphological variations of each whorl of tepals, its flower shape can be subdivided into major categories such as lotus petal, plum petal, butterfly petal, narcissus petal, and bamboo leaf petal. It is worth noting that some germplasm exhibits a phenotype of multiple whorls of tepals (more than six tepals), known as "unusual flowers," which have higher commercial value due to their unique shape.

[0003] The multiple petal morphology of Cymbidium goeringii is a typical quantitative trait, regulated by multiple genes. However, due to the lack of phenotypic markers for this trait during the vegetative growth stage and the 3-5 year reproductive maturity cycle before flowering, traditional breeding faces bottlenecks such as lengthy cycles, high costs, and difficulties in early screening. Existing molecular marker systems (such as SSR markers) are mostly used for germplasm identification and genetic pedigree analysis, while the development of functional markers, especially molecular markers related to Cymbidium goeringii petal morphology, remains largely unexplored. This severely restricts the efficiency of molecular breeding technology applications. Summary of the Invention

[0004] To address the aforementioned problems, this invention provides a KASP marker combination for identifying multi-petaled and uniquely shaped varieties of Cymbidium goeringii, along with its application, primers, and a kit. The KASP markers provided by this invention can be used to identify multi-petaled and uniquely shaped varieties of Cymbidium goeringii.

[0005] To achieve the above objectives, the present invention provides the following technical solution:

[0006] This invention provides a KASP marker for identifying Cymbidium goeringii varieties with multiple perianth segments and unique flowers, including one or more of KASP1, KASP2 and KASP3;

[0007] The KASP1 gene is located at the 229th base of the coding region of the CsLCR gene on chromosome 5 of Cymbidium goeringii. It has a C / G mutation and the genotype C:C is a variety of Cymbidium goeringii with multiple perianth segments and unusual flowers.

[0008] The KASP2 gene is located at the 687th base of the coding region of the CsLCR gene on chromosome 5 of Cymbidium goeringii. It has a T / G mutation and the genotype G:G is a variety of Cymbidium goeringii with multiple perianth segments and unusual flowers.

[0009] The KASP3 gene is located at bases 1429 and 1430 of the coding region of the CsLCR gene on chromosome 5 of Cymbidium goeringii. There is a T / G mutation at base 1429 and a T / C mutation at base 1430. The genotype GC:GC is a Cymbidium goeringii variety with multiple perianth segments and unusual flowers.

[0010] The nucleotide sequence of the CsLCR gene is shown in SEQ ID No. 10.

[0011] This invention also provides the application of the KASP marker described in the above technical solution in identifying Cymbidium goeringii varieties with multiple perianth segments and unique flowers.

[0012] This invention also provides a KASP primer for identifying rare varieties of Cymbidium goeringii with multiple perianth segments, including one or more of KASP1 primer, KASP2 primer and KASP3 primer;

[0013] The nucleotide sequences of the upstream primers F1 and F2 of the KASP1 primer are shown in SEQ ID No. 1-2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 3.

[0014] The nucleotide sequences of the upstream primers F1 and F2 of the KASP2 primer are shown in SEQ ID No. 4-5, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 6.

[0015] The nucleotide sequences of the upstream primers F1 and F2 of the KASP3 primer are shown in SEQ ID No. 7-8, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 9.

[0016] This invention also provides the application of the KASP primers described in the above technical solution in identifying rare flower varieties of Cymbidium goeringii with multiple perianth segments.

[0017] Preferably, the application includes the following steps:

[0018] 1) Extract genomic DNA from Cymbidium goeringii, and use the genomic DNA as a template to perform real-time quantitative PCR amplification using the KASP primers described in the above technical solution to obtain the amplification product;

[0019] 2) Read the fluorescence data of the amplification product obtained in step 1), convert it into typing results, and identify the unique flower varieties of Cymbidium goeringii based on the typing results.

[0020] Preferably, the real-time quantitative PCR amplification system consists of: 1.25 μL genomic DNA (concentration 30 ng / μL), 2.5 μL 2×KASP Mastermix, and 1.25 μL PrimerMix;

[0021] In the Primer Mix described above, the volume ratio of upstream primer F1, upstream primer F2, and downstream primer in the KASP primers is 1:1:3, and the concentration is 10 μM.

[0022] Preferably, the real-time quantitative PCR amplification program is as follows: 95℃ for 10 min; 95℃ for 20 s, 58℃ for 60 s, 10 cycles; 95℃ for 20 s, 55℃ for 60 s, 27 cycles; 25℃ for 30 s.

[0023] This invention also provides a kit for identifying rare varieties of Cymbidium goeringii with multiple perianth segments, comprising the KASP primers and 2×KASP Mastermix described in the above technical solution.

[0024] The beneficial effects of this invention are:

[0025] This invention observes the number of perianth segments in flowers of different germplasm resources within natural populations of Cymbidium goeringii and performs genome-wide association analysis. This makes the SNP loci for perianth segment number obtained from the association analysis more reliable, and the discovery of candidate genes for perianth segment number and the development of genetic markers more precise. The three KASP markers designed and developed in this invention can be used for the breeding of Cymbidium goeringii germplasm with multiple perianth segments and hybrid offspring. They can accurately genotype Cymbidium goeringii varieties with more than 6 perianth segments compared to normal varieties. This combination of molecular markers can play a role in large-scale early germplasm screening, providing effective assistance for molecular breeding of Cymbidium goeringii flower types. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0027] Figure 1 Comparison photos of a normal-flowered Cymbidium goeringii (A) and a variety with unusual flowers and multiple perianth segments (B and C);

[0028] Figure 2 Manhattan results (A) and QQ results (B) of GWAS analysis for the number of petals of Cymbidium goeringii;

[0029] Figure 3 Genotyping results of 75 Cymbidium cultivars using three KASP markers. Detailed Implementation

[0030] This invention provides a KASP marker for identifying Cymbidium goeringii varieties with multiple perianth segments and unique flowers, including one or more of KASP1, KASP2 and KASP3;

[0031] The KASP1 gene is located at the 229th base of the coding region of the CsLCR gene on chromosome 5 of Cymbidium goeringii. It has a C / G mutation and the genotype C:C is a variety of Cymbidium goeringii with multiple perianth segments and unusual flowers.

[0032] The KASP2 gene is located at the 687th base of the coding region of the CsLCR gene on chromosome 5 of Cymbidium goeringii. It has a T / G mutation and the genotype G:G is a variety of Cymbidium goeringii with multiple perianth segments and unusual flowers.

[0033] The KASP3 gene is located at bases 1429 and 1430 of the coding region of the CsLCR gene on chromosome 5 of Cymbidium goeringii. There is a T / G mutation at base 1429 and a T / C mutation at base 1430. The genotype GC:GC is a Cymbidium goeringii variety with multiple perianth segments and unusual flowers.

[0034] The nucleotide sequence of the CsLCR gene is shown in SEQ ID No. 10.

[0035] SEQ ID No. 10:

[0036]

[0037] This invention also provides the application of the KASP marker described in the above technical solution in identifying Cymbidium goeringii varieties with multiple perianth segments and unique flowers.

[0038] This invention also provides a KASP primer for identifying the unique flower varieties of Cymbidium goeringii with multiple perianth segments, including one or more of KASP1, KASP2, and KASP3 primers; the nucleotide sequences of the upstream primers F1 and F2 of the KASP1 primer are shown in SEQ ID No. 1-2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 3; the nucleotide sequences of the upstream primers F1 and F2 of the KASP2 primer are shown in SEQ ID No. 4-5, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 6; the nucleotide sequences of the upstream primers F1 and F2 of the KASP3 primer are shown in SEQ ID No. 7-8, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 9.

[0039] SEQ ID No. 1:

[0040] GAAGGTCGGAGTCAACGGATTGACGAGACCCTGGCGACC;

[0041] SEQ ID No. 2:

[0042] GAAGGTGACCAAGTTCATGCTGACGAGACCCTGGCGACG;

[0043] SEQ ID No. 3:

[0044] TTGTATATGCGCCGTGCCG;

[0045] SEQ ID No.4:

[0046] GAAGGTGACCAAGTTCATGCTCGTTTCATTCTGCCGGAATTT;

[0047] SEQ ID No. 5:

[0048] GAAGGTCGGAGTCAACGGATTCGTTTCATTCTGCCGGAATTG;

[0049] SEQ ID No. 6:

[0050] GGCGACAGATTGGGACAGAGTTA;

[0051] SEQ ID No. 7:

[0052] GAAGGTCGGAGTCAACGGATTGCTCCTTCGCTACCACCTTTT;

[0053] SEQ ID No. 8:

[0054] GAAGGTGACCAAGTTCATGCTCTCCTTCGCTACCACCTTGC;

[0055] SEQ ID No. 9:

[0056] GAGGGTAAGCGACATCTTCTGC.

[0057] This invention also provides the application of the KASP primers described in the above technical solution in identifying rare flower varieties of Cymbidium goeringii with multiple perianth segments.

[0058] In this invention, the application preferably includes the following steps:

[0059] 1) Extract genomic DNA from Cymbidium goeringii, and use the genomic DNA as a template to perform real-time quantitative PCR amplification using the KASP primers described in the above technical solution to obtain the amplification product;

[0060] 2) Read the fluorescence data of the amplification product obtained in step 1), convert it into typing results, and identify the unique flower varieties of Cymbidium goeringii based on the typing results.

[0061] In this invention, the preferred system for real-time quantitative PCR amplification is: 1.25 μL genomic DNA (concentration 30 ng / μL), 2.5 μL 2×KASP Master mix, and 1.25 μL Primer Mix. In this invention, the volume ratio of upstream primer F1, upstream primer F2, and downstream primer in the KASP primers of the aforementioned technical solution in the Primer Mix is ​​1:1:3, and the concentration is 10 μM. In this invention, the preferred program for real-time quantitative PCR amplification is: 95℃ for 10 min; 95℃ for 20 s, 58℃ for 60 s, 10 cycles; 95℃ for 20 s, 55℃ for 60 s, 27 cycles; 25℃ for 30 s.

[0062] This invention also provides a kit for identifying rare varieties of Cymbidium goeringii with multiple perianth segments, comprising the KASP primers described in technical solution 3 above and 2×KASP Mastermix.

[0063] To further illustrate the present invention, the following detailed description is provided in conjunction with embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0064] Example 1

[0065] (1) Using 195 Cymbidium goering samples as the research objects, they were cultivated in pots in a Cymbidium greenhouse with conventional water and fertilizer management. Phenotypic monitoring was carried out during two consecutive reproductive cycles, and the number of perianth segments of the floral organs was systematically recorded during the full bloom period. The sampling strategy was set to select 2-3 biological replicates for each germplasm, and collect 3 fully bloomed flowers from each plant for morphometric measurement. The average value was finally taken as the observed value of the number of perianth segments for each Cymbidium goering sample.

[0066] (2) Young leaf samples were collected from the test materials, and whole-genome DNA was extracted using a nucleic acid extraction kit (TIANGEN). Dual quality assessment was performed using 1.2% agarose gel electrophoresis combined with NanoDrop spectrophotometry. Samples meeting the quality standards were then subjected to simplified genome sequencing. An average genome coverage depth of 10.01× was obtained, generating a total of 1241.67 Mb reads, with a sequencing quality Q30 value of 93.13%. The original sequences were aligned to the Molan reference genome, and parallel analysis using GATK and samtools was performed. High-confidence variant datasets were constructed from SNP sites identified by both algorithms, ultimately yielding 65,318,522 population-level SNP markers.

[0067] (3) Combining the observed number of perianth segments and the developed Cymbidium goeringii SNP markers, genome-wide association analysis (GWAS) was performed using EMMAX to obtain the EMMAX mixed linear model results. Figure 2 The images show the Manhattan and QQ results for the EMMAX model. A total of 2146 SNPs significantly associated with the number of perianth segments were identified, of which 1278 were located in the UTR region of the gene and 50 were located in the exon or intron region, indicating that these regions may be involved in the genetic variation regulating the number of perianth segments.

[0068] Example 2

[0069] A KASP marker for identifying the association between multiple perianth segments and unusual flower trait in Cymbidium goeringii. The KASP marker is developed based on significantly associated SNP sites obtained in Example 1, using four SNP sites located in the coding region of the CsLCR gene on chromosome 5 of Cymbidium goeringii. The coding sequence of the CsLCR gene is as follows (SEQ ID No. 10):

[0070]

[0071] SNP1 (C / G) is located at nucleotide 229 of the coding region of the CsLCR gene, SNP2 (T / G) is located at nucleotide 687 of the coding region of the CsLCR gene, and SNP3 (T / G) and SNP4 (T / C) are two adjacent SNPs located at nucleotides 1429 and 1430 of the coding region of the CsLCR gene, respectively. Since SNP3 and SNP4 are adjacent, they are treated as a single SNP for labeling. Three primers were designed for each of the four SNP sites: upstream primer F1, upstream primer F2, and downstream primer R. Primers F1 and F2 include FAM and VIC fluorescent linker sequences, respectively. The primer sequences are shown in Table 1.

[0072] Table 1. Specific primers for KASP markers

[0073]

[0074] Example 3

[0075] A kit for SNP1(C / G) KASP labeling, the kit comprising upstream primer F1, upstream primer F2 and downstream primer R, which are the sequences shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3, respectively.

[0076] Example 4

[0077] A kit for SNP2(T / G) KASP labeling, the kit comprising upstream primer F1, upstream primer F2 and downstream primer R, which are the sequences shown in SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6, respectively.

[0078] Example 5

[0079] A kit for SNP3 / 4(TT / GC) KASP labeling, the kit comprising upstream primer F1, upstream primer F2 and downstream primer R, which are the sequences shown in SEQ ID No. 7, SEQ ID No. 8 and SEQ ID No. 9, respectively.

[0080] Example 6

[0081] A kit for KASP labeling of SNP1(C / G), SNP2(T / G) and SNP3 / 4(TT / GC), the kit comprising upstream primer F1, upstream primer F2 and downstream primer R for SNP1(C / G), SNP2(T / G) and SNP3 / 4(TT / GC) KASP, which are sequences shown in SEQ ID No. 1 to SEQ ID No. 9, respectively.

[0082] Example 7

[0083] A method for screening Cymbidium goeringii varieties or germplasm with multiple flower tepals and unusual flowers, the steps of which are as follows:

[0084] (1) Seventy-five cultivated Cymbidium goeringii varieties were randomly selected, including 14 varieties with multiple perianth segments (numbers 1-14 in Table 1) and 61 varieties with normal flowers (numbers 15-75 in Table 1), which were used as experimental materials to verify the effectiveness of the KASP marker.

[0085] Table 2. 75 Cymbidium varieties used for KASP marker testing

[0086] Serial Number Variety name Serial Number Variety name Serial Number Variety name 1 Millennium Goddess 26 Guihua 51 Gold Inlaid Jade 2 Wenshan Strange Butterfly 27 Yaolin Rouge 52 Beihai plain flower thread art 3 Green Cloud 28 Hooked Green 53 Golden Suhe 4 Bird's Nest King 29 Black Bao Gong 54 Purple 5 China's Marvelous Butterfly 30 Colorful Plum Blossom Butterfly 55 Proud Plum 6 Red Roses 31 Joyful Butterfly Thread Art 56 White Jade Brocade 7 Tianfuqi 32 Overjoyed 57 Blue Waves 8 Jade Lion 33 Rouge Butterfly 58 Hongtashan 9 Cuixiang 34 Tang Sancai 59 Purple Qi Comes from the East 10 Xiju 35 Green Claws White Ink 60 Thread Art Red Lotus 11 Baoshan Claw 36 Big Tiger Stripe 61 Golden Princess Thread Art 12 Zhuhai Fisher Girl 37 Top Scholar Butterfly 62 Red Lips Plum 13 Datun Qilin 38 Qiao Butterfly 63 Xiqiao Suhe 14 Treasure Island Wonders 39 Jin Su 64 Red Chrysanthemum 15 Amber Flower 40 Willow Leaf White Ink 65 Fuqianzhong 16 Imperial Concubine 41 Golden Jade 66 Round lotus 17 Chinese Red 42 Enterprise Black 67 Southern Peony 18 Heavenly General 43 Dwarf Bauhinia 68 High Mountain Red Wine 19 Long March 44 Red Chan 69 Purple Lotus 20 Soaring Crane 45 Zhongban Baimo 70 Hidden Dragon 21 Green 46 Xiashan Jinzui 71 Lotus emerging from water 22 Looking at the Moon from the Jade Terrace 47 Golden Sun Wheel Art 72 Xiao Xiang 23 Far East Star 48 Chaozhou Suhe 73 Dawn 24 Rainbow Clouds 49 Black Brother 74 Emerald Butterfly 25 King Lotus Butterfly 50 Purple Lotus Fairy 75 Guangzhou Peony

[0087] (2) Genomic DNA was extracted from the 75 Cymbidium orchid samples using a DNA extraction kit (TIANGEN), dissolved in ddH2O, and then the quality and concentration of the DNA were detected by 1.2% agarose gel electrophoresis and NanoDrop spectrophotometer, respectively. After the DNA passed the quality inspection, the concentration was uniformly diluted to 30 ng / μL.

[0088] (3) KASP markers were developed for the SNP sites SNP1 (C / G), SNP2 (T / G), and SNP3 / 4 (TT / GC) associated with the unusual flower trait of Cymbidium goeringii. The primer sequences for the markers are shown in Table 1. Using the Cymbidium goeringii genomic DNA extracted in step (2) as a template, PCR amplification was performed using the corresponding primers F1, F2, and R. The reaction was carried out in QuantStudio. TM The PCR was performed using a 7Flex real-time quantitative PCR system to obtain the PCR amplification products. The amplification system consisted of: 1.25 μL of Cymbidium goeringii sample DNA template (concentration 30 ng / μL), 2.5 μL of 2×KASP Master mix, and 1.25 μL of Primer Mix (F1:F2:R = 1:1:3, volume ratio) (primer concentration 10 μM), added to a 96-well PCR plate. Each of the 75 Cymbidium goeringii samples was placed in one well, with two additional wells containing ddH2O instead of the DNA template as a water control. The PCR reaction conditions are shown in Table 3.

[0089] Table 3 PCR reaction conditions

[0090]

[0091] (4) PCR amplification of 75 Cymbidium goeringii samples was performed using the KASP molecular marker primer pairs described in Table 1 on a real-time quantitative PCR instrument. After the reaction, the samples were processed using QuantStudio. TM The 7Flex real-time quantitative PCR system reads the fluorescence data of the reaction products and converts them into genotyping results, thereby performing genotyping on the samples.

[0092] (5) The molecular marker KASP1 can clearly separate the C and G genotypes. Genotyping was successfully performed on all 75 varieties. Figure 3 As shown in Table A, the black dots near the Y-axis represent Cymbidium goeringii varieties with homozygous C:C SNP sites, the dark gray dots near the X-axis represent Cymbidium goeringii varieties with homozygous G:G SNP sites, and the light gray dots in the middle represent Cymbidium goeringii varieties with heterozygous C:G SNP sites. The small black square in the lower left corner is the water control. Varieties with the C:C genotype are multi-petaled, unusual-flowered varieties, while those with the C:G and G:G genotypes are normal-flowered varieties. 65 out of 75 Cymbidium goeringii varieties were successfully identified, with an accuracy rate of 86.7% (Table 4).

[0093] Table 4. Classification results of KASP1 markers

[0094]

[0095] The molecular marker KASP2 can clearly distinguish between the T and G genotypes. Successful genotyping was achieved in 75 varieties. Figure 3 As shown in Figure B, the black dots near the Y-axis represent Cymbidium goeringii varieties with homozygous T:T SNP sites, the dark gray dots near the X-axis represent Cymbidium goeringii varieties with homozygous G:G SNP sites, and the light gray dots in the middle represent Cymbidium goeringii varieties with heterozygous G:T SNP sites. The small black square in the lower left corner is the water control. Varieties with the G:G genotype are multi-petaled, unusual-flowered varieties, while those with the G:T and T:T genotypes are normal-flowered varieties. 64 out of 75 Cymbidium goeringii varieties were successfully identified, with an accuracy rate of 83.3%.

[0096] Table 5. Classification results of KASP2 markers

[0097]

[0098] The molecular marker KASP3 can also clearly separate the TT / GC genotypes, and genotyping was successfully performed on all 75 varieties. Figure 3As shown in Figure C, the black dots near the Y-axis represent Cymbidium goeringii varieties with a homozygous TT:TT SNP locus, the dark gray dots near the X-axis represent Cymbidium goeringii varieties with a homozygous GC:GC SNP locus, and the light gray dots in the middle represent Cymbidium goeringii varieties with a heterozygous GC:TT SNP locus. The small black square in the lower left corner is the water control. Varieties with the GC:GC genotype are multi-petaled, unusual-flowered varieties, while those with the GC:TT and TT:TT genotypes are normal-flowered varieties. 64 out of 75 Cymbidium goeringii varieties were successfully identified, with an accuracy rate of 85.3%.

[0099] Table 6. Classification results of KASP3 markers

[0100]

[0101] Comparative analysis revealed that KASP2 and KASP3 successfully identified the same varieties with identical identification results, allowing for selection of either one. However, their results were not entirely identical to those identified by KASP1. Combining different markers, the KASP1+KASP2 and KASP1+KASP3 combinations yielded the same identification results. Except for eight normal-flowered varieties—'Huangfei', 'Yuandong Zhixing', 'Gua Lü', 'Yaotai Wangyue', 'Chongtian He', 'Zhongguo Hong', 'Changzheng', and 'Tianjiang'—all other varieties, including 14 multi-petaled, unusual-flowered varieties, were successfully identified, achieving an accuracy rate of 89.3%. Therefore, the three KASP markers for Cymbidium goeringii developed based on four SNPs on the CsLCR gene in this invention demonstrate a relatively ideal identification effect for multi-petaled, unusual-flowered varieties of Cymbidium goeringii.

[0102] Table 7 Identification results of KASP marker combinations

[0103]

[0104] This invention observes the number of perianth segments in flowers of different germplasm resources within natural populations of Cymbidium goeringii and performs genome-wide association analysis. This makes the SNP loci for perianth segment number obtained from the association analysis more reliable, and the discovery of candidate genes for perianth segment number and the development of genetic markers more precise. The three KASP markers designed and developed in this invention can be used for the breeding of Cymbidium goeringii germplasm with multiple perianth segments and hybrid offspring. They can accurately genotype Cymbidium goeringii varieties with more than 6 perianth segments compared to normal varieties. This combination of molecular markers can play a role in large-scale early germplasm screening, providing effective assistance for molecular breeding of Cymbidium goeringii flower types.

[0105] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A KASP primer for identifying rare and unusual flower varieties of Cymbidium goeringii with multiple perianth segments, characterized in that, Including one or more of KASP1 primers, KASP2 primers, and KASP3 primers; The nucleotide sequences of the upstream primers F1 and F2 of the KASP1 primer are shown in SEQ ID No. 1-2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

3. The nucleotide sequences of the upstream primers F1 and F2 of the KASP2 primer are shown in SEQ ID No. 4-5, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

6. The nucleotide sequences of the upstream primers F1 and F2 of the KASP3 primer are shown in SEQ ID No. 7-8, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.

9.

2. The application of the KASP primers as described in claim 1 in the identification of rare and exotic varieties of Cymbidium goeringii with multiple perianth segments.

3. The application according to claim 2, characterized in that, The application includes the following steps: 1) Extract genomic DNA from Cymbidium goeringii, and use the genomic DNA as a template to perform real-time quantitative PCR amplification using the KASP primers described in claim 1 to obtain the amplification product; 2) Read the fluorescence data of the amplification product obtained in step 1), convert it into typing results, and identify the unique flower varieties of Cymbidium goeringii based on the typing results.

4. The application according to claim 3, characterized in that, The real-time quantitative PCR amplification system consisted of: 1.25 μL of genomic DNA at a concentration of 30 ng / μL, 2.5 μL of 2×KASP Master mix, and 1.25 μL of Primer Mix. In the Primer Mix described in claim 1, the volume ratio of upstream primer F1, upstream primer F2, and downstream primer is 1:1:3, and the concentration is 10 μM.

5. The application according to claim 4, characterized in that, The real-time quantitative PCR amplification program is as follows: 95℃ for 10 min; 95℃ for 20 s, 58℃ for 60 s, 10 cycles; 95℃ for 20 s, 55℃ for 60 s, 27 cycles; 25℃ for 30 s.

6. A kit for identifying rare varieties of Cymbidium goeringii with multiple perianth segments, characterized in that, It includes the KASP primers as described in claim 1 and 2×KASP Master mix.

Images