SNP (Single Nucleotide Polymorphism) molecular marker associated with leaf width of brassica juncea, detection substance and application of SNP molecular marker

Abstract

The invention relates to the technical field of molecular biology and genetic breeding, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker associated with leaf width of brassica juncea, a detection substance and application of the SNP molecular marker. According to the SNP molecular marker associated with the leaf width of the mustard type rape, the SNP molecular marker is located at the 15973429 position of a chromosome A07 of the mustard type rape, and a basic group at the 15973429 position is A or G; the SNP molecular marker significantly associated with leaf width of brassica juncea is obtained, a reliable molecular marker source is provided for leaf shape selection of brassica juncea, and the SNP molecular marker can be used for auxiliary selection of brassica juncea materials with narrow or wide leaves.

Description

Technical Field

[0001] The present invention relates to the technical fields of molecular biology and genetic breeding, and particularly relates to an SNP molecular marker associated with leaf width of Brassica juncea, a detection substance thereof, and uses thereof. Background Art

[0002] Rapeseed is an oil crop and one of the main sources of edible vegetable oil. Currently, the types of rapeseed include Brassica napus (AACC), Brassica juncea (AABB), and Brassica rapa (AA) rapeseed. Among them, Brassica juncea has advantages such as strong adaptability and rich resistance resources, and is an excellent material for carrying out genetic research.

[0003] Leaves are the main photosynthetic organs of rapeseed seedlings and an important basis for rapeseed yield formation. Reasonable leaf size can improve the utilization efficiency of water and light, thereby achieving high yields. Leaf size includes traits such as leaf width, leaf length, and leaf area. In crops such as rice and corn, narrow leaves are considered one of the ideal plant types for dense planting, and in-depth research has been carried out on the leaf width trait. In rice, more than 30 narrow leaf genes such as NAL1 and NAL5 have been cloned, and in corn, multiple narrow leaf genes such as ASC1, DIL1, and ZmNL4 have been cloned. In cruciferous plants, some research has also been carried out on leaf width. Researchers at Shenyang Agricultural University cloned the narrow leaf gene BrAN of Chinese cabbage using a narrow leaf EMS mutant of Chinese cabbage and verified in Arabidopsis thaliana that BrAN regulates leaf width by regulating microtubule arrangement. In Brassica napus, two QTL loci qLW-A01-1 and qLW-C03-1 that regulate leaf width were mapped on chromosomes A01 and C03 through QTL mapping, which can explain 12.04% and 17.34% of the phenotypic variation, respectively. Research on leaf width-related has been carried out in both Chinese cabbage and Brassica napus, but no gene that regulates leaf width has been cloned in Brassica juncea. Summary of the Invention

[0004] Therefore, the technical problem to be solved by the present invention is to provide an SNP molecular marker associated with leaf width of Brassica juncea, a detection substance thereof, and uses thereof.

[0005] To this end, the present invention provides the following technical solutions:

[0006] An embodiment of the present invention provides an SNP molecular marker associated with leaf width of Brassica juncea, and the SNP molecular marker is located at position 15973429 on chromosome A07 of Brassica juncea, and the base at position 15973429 is A or G.

[0007] In some embodiments, the genotype of the SNP molecular marker located at position 15973429 on chromosome A07 of Brassica juncea is G, corresponding to narrow-leaf Brassica juncea, and the genotype of the SNP molecular marker located at position 15973429 on chromosome A07 of Brassica juncea is A, corresponding to wide-leaf Brassica juncea.

[0008] In some embodiments, the SNP molecular marker is a sequence within ≤ 450 - 550 bp upstream and downstream of position 15973429 on chromosome A07 of Brassica juncea. In a preferred embodiment, the SNP molecular marker is a sequence of 500 bp upstream and downstream of position 15973429 on chromosome A07 of Brassica juncea.

[0009] In the embodiments of the present invention, a substance for detecting the SNP molecular marker associated with the leaf width of Brassica juncea is at least one of the following:

[0010] 1) The substance for detecting the SNP molecular marker associated with the leaf width of Brassica juncea contains PCR primers for amplifying a sequence fragment including the aforementioned SNP molecular marker associated with the leaf width of Brassica juncea;

[0011] 2) The substance for detecting the SNP molecular marker associated with the leaf width of Brassica juncea is a PCR reagent containing the PCR primers in 1);

[0012] 3) A kit containing the PCR primers in 1) or the PCR reagent in 2).

[0013] In some embodiments, the sequences of the PCR primers are as shown in SEQ ID NO.1 - 2. The sequence of the upstream primer is as shown in SEQ ID NO.1, and the sequence of the downstream primer is as shown in SEQ ID NO.2.

[0014] In some embodiments, the amplification system of the PCR reagent:

[0015] Component Volume 2×PCR Mix 15 μL Forward primer, concentration 8 - 12 μM 1.5 μL Reverse primer, concentration 8 - 12 μM 1.5 μL DNA, concentration 50 - 100 ng / μL 2.5 μL <![CDATA[ddH2O]]> 9.5 μL Total 30 μL

[0016] In the above amplification system of the PCR reagent, 2×PCR Mix is a commercially available product.

[0017] In some embodiments, the concentration of the upstream primer can be any one of 8 μM, 9 μM, 10 μM, 11 μM, 12 μM or a range value between any two of these values. In a preferred embodiment, the concentration of the upstream primer is 10 μM. μM represents μmol / L.

[0018] In some embodiments, the concentration of the downstream primer can be any one of 8 μM, 9 μM, 10 μM, 11 μM, 12 μM or a range value between any two of these values. In a preferred embodiment, the concentration of the downstream primer is 10 μM. μM represents μmol / L.

[0019] An embodiment of the present invention provides the use of the SNP molecular marker associated with the leaf width of Brassica juncea or the substance for detecting the SNP molecular marker associated with the leaf width of Brassica juncea in any one of the following A1 - A6:

[0020] A1) Identifying or assisting in identifying the leaf width of Brassica juncea;

[0021] A2) Preparing a product for identifying or assisting in identifying the leaf width of Brassica juncea;

[0022] A3) Screening or assisting in screening the leaf width of Brassica juncea;

[0023] A4) Preparing a product for screening or assisting in screening the leaf width of Brassica juncea;

[0024] A5) Assisted breeding of Brassica juncea;

[0025] A6) Preparing a product for assisted breeding of Brassica juncea.

[0026] An embodiment of the present invention provides a method for detecting the leaf width of Brassica juncea, comprising:

[0027] (1) Extracting the genomic DNA of the Brassica juncea sample to be tested;

[0028] (2) Using the substance for detecting the SNP molecular marker associated with the leaf width of Brassica juncea as described above to perform PCR amplification on the genomic DNA extracted in step (1);

[0029] (3) Sequencing the amplification product in step (2). If the genotype at the 15973429th position corresponding to the amplification product is G, the sample to be tested is narrow - leaf Brassica juncea; if the genotype at the 15973429th position corresponding to the amplification product is A, the sample to be tested is wide - leaf Brassica juncea.

[0030] In some embodiments, the PCR amplification program is:

[0031]

[0032] In some embodiments, the sequence of the amplification product of the narrow - leaf Brassica juncea is as shown in SEQ ID NO.3; and / or, the sequence of the amplification product of the wide - leaf Brassica juncea is as shown in SEQ ID NO.4.

[0033] The technical solution of the present invention has the following advantages:

[0034] (1) A SNP molecular marker associated with the leaf width of Brassica juncea provided by the present invention, wherein the base at the 15,973,429th position on chromosome A07 of Brassica juncea is G or A; the present invention obtains a SNP locus significantly associated with the leaf width of Brassica juncea, with a contribution rate of 9.27%, which can be effectively applied to the genetic improvement of the leaf width trait of Brassica juncea. The research discovers a molecular marker significantly associated with the leaf width of Brassica juncea var. gracilis, providing a reliable source of molecular markers for the selection of leaf shape of Brassica juncea, and can be used to assist in selecting Brassica juncea materials with narrower or wider leaves. Description of the Drawings

[0035] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0036] Figure 1 It is a SNP locus significantly associated with the leaf width of Brassica juncea detected at the 15,973,429th base on chromosome A07 in Example 1 of the present invention;

[0037] Figure 2 It is the difference between the amplification products of the A07-1G genotype and the A genotype of the molecular marker in Example 2 of the present invention. Specific Embodiments

[0038] The following embodiments are provided to better understand the present invention further, and are not limited to the best embodiment. They do not limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior art features falls within the protection scope of the present invention.

[0039] For those steps or conditions not specified in the examples, the operations or conditions of the conventional experimental steps described in the literature in this field can be followed. For the reagents or instruments not specified by the manufacturer, they are all conventional reagent products that can be obtained through commercial purchase.

[0040] Example 1 Obtaining of the SNP Molecular Marker Associated with the Leaf Width of Brassica juncea

[0041] (1) A natural population consisting of 480 Brassica juncea accessions was planted in two environments, namely in Nanchang, Jiangxi and Gao'an, Jiangxi. Among them, the plants were potted in Nanchang, Jiangxi and field-planted in Gao'an, Jiangxi. The management measures were carried out according to the general field trial standards. At the six-leaf stage, the leaf width of the third leaf counted from the bottom up of the plant was investigated, and the phenotypic data of leaf width were collected. The BLUP values of leaf width in the two environments of Nanchang, Jiangxi and Gao'an, Jiangxi were calculated using the lme package in R Studio software as the phenotypic values for genome-wide association analysis.

[0042] (2) The genotype data of this natural population have been published and can be obtained by downloading from the NCBI website (https: / / www.ncbi.nlm.nih.gov / bioproject / ?term=PRJNA615316). Quality control was performed on the genotype data: using Plink software to filter SNP loci with a missing rate greater than 0.1, a minor allele frequency less than 0.05, and samples with a genotype data missing rate greater than 0.1 and a heterozygosity rate greater than 0.1. After filtering, 435 samples and 4,460,968 SNP loci remained for subsequent analysis.

[0043] (3) In the R studio software, using the mixed linear model in the R package rMVP, genome-wide association analysis was performed by combining the phenotypic data and the filtered genotype data. One SNP locus significantly associated with the leaf width of Brassica juncea was detected at the 15,973,429th base on chromosome A07 ( Figure 1 ), with a significance level of 6.036e-07 and a contribution rate of 9.27%. The base sequence at the 15,973,429th position on chromosome A07 is A or G.

[0044] (4) According to the base sequence at the 15,973,429th position on chromosome A07, the 435 accessions within the natural population were divided into two genotypes, A and G. Among them, the average leaf width of the accessions with genotype A was 54.53 ± 7.61 mm, and the average leaf width of the accessions with genotype G was 50.23 ± 6.40 mm. The significance test showed that there was a highly significant difference in leaf width between the accessions with genotype A and genotype G, and the p-value was 4.40E-06.

[0045] Example 2 Primers for Detecting SNP Molecular Markers Associated with the Leaf Width of Brassica juncea

[0046] This example provides a substance for detecting SNP molecular markers associated with the leaf width of Brassica juncea, including:

[0047] (1)Extract the sequences of 500 bp upstream and downstream of 15,973,429 bases on chromosome A07 of Brassica juncea, and design SNP molecular marker primer A07-1 according to the primer design principle. The forward primer is A07-1F: ATGCCTTGATGAGAATAGCCTT (SEQ ID NO.1), and the reverse primer is A07-1R: CGAACCTCGTGGGGAATCTT (SEQ ID NO.2).

[0048] The amplified sequence in Brassica juncea J200 is genotype A, and the sequence is as follows:

[0049] ATGCCTTGATGAGAATAGCCTTAATTTTCTGCTAAGTGTCTGCTCTTTGTAAGCCACAGAAGCAAAGAATGATGCAGAGGAGACTGCCCTTTTATAGGCACAAAATAATTGAAAGAGAGAGGATGAGAGCTCGCACCGACCTTCCACTATATGTGATTTGAGACATCACGAAAATGTGAAGCCTTAGAGATAGGTTCATCACGCCTTTTCCGACTTTATTATCATTTTAAACTTTAGATTTTGGAATTTAAGTTTGTTTTTTGACAAATTTTCTGGAATTTAAGTTTTGCCGATTTCTTACCTTTTTTATAGAGAAATTTGGCCATATAACCATAAAAAAACTAAATTAACAAACTAACCATCTTTCCCCTTCTCTCTCTTCTTTTTCTTCCTATGTCTCAAGTTAGTTTTTTTAATTTTAGTTTTTATTATTCTTTCGCCAGTTCACCTTTTTTATATTTTTCTTTCTATGATTATACTCCTTTCGTTTTTTAATATAAATCATTTTAGAGAAATTTTATGTTCTAAATTATATGACATTTTCAGTTTTCTATGTAAAATTTATTAACACTCAATGTTATATGACCAATAATAATATACCTTCCATTTTATCATTGGTTGATTTGTGGTTATGTAAAGAACTAATGATGTTTTGTTTAGAAAATATAAAAATTAATGATTTTCTTAATTTATGTGCATAATTATAAAACGACTTATATTAAAAAACGGAGGGAGTAACGTATTTCTTTAACCCAGGGACACTACGCATACACGGAACTATGAATCAGAAAAAACAACACTTGCATTTAATCCCATAAAATATTTAGCAATCTCAAAGATTCCCCACGAGGTTCG(SEQ ID NO.3).

[0050] The amplified sequence in Brassica juncea I110 is of the G genotype and is as follows:

[0051] ATGCCTTGATGAGAATAGCCTTAACTTTCTGCTAAGTGTCTGCTCTTTGTAAGCCACAGAAGCAAAGAATGATGCAGAGGAGACTGCCCTTTTATAGGCACAAAATAATTGAAAGAGAGAGGATGAGAGCTCGCACCGACCTTCCACTATATGTGATTTGAGACATCACGAAAATGTGAAGCCTTGGAGATAGGTTCATCACGCCTTTTCCAACTTTATTATCATTTTAAACTTTAGATTTTGAATTTAAGTTTGTTTTTTTGACAAATTTTCTGGAATTTAAGTTTTGCCGATTTCTTACCTTTTTTATAGAGAAATTTGGCCATATAACTATAAAAAAACTAAATTAACAAACTAACCATCTTTCCCCTTCTCTCTCTTCCTTTTTCTTCCTTTGTCTCAAGTTAGTTTCTTAATTTTAGTTTTTATTATTATATCGCCAGTTCACCTTTTTATATTTTTTCTTTCTATGATTATAACATATTTCTTTAACCCAAGGATACTACGCATACACGGAACTATGGATCAGAAAAACAACACTTGCATTTAATCCCATAAAATATTTAGCAATCTCAAAGATTCCCCACGAGGTTCG(SEQ ID NO.4).

[0052] The amplified products of the A genotype and the G genotype of molecular marker A07-1 are different as Figure 2 shown.

[0053] Kit for detecting SNP molecular markers associated with leaf width of Brassica juncea in Example 3

[0054] This example provides a kit for detecting SNP molecular markers associated with leaf width of Brassica juncea, including the PCR amplification system shown in the following table:

[0055] Table 1. PCR amplification system

[0056] Component Volume 2×PCR Mix (commercially available) 15 μL Forward primer, concentration 10 μM 1.5 μL Reverse primer, concentration 10 μM 1.5 μL DNA, concentration 50 - 100 ng / μL 2.5 μL <![CDATA[ddH2O]]> 9.5 μL Total 30 μL

[0057] Application of substances for detecting SNP molecular markers associated with leaf width of Brassica juncea in screening and breeding of Brassica juncea leaf width in Example 4

[0058] This embodiment provides a method for detecting the leaf width of Brassica juncea, comprising the following steps:

[0059] (1) Select 14 broad-leaf materials (leaf width 63.27 mm - 75.96 mm) and 14 narrow-leaf materials (leaf width 34.99 mm - 41.48 mm) from 480 Brassica juncea natural populations.

[0060] (2) Extract the genomic DNA of the materials in (1) using the conventional CTAB method;

[0061] (3) Using the genomic DNA in (2) as a template and SEQ ID NO.1 - 2 as primers, construct a PCR amplification system and perform PCR amplification as shown in the following table:

[0062] Table 2. PCR Amplification System

[0063] Component Volume 2×PCR Mix (commercially available) 15 μL Forward primer, concentration 10 μM 1.5 μL Reverse primer, concentration 10 μM 1.5 μL DNA, concentration 50 - 100 ng / μL 2.5 μL <![CDATA[ddH2O]]> 9.5 μL Total 30 μL

[0064] PCR Amplification Reaction Program:

[0065] Table 3. PCR Amplification Program

[0066]

[0067]

[0068] (4) Sequence the products amplified in step (3), detect the genotype at the corresponding 15973429th position in the amplified products, and the distribution of the two genotypes of the molecular marker A07 - 1 significantly associated with the leaf width of Brassica juncea in the leaf width extreme materials. The results show that 13 out of 14 narrow-leaf materials have the G genotype of the molecular marker snp A07 - 1, while 12 out of 14 broad-leaf materials have the A genotype (Table 4).

[0069] The above results indicate that the molecular marker A07 - 1 is highly associated with the leaf width of Brassica juncea, and thus can be used for molecular marker-assisted selection of the leaf width of Brassica juncea.

[0070] Table 4. Genotypes of Molecular Marker A07 - 1 in Leaf Width Extreme Materials

[0071]

[0072]

[0073] Obviously, the above embodiments are merely examples given for clear illustration and not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all implementation manners here. And the obvious changes or modifications derived therefrom still fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker associated with the leaf width of Brassica juncea, characterized in that, The SNP molecular marker is located at position 15973429 on chromosome A07 of Brassica juncea, and the base at position 15973429 is A or G.

2. The SNP molecular marker associated with the leaf width of Brassica juncea according to claim 1, characterized in that, When the genotype of the SNP molecular marker located at position 15973429 on chromosome A07 of Brassica juncea is G, it corresponds to narrow-leaf Brassica juncea, and when the genotype of the SNP molecular marker located at position 15973429 on chromosome A07 of Brassica juncea is A, it corresponds to wide-leaf Brassica juncea.

3. The SNP molecular marker associated with the leaf width of Brassica juncea according to claim 1 or 2, characterized in that The SNP molecular marker is a sequence with ≤ 450 - 550 bp upstream and downstream of position 15973429 on chromosome A07 of Brassica juncea.

4. A substance for detecting SNP molecular markers associated with the leaf width of Brassica juncea, characterized in that, It is at least one of the following: 1) The substance for detecting the SNP molecular marker associated with leaf width of Brassica juncea contains PCR primers for amplifying a sequence fragment including the SNP molecular marker associated with leaf width of Brassica juncea as described in any one of claims 1 - 3; 2) The substance for detecting the SNP molecular marker associated with leaf width of Brassica juncea is a PCR reagent containing the PCR primers described in 1); 3) A kit containing the PCR primers described in 1) or the PCR reagent described in 2).

5. The substance for detecting SNP molecular markers associated with the leaf width of Brassica juncea according to claim 4, characterized in that The sequences of the PCR primers are as shown in SEQ ID NO.1 - 2.

6. The substance for detecting SNP molecular markers associated with the leaf width of Brassica juncea according to any one of claims 4-5, characterized in that The amplification system of the PCR reagent:

7. Use of the SNP molecular marker associated with leaf width of Brassica juncea as described in any one of claims 1 - 3 or the substance for detecting the SNP molecular marker associated with leaf width of Brassica juncea as described in any one of claims 4 - 6 in any one of the following A1 - A6: A1) Identifying or assisting in identifying the leaf width of Brassica juncea; A2) Preparing a product for identifying or assisting in identifying the leaf width of Brassica juncea; A3) Screening or assisting in screening the leaf width of Brassica juncea; A4) Preparing a product for screening or assisting in screening the leaf width of Brassica juncea; A5) Assisted breeding of Brassica juncea; A6) Preparing a product for assisted breeding of Brassica juncea.

8. A method for detecting the leaf width of Brassica juncea, characterized in that, It includes: (1) Extracting genomic DNA from a Brassica juncea sample to be tested; (2) Using the substance for detecting the SNP molecular marker associated with leaf width of Brassica juncea as described in any one of claims 4 - 6 to perform PCR amplification on the genomic DNA extracted in step (1); (3) Sequencing the amplification product in step (2). If the genotype at the corresponding position 15973429 in the amplification product is G, the sample to be tested is narrow-leaf Brassica juncea, and if the genotype at the corresponding position 15973429 in the amplification product is A, the sample to be tested is wide-leaf Brassica juncea.

9. The method for detecting the leaf width of Brassica juncea according to claim 8, wherein The program of the PCR amplification is:

10. The method for detecting the leaf width of Brassica juncea according to claim 9, wherein The sequence of the amplification product of the narrow-leaf Brassica juncea is as shown in SEQ ID NO.3; and / or, the sequence of the amplification product of the wide-leaf Brassica juncea is as shown in SEQ ID NO.4.

Images