In-vitro cell-free protein synthesis system and method for inserting non-natural amino acid and application

Abstract

The invention provides an in-vitro cell-free protein synthesis system for inserting non-natural amino acid. The reaction system comprises: (1) a yeast cell extract; (2) non-natural amino acids; (3) an exogenous orthogonal aminoacyl tRNA synthetase / orthogonal tRNA pair; (4) a template containing a target protein gene sequence, wherein a codon for coding at least one amino acid in the target protein gene sequence is mutated into a termination codon; by adopting the reaction system, the insertion efficiency of the non-natural amino acid and the expression quantity of the non-natural amino acid protein can be improved.

Description

In vitro cell-free protein synthesis system, method and application for inserting unnatural amino acids Technical Field

[0001] The present invention relates to the field of biotechnology, and preferably to an in vitro cell-free protein synthesis system for inserting unnatural amino acids. Background Art

[0002] Proteins are essential molecules in cells, involved in nearly all cellular functions. Different protein sequences and structures determine their diverse functions. Within cells, proteins act as enzymes to catalyze various biochemical reactions, serve as signaling molecules to coordinate various biological activities, support biological morphology, store energy, transport molecules, and enable movement. In the biomedical field, protein antibodies, as targeted drugs, are important treatments for diseases such as cancer.

[0003] In cells, protein production involves two steps: gene transcription and mRNA translation.

[0004] Gene transcription is the process by which a strand of RNA is synthesized using a DNA strand as a template, under the catalysis of DNA-dependent RNA polymerase (RNP or RNAP), using four NTPs (ATP, CTP, GTP, and UTP) as raw materials, according to the principle of base complementary pairing. For some RNA viruses, RNA can also guide the synthesis of RNA.

[0005] The translation of mRNA into protein refers to the process of assembling activated amino acids into protein polypeptide chains on ribosomes (also known as ribosomes) using mRNA as a template and tRNA as a carrier under the action of relevant enzymes and auxiliary factors.

[0006] Regulation of protein synthesis plays an important role in responding to external stresses such as nutrient deprivation, cell development and differentiation, and many other processes, including transcriptional regulation and translational regulation.

[0007] Transcriptional regulation refers to the regulation of RNA synthesis using DNA as a template. All cells possess a large number of sequence-specific DNA-binding proteins (trans-acting factors) that can accurately recognize and bind to specific DNA sequences (cis-acting elements), acting as switches at the transcriptional level. Transcriptional regulation is a key component of eukaryotic gene expression regulation. Depending on whether eukaryotic gene expression is affected by the environment, it can be divided into developmental regulation and transient regulation. Developmental regulation refers to the regulation of gene expression by eukaryotic organisms according to a "predetermined" and "ordered" program to ensure their growth, development, and differentiation. This is an irreversible process. Transient regulation refers to the adaptive transcriptional regulation of eukaryotic organisms in response to internal and external environmental stimuli. This is a reversible process.

[0008] The four processes of translation regulation include translation initiation, translation elongation, translation termination and ribosome recycling, among which translation initiation is the most regulated process. During the translation initiation stage, the small ribosomal subunit (40S) binds to (tRNA) iMet The small subunit then moves downstream and binds to the large ribosome (60S) at the start codon (AUG), forming a complete ribosome and entering the translation elongation phase.

[0009] Currently, the commonly used biosynthetic systems are the in vivo biosynthetic system and the in vitro biosynthetic system. The in vivo biosynthetic system refers to the process of synthesizing various compounds catalyzed by enzymes within the biological system. It is the general term for assimilation reactions within the organism, including photosynthesis, gluconeogenesis, and the biosynthesis of nucleotides, nucleic acids, and proteins. In cellular biosynthesis, protein synthesis is the most quantitatively important. Protein biosynthesis, also known as translation, is the process of converting the base sequence in the mRNA molecule into the amino acid sequence in the protein or polypeptide chain. Protein biosynthesis is divided into five stages: activation of amino acids, initiation of polypeptide chain synthesis, elongation of the peptide chain, termination and release of the peptide chain, and post-synthesis processing and modification of the protein.

[0010] An in vitro biosynthesis system involves the efficient in vitro synthesis of specific chemical molecules or biomacromolecules (DNA, RNA, proteins) by adding exogenously encoded nucleic acids (DNA, RNA), substrates, and energy sources to a lysed bacterial, fungal, plant, or animal cell system. A common in vitro biosynthesis system is the in vitro protein synthesis system, a cell-free protein synthesis system that uses exogenous mRNA or DNA templates and cell lysates to rapidly and efficiently translate exogenous recombinant proteins.

[0011] The earliest known cell-free system dates back to Buchner's 1897 proposal that biosynthesis could be carried out in vitro. He demonstrated bioethanol production using a yeast cell-free system. However, due to an imbalance in adenosine triphosphate (ATP), this system was not suitable for large-scale application. Welch and Scopes addressed this issue through various approaches in 1985, achieving high ethanol yields. However, this system also had two major drawbacks: the need for the addition of costly enzymes and its inability to tolerate temperature fluctuations.

[0012] However, this technology currently has some inherent problems that are difficult to solve: such as reversibility, instability, leakage, inactivation, enzyme recycling, lack of stable enzymes, enzyme complexes and cofactors, etc.

[0013] A common commercial in vitro protein synthesis system is the in vitro transcription-translation coupled system (IVTT). This system uses a DNA template, RNA polymerase to transcribe an mRNA intermediate, and then uses components such as amino acids and ATP to complete the efficient one-step translation of the exogenous protein. Currently, common commercial in vitro protein expression systems include the Escherichia coli extract (ECE) system, the rabbit reticulocyte lysate (RRL) system, the wheat germ extract (WGE) system, the insect cell extract (ICE) system, and the human system.

[0014] Compared with traditional in vivo recombinant expression systems, in vitro cell-free protein synthesis systems have many advantages, such as the ability to express special proteins that are toxic to cells or contain non-natural amino acids (such as D-amino acids), the ability to directly use PCR products as templates to simultaneously synthesize multiple proteins in parallel, and the ability to carry out high-throughput drug screening and proteomics research.

[0015] As key sites for post-translational modification of proteins and key residues in the active centers of various enzymes, unnatural amino acids play a crucial role in the physiological and pathological functions of various proteins. For proteins, particularly peptide drugs, modification with unnatural amino acids may not only enhance the efficacy and reduce drug toxicity of peptide drugs, but also significantly reduce their immunogenicity and immune rejection due to the incorporation of unnatural amino acids. Furthermore, certain proteases may no longer recognize peptides incorporating unnatural amino acids, allowing the drug to remain in the body for longer periods without degradation, thereby extending its half-life and eliminating the drawbacks of continuous injections of peptide drugs. Furthermore, modification may allow peptide drugs to be "loaded" with other chemical attachments, leading to the emergence of new approaches to disease treatment.

[0016] Post-translational modification of proteins using targeted modification of non-natural amino acids is of great significance for the synthesis of special peptides or proteins and the influence of chemically modified amino acids on protein structure and function.

[0017] Currently, the most mature technology for the artificial synthesis of proteins modified with non-natural amino acids is chemical peptide synthesis. Liquid-phase or solid-phase synthesis can be used to synthesize short fragments, but these methods have significant limitations. Liquid-phase synthesis relies primarily on the spontaneous coupling of amino acids in the reaction system, which can be inefficient. Separation of raw materials and activators from the reaction system is also difficult, making obtaining pure peptide products difficult.

[0018] Summary of the Invention

[0019] The object of the present invention is to provide a reaction system, a kit and a reaction method for improving the efficiency of protein synthesis containing unnatural amino acids.

[0020] The first aspect of the present invention provides an in vitro cell-free protein synthesis system for inserting unnatural amino acids, characterized in that the reaction system comprises:

[0021] (1) Cell extracts;

[0022] (2) unnatural amino acids;

[0023] (3) exogenous orthogonal aminoacyl-tRNA synthetase / orthogonal tRNA pair;

[0024] (4) A template comprising a target protein gene sequence, wherein at least one codon encoding an amino acid in the target protein gene sequence is mutated into a stop codon.

[0025] In another preferred embodiment, the stop codon is mutated to TAG.

[0026] In another preferred embodiment, one amino acid codon in the target protein gene sequence is mutated into a stop codon.

[0027] In another preferred embodiment, two or more amino acid codons in the target protein gene sequence are mutated into stop codons.

[0028] In another preferred embodiment, the cell extract is preferably selected from any one of the following sources: Escherichia coli, yeast cells, mammalian cells, plant cells, insect cells, or a combination thereof.

[0029] In another preferred embodiment, the cell extract is more preferably selected from any one of the following sources: Escherichia coli, Kluyveromyces lactis, wheat germ cells, Spodoptera frugiperda insect cells, rabbit reticulocytes, CHO cells, COS cells, VERO cells, BHK cells, human fibrosarcoma HT1080 cells, or a combination thereof.

[0030] In another preferred embodiment, the yeast cell is preferably selected from Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta (Methanol-inducible yeast (Ogataeaminuta), Pichia lindneri), Pichia opuntiae, Pichia athermotolerans, Pichia salictaria, Pichia g uercuum, Pichia apijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae. cerevisiae), Saccharomyces sp., Hansenula polymorpha, Kluyveromyces, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces marxianus var. lactis, Kluyveromyces marxianus var. marxianus, Kluyveromyces marxianus var.vanudenii, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus, Kluyveromyces siamensis, and Kluyveromyces yarrowii, or a combination thereof. In another preferred embodiment, the Kluyveromyces yeast is more preferably selected from Kluyveromyces marxianus and / or Kluyveromyces lactis.

[0031] In another preferred embodiment, the yeast cell extract is an aqueous extract of yeast cells.

[0032] In another preferred embodiment, the yeast cell extract does not contain long-chain nucleic acid molecules endogenous to yeast.

[0033] In another preferred embodiment, the yeast cell extract is prepared by a method comprising the following steps:

[0034] (i) providing yeast cells;

[0035] (ii) washing the yeast cells to obtain washed yeast cells;

[0036] (iii) subjecting the washed yeast cells to cell disruption to obtain a crude yeast extract; and

[0037] (iv) performing solid-liquid separation on the crude yeast extract to obtain a liquid portion, which is the yeast cell extract.

[0038] In another preferred embodiment, the centrifugation is performed in a liquid state.

[0039] In another preferred embodiment, the centrifugation condition is 5000-100000g, preferably, 8000-30000g.

[0040] In another preferred embodiment, the centrifugation time is 0.5 min–2 h, preferably, 20–50 min.

[0041] In another preferred embodiment, the centrifugation is carried out at 1-10°C, preferably, at 2-6°C.

[0042] In another preferred embodiment, the washing treatment is carried out by using a washing liquid at a pH of 7-8 (preferably 7.4).

[0043] In another preferred embodiment, the washing liquid is selected from the following group: potassium 4-hydroxyethylpiperazineethanesulfonate, potassium acetate, magnesium acetate, or a combination thereof.

[0044] In another preferred embodiment, the cell disruption treatment includes high-pressure disruption and freeze-thaw (such as liquid nitrogen low-temperature) disruption.

[0045] In another preferred embodiment, the structural formula of the non-natural amino acid is compound of formula (I):

[0046] wherein n is selected from a natural number of 1-20, R1 is selected from a substituted or unsubstituted C5-C60 aryl or heteroaryl group, a substituted or unsubstituted C1-C20 alkyl group, a substituted or unsubstituted C2-C20 alkenyl group or a substituted or unsubstituted C2-C20 alkynyl group, and A is selected from O or -CH2-.

[0047] In another preferred embodiment, n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

[0048] In another preferred embodiment, n is a natural number selected from 1-10.

[0049] In another preferred embodiment, n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0050] In another preferred embodiment, n is a natural number selected from 1-6.

[0051] In another preferred embodiment, n is selected from 1, 2, 3, 4, 5 or 6.

[0052] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C5-C30 aryl or heteroaryl.

[0053] In another preferred embodiment, the R1 is selected from substituted or unsubstituted phenyl.

[0054] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C20 alkenyl.

[0055] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C10 alkenyl.

[0056] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C6 alkenyl.

[0057] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C20 alkynyl.

[0058] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C10 alkynyl.

[0059] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C6 alkynyl.

[0060] In another preferred embodiment, the A is selected from O.

[0061] In another preferred embodiment, the A is selected from -CH2-.

[0062] In another preferred embodiment, the substituents are substituents commonly used in the art, such as aryl, heteroaryl, alkyl, cycloalkyl, aryloxy, heteroaryloxy, alkyloxy, cycloalkyloxy, hydroxyl, thiol, ester, carboxyl, cyano, halogen, nitro, sulfonic acid, azide, alkenyl, alkynyl, phosphate, etc.

[0063] In another preferred embodiment, the structural formula of the non-natural amino acid is selected from one or a combination of the following:

[0064] In another preferred embodiment, the concentration of the non-natural amino acid relative to the reaction system is in the range of 0.1 to 1000 mmol / L, preferably 0.5 to 500 mmol / L, more preferably 0.5 to 100 mmol / L.

[0065] In another preferred embodiment, the exogenous orthogonal aminoacyl-tRNA synthetase is selected from natural or mutant Pyl-tRNA synthetase (PylRS), Leu-tRNA synthetase (LeuRS), Tyr-tRNA synthetase (TyrRS), Phe-tRNA synthetase (PheRS) or TrP-tRNA synthetase (TrpRS); the tRNA is selected from natural or mutant tRNAPyl, tRNALeu, tRNATyr, tRNAPhe or tRNATrp.

[0066] In another preferred embodiment, the exogenous orthogonal aminoacyl-tRNA synthetase is selected from natural or mutant MaPylRS, MmPylRS, MbPylRS, EcTyrRS, MjTyrRS, EcLeuRS, ScPheRS, ScTrpRS, BsTrpRS, preferably MaPylRS.

[0067] In another preferred embodiment, the concentration of the enzyme relative to the reaction system is in the range of 0.001 to 1 mmol / L, preferably 0.005 to 0.1 mmol / L, and more preferably 0.005 to 0.05 mmol / L.

[0068] In another preferred embodiment, the concentration of the tRNA relative to the reaction system ranges from 0.001 to 1 mmol / L, preferably from 0.005 to 0.1 mmol / L, and more preferably from 0.02 to 0.1 mmol / L.

[0069] In another preferred embodiment, the target protein is selected from luciferin, luciferase, green fluorescent protein, yellow fluorescent protein, red fluorescent protein, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable region of an antibody, luciferase mutation, α-amylase, enterobactin A, hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, interleukin-1β, lysozyme, serum albumin, single-chain antibody fragment (scFV), transthyretin, tyrosinase, xylanase, or a combination thereof.

[0070] In another preferred embodiment, the system further comprises: the system further comprises one or more components selected from the group consisting of a buffer, potassium ions, magnesium ions, polyethylene glycol, an optional aqueous solvent, and phosphate.

[0071] In another preferred embodiment, the buffer is selected from the group consisting of Tris-HCl, Tris base, HEPES, Tris-citric acid, citric acid-citrate, and Tris-citrate, or a combination thereof.

[0072] In another preferred embodiment, the potassium ions are derived from a potassium ion source, which is not particularly limited. The potassium ion source is selected from the following group: potassium acetate, potassium glutamate, potassium citrate, or a combination thereof.

[0073] In another preferred embodiment, the potassium ion concentration is 30-210 mM, preferably 30-150 mM, more preferably 30-80 mM.

[0074] In another preferred embodiment, the magnesium ions are derived from a magnesium ion source, which is not particularly limited and is selected from the group consisting of magnesium acetate, magnesium glutamate, magnesium citrate, magnesium aspartate, or a combination thereof.

[0075] In another preferred embodiment, the polyethylene glycol is selected from the group consisting of PEG3000, PEG8000, PEG6000, PEG3350, or a combination thereof.

[0076] In another preferred embodiment, the phosphate is selected from orthophosphate, dihydrogen phosphate, disodium hydrogen phosphate, metaphosphate, pyrophosphate, or a combination thereof; preferably orthophosphate.

[0077] In another preferred embodiment, the concentration of the cell extract is 20-80% v / v.

[0078] In another preferred embodiment, the concentration (w / v) of the polyethylene glycol is 0.1-8%, preferably 0.5-4%, and more preferably 1-2%.

[0079] The second aspect of the present invention provides a kit, characterized in that the kit contains (a) a container, and (b) the synthesis system according to any one of the first aspects of the present invention located in the container.

[0080] The third aspect of the present invention provides a method for synthesizing a protein containing unnatural amino acids using a cell-free system, which is prepared using the synthesis system described in any one of the first aspect of the present invention or the kit described in the second aspect of the present invention.

[0081] The fourth aspect of the present invention provides use of the system described in the first aspect of the present invention or the kit provided in the second aspect of the present invention in synthesizing proteins containing unnatural amino acids.

[0082] The fifth aspect of the present invention provides a protein containing non-natural amino acids, which is prepared by the synthesis system described in any one of the first aspect of the present invention, the kit described in the second aspect of the present invention, or the method described in the third aspect of the present invention.

[0083] The sixth aspect of the present invention provides the use of a protein containing the non-natural amino acid provided by the fifth aspect of the present invention in click chemistry modification.

[0084] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0085] FIG1 shows a schematic diagram of the MaPylRS pET28a plasmid constructed in the present invention.

[0086] FIG2 shows the pET28a-tRNA constructed by the present invention. Pyl CUA Schematic diagram of the plasmid.

[0087] FIG3 shows the constructed single-site incorporation reporter gene.

[0088] Figure 4 is a schematic diagram of the dual fluorescent reporter gene system used in the present invention. Its purpose is to detect the efficiency and authenticity of unnatural amino acid insertion. OTS: orthogonal translation system; ncAA: noncanonical amino acid; F: natural amino acid Phe; X: noncanonical amino acid.

[0089] Figure 5 shows the protein factory of the present invention inserting unnatural amino acid reporter genes and different OTS components, with the expression supernatant purified via a nickel column. NC represents ncaa alone, PC represents the positive control, ETC on the left represents the ncaa reporter gene + OTS, ET represents the ncaa reporter gene + o-aars + o-tRNA, EC represents the ncaa reporter gene + o-aars + ncaa, and ETC on the right represents the repeated use of the ncaa reporter gene + OTS (o-aars + o-tRNA + ncaa).

[0090] Figure 6.1 shows the estimated expression level of the target protein with unnatural amino acids based on protein factory-OTS.

[0091] Figure 6.2 shows the purified target protein analyzed by SDS-PAGE and expression level estimation using ImageJ software. The grayscale value of the eGFP-ncaa-scarlet protein band is approximately 0.357 times that of the injected O-aaRs. The concentration of injected O-aaRs is known to be 1.2 mg / ml. Therefore, the expression level of the eGFP-ncaa-scarlet protein can be calculated to be approximately 0.43 mg / ml.

[0092] FIG7 shows the mass spectrometry analysis results of proteins labeled with non-natural amino acids. The mass spectrometry analysis results show that the relative content of proteins labeled with non-natural amino acids is 99.81%.

[0093] FIG8 shows the fluorescence values ​​of purified proteins tagged with unnatural amino acids.

[0094] FIG9 shows the concentration (mg / ml) of the purified protein estimated by the BCA standard curve, and the total amount of expressed protein inferred by the fluorescence value of the purified protein.

[0095] Figure 10 shows the results of click chemistry labeling of a POCK-inserted reporter gene. The purified reporter protein was reacted with azide-CY5 in a click chemistry experiment. Fluorescence images show that the target protein was labeled with red fluorescence after the reaction. A is a dye-stained image, B is a fluorescence image. 1 and 3 represent denatured samples after labeling, 2 and 4 represent non-denatured samples after labeling, and 5 represents a denatured sample before labeling. The red color represents the CY5 protein (610 nm), and the blue represents the GFP protein (435 nm).

[0096] Figure 11 shows the ncaa dual-site insertion gene constructed by the present invention, which mutates the Y codon at position 151 of GFP to TAG to detect the insertion of unnatural amino acids. The first insertion site is located between two tags (8*His tag) and (3*Flag), at the N-terminus of the entire GFP protein, and has little effect on the structure and fluorescence intensity. The second insertion site is 151Try. Based on the structure of EGFP, 151Try is located outside the barrel structure, which is presumably less influential. Sequencing results indicate that the mutation is consistent with expectations.

[0097] FIG12 shows the structure and effect diagram of the protein synthesized by the present invention with double insertion of NCAA.

[0098] Figure 13 shows the ncaa triple insertion gene constructed according to the present invention, with K selected at position 2 for the third insertion site. The third unnatural amino acid was inserted at 105Tyr, also located outside the EGFP barrel, without affecting fluorescence. Sequencing results confirmed that the mutations were correct, consistent with the intended design.

[0099] Figure 14 shows fluorescence images of proteins synthesized by gene insertion at three sites of the ncaa gene. Figure 1 shows the expression supernatant of a GFP gene with three TAG sites (3 sites) in a cell-free in vitro orthogonal translation system (MW = 35 kDa); Figure 2 shows the expression supernatant of a TEV enzyme-TEV cleavage site (with a TAG mutation)-EGFP gene fusion (MW = 58.5 kDa). This construct contains a non-natural amino acid insertion site. Only when the non-natural amino group is inserted into the synthesized polypeptide chain can GFP be expressed, exhibiting green fluorescence. Furthermore, due to the non-natural amino acid mutation in the TEV cleavage site, it cannot be recognized by TEV, resulting in a fusion protein with a molecular weight of 58.5 kDa. Figure 3 shows sample 1 after Ni column purification; and Figure 4 shows sample 2 after Ni column purification. These results demonstrate that a GFP gene with three TAG stop codons can also be expressed in a cell-free in vitro orthogonal translation system. The TEV-tagged fusion protein also demonstrates that TAG can introduce non-natural amino acids into protein polypeptide chains. DETAILED DESCRIPTION

[0100] After extensive and in-depth research, including extensive screening and exploration, a reaction system was unexpectedly discovered for the first time to improve the efficiency of protein synthesis containing unnatural amino acids. In an in vitro synthesis system using Kluyveromyces lactis cells, the efficiency of inserting a single unnatural amino acid (POCK, or Pock, or pock, also known as the compound Proclys) into a standard protein (eGFP) reached 99.81%. After incorporation of this POCK, the target protein expression level reached 0.43 mg / ml. Furthermore, experiments further confirmed that proteins containing unnatural amino acids can be modified by click chemistry.

[0101] The purpose of the present invention is to establish a system for in vitro translation and site-specific modification of proteins in eukaryotic cells. The basic technical approach is to incorporate a bioorthogonal translation system (OTS) into the Protein Factory system. The OTS comprises non-canonical aminoacyl-tRNA synthetases (O-aaRs) that use non-natural amino acids (ncAAs) as substrates, and O-tRNAs recognized by the ncaaRSs. The O-tRNAs bind bioorthogonally to the cell's natural aminoacyl-tRNA synthetases and cannot be used as substrates for aminoacylation. O-aaRs can specifically catalyze the aminoacylation reaction between O-tRNA and ncAA. Typically, the anticodon of the O-tRNA is modified to pair with the amber stop codon (TAG), allowing the naturally terminated mRNA signal to be recognized and translated into non-natural amino acids. The chemically active groups of these non-natural amino acids can further form covalent bonds with probe molecules or other molecules through click chemistry to achieve specific modification of the target protein.

[0102] In the following examples, the (i.e. POCK) is used as a representative of NCAA, but the NCAA in this application is not limited to referring only to POCK.

[0103] "The expression system of the present invention", "the in vitro expression system of the present invention", "the in vitro cell-free expression system", and "the in vitro cell-free expression system" are used interchangeably and all refer to the in vitro protein expression system of the present invention. Other descriptions may also be used, such as: in vitro protein synthesis system, in vitro protein synthesis system, cell-free system, cell-free system, cell-free protein synthesis system, cell-free in vitro protein synthesis system, in vitro cell-free protein synthesis system, in vitro cell-free synthesis system, CFS system (cell-free system), CFPS system (cell-free protein synthesis system), etc. According to the reaction mechanism, it may include an in vitro translation system (which may be abbreviated as an IVT system, a mR2P system), an in vitro transcription-translation system (which may be abbreviated as an IVTT system, a D2P system), an in vitro replication-transcription-translation system (which may be abbreviated as an IVDTT system, a D2P system), etc. In the present invention, the IVTT system is preferred. We also refer to the in vitro protein synthesis system as a "protein synthesis factory" ("Protein Factory" or "proteinfactory" or "protein factory"). The in vitro protein synthesis system provided by the present invention adopts an open description method for its components.

[0104] The final concentrations of the components in the Protein Factory of the present invention are: 80% (v / v) Kluyveromyces lactis extract, 15mM glucose, 320mM maltodextrin (measured in molar concentration of glucose monomers), 24mM tripotassium phosphate, 1.8mM nucleoside triphosphate mixture (a mixture of adenosine triphosphate, guanosine triphosphate, cytosine triphosphate and uridine triphosphate, with the final concentration of each nucleoside triphosphate being 1.8mM), 0.7mM amino acid mixture (glycine triphosphate, guanosine triphosphate, cytosine triphosphate and uridine triphosphate), 1.8mM urea nitrogen mixture, ... , alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine and histidine, the final concentration of each amino acid is 0.7mM), magnesium L-aspartate, 80mM potassium acetate, 2% (w / v) polyethylene glycol 8000, 9.78mM pH 8.0 Tris·HCl buffer, 6% (w / v) trehalose. Wherein, the lactic acid Kluyveromyces extract includes endogenously expressed T7 RNA polymerase. The preparation process of the lactic acid Kluyveromyces cell extract adopts conventional technical means and is prepared with reference to the method described in CN109593656A. In summary, the preparation steps include: providing an appropriate amount of raw materials of fermented lactic acid Kluyveromyces cells, quick-freezing the cells with liquid nitrogen, breaking the cells, and collecting the supernatant by centrifugation to obtain a cell extract. The protein concentration in the obtained Kluyveromyces lactis cell extract is 20-40 mg / mL.

[0105] Example 1: Purification of MaPylRs protein

[0106] 1.1 Construction of MaPylRS pET28a plasmid

[0107] The PylRSs (pyrrolysyl-tRNA synthetase) from Candidatus Methanomethylophilus alvus (Anaerobic Ammonium Oxidizing Methanol Methylophilus alvus), gene sequence number WP_015505008, was synthesized (Bioengineering) and cloned into the Escherichia coli expression vector pET28a at the NcoI / BamHI site (see Figure 1).

[0108] 1.2 MaPyLRs induced expression: pET28a-MaPylRs plasmid was transformed into Escherichia coli competent cells BL (DE3) cells.

[0109] Single clones of cells were picked and cultured overnight in 100 ml of LB medium containing 50 mg / ml kanamycin. For expansion, 1000 μl of the above culture medium was added to 1 L of LB medium containing 50 mg / ml kanamycin. The cells were cultured overnight at 37°C. When the bacterial density reached OD600 = 0.6, IPTD was added at a final concentration of 0.2 mM and the cells were transferred to 16°C for further 20 hr.

[0110] 1.3 MaPyLRs Purification: After induced expression, cells were collected by centrifugation, disrupted with a high-pressure homogenizer, and centrifuged at 12,000 rpm to remove the precipitate. The supernatant was purified using HisTrp FF (GE). The equilibration buffer, Buffer A, consisted of 25 mM TrisHCl (pH 7.6), 20 mM imidazole, and 5% glycerol. Elution buffer, Buffer B, consisted of 25 mM TrisHCl (pH 7.6), 250 mM imidazole, and 5% glycerol. Gradient elution was performed according to standard purification procedures.

[0111] 1.4 MaPyLRs Concentration: Combine the eluted proteins and concentrate them using ultrafiltration centrifugal concentrators (Millipore). After concentration, dialyze the sample against Buffer A overnight.

[0112] 1.5 Quantify protein concentration using the BCA method.

[0113] Obtained MaPylRS

[0114] Example 2: tRNA Pyl CUA In vitro transcription

[0115] 2.1 Construction of pET28a-tRNA Pyl CUA plasmids

[0116] tRNA pyl CUA Gene sequence: Genebank number: CP017686.1 The target fragment was amplified by PCR, GGGGGACGGTCCGGCGACCAGCGGGTCTCTAAAACCTAGCcAGCGGGGTTCGACACCCCGGTCTCTCGcca (SEQ ID No: 2)

[0117] Connected to the downstream of T7 promoter in PET28a vector (see Figure 2).

[0118] Example 3: Construction of single site incorporation reporter gene

[0119] Using pD2P8His-EGFP as a template, we first inserted a stop codon (TAG) and a Flag tag between the 8His tag and the reporter gene via PCR. Secondly, we replaced the 8His tag in the original template with a Stag tag to stabilize the reporter gene, ultimately constructing the reporter gene shown in Figure 3.

[0120] Primers:

[0121] Insert TAG-Flag tag:

[0122] Primer1:ACCACCACCACGGTTAGGTGGGGACTACAAGGATCACGACG(SEQ ID No:3)

[0123] Primer2:ctccatggctGGATCCCTTATCGTCGTCATCCTTGTAATCG(SEQ ID No:4)

[0124] Corresponding vector PCR primers:

[0125] primer3:TTGTAGTCCCCACCCTAACCGTGGTGGGTGGTGGTG(SEQ ID No:5)

[0126] Primer4:TACAAGGATGACGACGATAAGGGATCCagccatggaggaag(SEQ ID No:6)

[0127] Insert the stag tag and replace the 8His tag:

[0128] Primer5:ACTCTGGTAAGaaggaaaccgctgctgctaaattcgaacgccagc(SEQ ID No:7)

[0129] Primer6:CCCCACCCTAACCgctgtccatgtgctggcgttcgaatttagcagc(SEQ ID No:8)

[0130] Corresponding vector PCR primers:

[0131] Primer 7:cagcggtttccttCTTACCAGAGTGAGAGAAGATAGATCT

[0132] GAATGG (SEQ ID No: 9)

[0133] Primer 8:cgccagcacatggacagcGGTTAGGGGTGGGGACTACAAGGATCAC(SEQ ID No:10)

[0134] The sequence of the reporter gene finally obtained is: SEQ ID No: 11.

[0135] Example 4: Insertion of unnatural amino acids (Pock) into the EGFP polypeptide chain

[0136] Cell-free in vitro translation conditions:

[0137] Protein Factory is dissolved in ddH2O.

[0138] 1ml protein factory

[0139] 10ul 500mM pock (final concentration 5mM)

[0140] 20uM MaPylRs (final concentration)

[0141] 20 μM tRNA pyl CUA (Final concentration)

[0142] Target gene template PCR product 30ul

[0143] 28℃, react overnight

[0144] Obtain the target protein.

[0145] Example 5: Testing the insertion efficiency and authenticity of unnatural amino acids

[0146] To detect the insertion efficiency and authenticity of unnatural amino acids, we designed two dual-fluorescence reporter genes (Figure 4).

[0147] The read-through efficiency of the stop codon for the introduction of unnatural amino acids is expressed by RRE (relative read-through efficiency): wherein: rfp(TAG+ncaa), rfp(positive control): represent the expression levels of the TAG reporter gene added to the orthogonal translation system and the C-terminal fluorescent protein of the positive control group (natural amino acids), respectively; gfp(TAG+ncaa), gfp(positive control): represent the expression levels of the TAG reporter gene added to the orthogonal translation system and the N-terminal fluorescent protein of the positive control group (natural amino acids), respectively.

[0148] The closer the RRE is to 1, the closer the efficiency of the unnatural amino acid insertion is to that of the natural amino acid. The maximum mistranslation frequency (MMF) of the natural amino acid at the target site in the product is expressed.

[0149] Correspondingly, the proportion of unnatural amino acids at this site is 1-MMF.

[0150] Ideally, when no unnatural amino acids are added, the expression of the C-terminal fluorescent protein is zero, that is, RRE(TAG-ncaa) = 0. Therefore, the closer the MMF is to 0, the higher the ratio of unnatural amino acids introduced, and only the expected unnatural amino acids are inserted at the specific site of the target protein.

[0151] Experimental results:

[0152] Adding OTS to the protein factory enables read-through of the stop codon

[0153] 1. Only after adding the complete OTS can the scarlet (red) behind the ncaa-reporter TAG codon be successfully translated and expressed. As shown in Figure 5, the cell supernatant turns from green to red (ETC sample in Figure 5), so this process is specific.

[0154] The protein factory-OTS-based target protein expression level estimation (Figure 6.1) was used. After purification, the target protein was subjected to SDS-PAGE electrophoresis and expression levels were estimated using ImageJ software (Figure 6.2). The grayscale value of the eGFP-ncaa-scarlet protein band was approximately 0.357 times that of the input O-aaRs. The concentration of the input O-aaRs was known to be 1.2 mg / ml. Therefore, the expression level of the eGFP-ncaa-scarlet protein was 0.43 mg / ml.

[0155] The mass spectrometry analysis results of the proteins labeled with non-natural amino acids showed that the relative content of the proteins labeled with non-natural amino acids was 99.81% ( FIG. 7 ).

[0156] After protein purification, the yield of unnatural amino acids incorporated into protein was determined by the BCA method to be 278 μg / ml ( FIG8 and FIG9 ).

[0157] Example 5: Application of click chemistry modification of proteins containing unnatural amino acids

[0158] (1) Preparation of stock solution:

[0159] 1. 20 mM CuSO4: Dissolve 31 mg CuSO4 in 10 ml sterile ddH2O, aliquot, and store at -20°C.

[0160] 2. 50 mM THPTA: 1 mg THPTA (cas 760952-88-3sigma) dissolved in 46 μl ddH2O and stored at -20°C;

[0161] 3. 100 mM BTTAA: 4.3 mg BTTAAHY-100486MCE, dissolved in 100 μl DMSO, stored at -20°C;

[0162] 4. 1mM Cy5-azide, 1mg Cy5-azide (Sigma-Aldrich 777323) dissolved in 1ml DMSO, protected from light, kept at -20℃:

[0163] 5.100mM aminoguaidin (CAS No. 1937-19-5 Sigma-Aldrich) Dissolve 0.11g aminoguaidin in 10ml ddH2O and store in aliquots at -20℃.

[0164] 6. Dissolve 0.198 g of 100 mM Sodium L-ascorbate (Sigma-Aldirich A7631) in 10 ml of ddH2O and store in aliquots at -20°C.

[0165] (2) Experimental method 1:

[0166] 1. Prepare CuSO4-THPTA premix:

[0167] 10ul 20mM CuSO4

[0168] 20ul 50mM THPTA

[0169] mix

[0170] 2. Prepare the reaction solution:

[0171] 200ul purified protein with unnatural amino acids, concentration ≈30uM

[0172] 120ul 1mM cy5-azide

[0173] 9ul CuSO4-THPTA premix

[0174] 30ul 100mM Aminoguaidin (cas1937-19-5 Yinokai)

[0175] 220ul PBS

[0176] 30ul 100mM Sodium L-ascorbate (CAS 134-03-2 Biotechnology)

[0177] Add in order, mix gently and seal.

[0178] Incubate at 4°C in the dark, place on a shaker, and allow to react overnight.

[0179] (3) Verification

[0180] A click chemistry experiment was performed using purified proteins containing unnatural amino acids and reacting them with Cy5-azide. Fluorescence images show that the target protein is labeled with red fluorescence after the reaction. However, the native sample shows that some protein remains unlabeled (see Figure 10). This demonstrates that proteins containing unnatural amino acids can be chemically modified by reacting with Cy5-azide via click chemistry.

[0181] Example 6

[0182] Construction of dual-site incorporation reporter gene

[0183] Primer 9: TAG2F: (SEQ ID No: 12)

[0184] Primer 10: TAG2R: (SEQ ID No: 13)

[0185] Primer 11: (SEQ ID No: 14)

[0186] TAG151F:AACTCTCACAACGTTTAGATCACCGCTGACAAGCAAAAGAACG

[0187] Primer 12: TAG151R: (SEQ ID No: 15)

[0188] PCR amplification was performed using the DNA sequence of pD2PeGFP (SEQ ID No: 16) as a template. After ligation and transformation, a single clone was picked and sequenced.

[0189] First, construct a single site to insert the reporter gene:

[0190] (1) PCR amplification using Novozymes Max Super-Fidelity DNA Polymerase Kit was used for amplification.

[0191] PCR reaction system:

[0192] PCR reaction procedure:

[0193] The correctness of the molecular weight of PCR products was detected by electrophoresis.

[0194] (2) PCR product ligation:

[0195] 10 μl of the vector and the inserted PCR amplification product were taken separately, mixed, and 1 μl of DpnI (NEB R0176S) was added and incubated at 37°C for 15 min.

[0196] (3) Transformation of ligation products,

[0197] Add 3 μL of the ligation product to 30 μL of competent DH5α cells (Weidi Biotech DL1001), incubate on ice for 30 minutes, then at 42°C for 45 seconds. Add 200 μL of LB medium and resuspend at 37°C for 1 hour. Plate the culture on an LB agar plate containing 1 μg / mL ampicillin and incubate at 37°C overnight. Single clones were selected and sent to Sangon Biotech for sequencing. Sequencing primers were T7 and T7terminal. The resulting template plasmid, pD2P-8his-egfp10 (SEQ ID No: 17), was obtained.

[0198] Next, using the above sequence-corrected plasmid as a template, PCR amplification, ligation, and transformation into DH5α competent cells were performed using the same protocol using primers 11 and 12 (TAG151R). Single clones were selected and sent to Sangon Biotechnology for sequencing. This yielded a reporter gene plasmid with the correct sequence and dual insertion sites.

[0199] Example 7 Synthesis of target protein with dual-site incorporation of reporter gene

[0200] 7.1 Plasmid template amplification: After culturing the correctly sequenced bacteria overnight, the plasmid was extracted using a small amount of plasmid extraction kit;

[0201] 7.2 Amplification of target gene

[0202] Primer 13, PD2PF: GGTGATGTCGGCGATATAGGCGCC (SEQ ID No: 18)

[0203] Primer 14, PD2PR: TGCTCAGCGGTGGCAGCAGCCAAC (SEQ ID No: 19)

[0204] After PCR amplification, the product can be directly used for protein translation in cell-free system without purification and concentration.

[0205] 4.3 Insertion of unnatural amino acids (Pock) into two sites of the EGFP polypeptide chain in a cell-free system

[0206] In vitro translation conditions:

[0207] Protein Factory is dissolved in ddH2O.

[0208] 1mL protein factory

[0209] 10 μL 500 mM pock (final concentration 5 mM)

[0210] 20uM MaPylRs (final concentration)

[0211] 20 μM tRNA pyl CUA (Final concentration)

[0212] Target gene template PCR product 30 μL

[0213] 28℃, react overnight

[0214] The target protein was obtained, see Figure 11.

[0215] Example 8 Construction of three-site incorporation reporter gene

[0216] The codons at three sites of GFP were mutated.

[0217] Using the double-site insertion reporter gene as a template, Thr at position 105 of EGFP was mutated to the stop codon TAG.

[0218] Primers:

[0219] Primer 15 105TAGF:

[0220] Primer 16 105TAGR: (SEQ ID No: 21)

[0221] The PCR reaction and ligation product transformation procedures were the same as in Example 3 to obtain a three-point mutation template sequence (SEQ ID No: 1).

[0222] Example 9 Synthesis of a target protein with three-site reporter gene incorporation

[0223] 6.1 Insertion of unnatural amino acids into three sites of GFP protein was achieved in a cell-free system.

[0224] In vitro translation conditions:

[0225] Protein Factory is dissolved in ddH2O.

[0226] 1ml protein factory

[0227] 10 μL 500 mM pock (final concentration 5 mM)

[0228] 20 μM MaPylRs (final concentration)

[0229] 20 μM tRNA pyl CUA (Final concentration)

[0230] Target gene template PCR product 30 μL

[0231] Incubate overnight at 28°C to synthesize a target protein with three reporter gene sites (see Figure 13).

[0232] Example 10 Further verification experiments of non-natural amino acid insertion into proteins.

[0233] 1. The expression product after the introduction of non-natural amino acids (Examples 7 and 9) was centrifuged at 15000 rpm for 15 min. The supernatant was collected and 100 μl of His Monster Beads (Kangma PROTN_HMBN1V00001) was added and incubated at 4°C for 30 min. The beads were adsorbed on a magnetic stand and washed three times with wash buffer: 50 mM Tris-HCl pH 8.0, 500 mM NaCl, 20 mM Imidazole. Finally, the sample was eluted with 50 μL of elution buffer: 50 mM Tris-HCl pH 8.0, 500 mM NaCl, 250 mM Imidazole.

[0234] The sample was divided into two equal parts. One part was added with 1 / 10 volume of DNA loading buffer. The other part was added with 1 / 4 volume of 5* SDS-PAGE loading buffer and incubated at 95°C for 5 min. These two parts served as the denatured and native samples, respectively. Separation was performed by electrophoresis using an 8-16% gradient precast gel (Wansheng Haotian, GSH2001-816T). After electrophoresis of the native sample, the expression of EGFP protein was confirmed using the Cy3 channel in fluorescence mode on a gel imager.

[0235] Denatured samples were electrophoresed and stained with Coomassie Brilliant Blue, then decolorized. Bands with the correct molecular weight were cut out and subjected to LC-MS / MS mass spectrometry, which confirmed the insertion of the unnatural amino acid ( FIG. 12 and FIG. 13 ).

[0236] 2. Further verification of the effect of the three-site insertion is shown in Figure 6, which shows fluorescence images of proteins synthesized by the three-site insertion of the ncaa gene. Figure 1 shows the expression supernatant of a GFP gene with three TAG sites (3 sites) in a cell-free in vitro orthogonal translation system (MW = 35 kDa); Figure 2 shows the expression supernatant of a TEV enzyme-TEV cleavage site (with a TAG mutation)-EGFP gene fusion (MW = 58.5 kDa). This construct contains an insertion site for an unnatural amino acid. Only when the unnatural amino group is inserted into the synthesized polypeptide chain can GFP be expressed, exhibiting green fluorescence. Furthermore, due to the unnatural amino acid mutation in the TEV cleavage site, TEV cannot recognize it, resulting in a fusion protein with a molecular weight of 58.5 kDa. Figure 3 shows sample 1 after Ni column purification; and Figure 4 shows sample 2 after Ni column purification. These results demonstrate that a GFP gene with three TAG stop codons can also be expressed in a cell-free in vitro orthogonal translation system. The TEV-tagged fusion protein also demonstrates that TAGs can introduce unnatural amino acids into protein polypeptide chains.

Claims

1. An in vitro cell-free protein synthesis system for inserting unnatural amino acids, characterized in that: The reaction system comprises: (1) Cell extracts; (2) Unnatural amino acids; (3) an exogenous orthogonal aminoacyl-tRNA synthetase / orthogonal tRNA pair; and (4) a template comprising a target protein gene sequence, wherein at least one amino acid encoding codon in the target protein gene sequence is mutated to a stop codon.

2. An in vitro cell-free protein synthesis system for inserting unnatural amino acids according to claim 1, characterized in that: The stop codon is TAG.

3. An in vitro cell-free protein synthesis system for inserting unnatural amino acids according to claim 1 or 2, wherein the cell extract is preferably selected from any one of the following sources: Escherichia coli, yeast cells, mammalian cells, plant cells, insect cells, or a combination thereof; the yeast cell is preferably selected from Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia akoclamae, Pichia membranaefaciens, Pichia microti (Ogataeaminuta, Pichia lindneri), Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia g uercuum), Pichia apijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Hansenula polymorpha, Kluyveromyces, Kluyveromyces lactis, Kluyveromyces marxianus, Kluyveromyces marxianus var. lactis, Kluyveromyces marxianus var. marxianus, Kluyveromyces marxianus var.vanudenii, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus, Kluyveromyces siamensis, Kluyveromyces yarrowii, or a combination thereof.

4. An in vitro cell-free protein synthesis system for inserting unnatural amino acids according to any one of claims 1 to 3, wherein the unnatural amino acid has a structural formula of compound (I): Wherein n is selected from a natural number of 1-20, R1 is selected from a substituted or unsubstituted C5-C60 aryl or heteroaryl, a substituted or unsubstituted C1-C20 alkyl, a substituted or unsubstituted C2-C20 alkenyl or a substituted or unsubstituted C2-C20 alkynyl, and A is selected from O or -CH2-.

5. An in vitro cell-free protein synthesis system for inserting non-natural amino acids according to claim 4, wherein n is selected from a natural number of 1-10, and R1 is selected from a substituted or unsubstituted C2-C20 alkenyl or a substituted or unsubstituted C2-C20 alkynyl; preferably, n is selected from a natural number of 1-6, and R1 is selected from a substituted or unsubstituted C2-C10 alkenyl or a substituted or unsubstituted C2-C10 alkynyl; further preferably, R1 is selected from a substituted or unsubstituted C2-C6 alkynyl.

6. An in vitro cell-free protein synthesis system for inserting unnatural amino acids according to claim 4 or 5, wherein the structural formula of the unnatural amino acids is selected from one or a combination of the following:

7. An in vitro cell-free protein synthesis system for inserting unnatural amino acids according to any one of claims 1 to 6, wherein the exogenous orthogonal aminoacyl-tRNA synthetase is selected from natural or mutant Pyl-tRNA synthetase (PylRS), Leu-tRNA synthetase (LeuRS), Tyr-tRNA synthetase (TyrRS), Phe-tRNA synthetase (PheRS) or TrP-tRNA synthetase (TrpRS); the tRNA is selected from natural or mutant tRNA Pyl , tRNA Leu tRNA Tyr、 tRNA Phe or tRNA Trp .

8. An in vitro cell-free protein synthesis system for inserting unnatural amino acids according to any one of claims 1 to 7, wherein the exogenous orthogonal aminoacyl-tRNA synthetase is selected from natural or mutant MaPylRS, MmPylRS, MbPylRS, EcTyrRS, MjTyrRS, EcLeuRS, ScPheRS, ScTrpRS, BsTrpRS; preferably MaPylRS.

9. An in vitro cell-free protein synthesis system for inserting unnatural amino acids according to any one of claims 1 to 8, wherein the target protein is selected from luciferin, luciferase, green fluorescent protein, yellow fluorescent protein, red fluorescent protein, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable region of an antibody, luciferase mutation, α-amylase, enterobactin A, hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, interleukin-1β, lysozyme, serum albumin, single-chain antibody fragment (scFV), thyroxine transporter, tyrosinase, xylanase, or a combination thereof.

10. An in vitro cell-free protein synthesis system for inserting unnatural amino acids according to any one of claims 1 to 9, further comprising: The system further comprises one or more components selected from the group consisting of a buffer, potassium ions, magnesium ions, polyethylene glycol, an optional aqueous solvent, and phosphate.

11. The in vitro cell-free protein synthesis system for inserting unnatural amino acids according to claim 10, further comprising one or more of the following features: (1) The v / v ratio of the cell extract to the reaction system is 20 to 80%; (2) further comprising polyethylene glycol, wherein the polyethylene glycol has a (w / v) ratio of 0.1-8% relative to the reaction system, preferably 0.5-4%, more preferably 1-2%; (3) The concentration of the exogenous orthogonal aminoacyl tRNA synthetase relative to the reaction system is in the range of 0.001 to 1 mmol / L, preferably 0.005 to 0.1 mmol / L, and more preferably 0.005 to 0.05 mmol / L; (4) The concentration range of the orthogonal tRNA relative to the reaction system is 0.001 to 1 mmol / L, preferably 0.005 to 0.1 mmol / L, and more preferably 0.02 to 0.1 mmol / L.

12. A kit, characterized in that: The kit contains the reaction system according to any one of claims 1 to 11.

13. A method for synthesizing a protein containing unnatural amino acids using an in vitro cell-free system, which is prepared using the synthesis system according to any one of claims 1 to 11 or the kit according to claim 12.

14. Use of the system according to any one of claims 1 to 11 or the kit according to claim 12 in synthesizing proteins containing unnatural amino acids.

15. A protein containing unnatural amino acids, which is prepared by the synthesis system according to any one of claims 1 to 11, the kit according to claim 12, or the method according to claim 13.

16. Use of the protein containing non-natural amino acids according to claim 15 in click chemistry modification.

Images