Gene editing system based on mRNA splicing reconstruction and non-homologous end connection repair
By using alternative splicing design in gene editing, Cas9 and sgRNA are introduced upstream of the target repair site, and combined with the NHEJ pathway, efficient and universal gene editing is achieved, solving the problems of low efficiency and poor versatility in the existing technology, ensuring the correct expression of the target protein and cell screening efficiency.
Patent Information
- Application Number
- CN202510341816.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2025-07-29
AI Technical Summary
The existing gene editing technology is inefficient and difficult to be versatile. Especially in the case of genomic mutations in different individuals, the development of existing sgRNA and homologous templates hinder the development of gene therapy, and the HDR repair efficiency is low, making it difficult to achieve accurate repair.
Using the principle of alternative splicing, sgRNA was designed upstream of the 5' of the intended repair site, Cas9, sgRNA and donor template DNA containing sgRNA recognition sequences, new splice acceptor sites, CDS and polyA tail sequences downstream of the corresponding gene, and DSB was inserted through the NHEJ pathway to destroy and replace the original genomic sequences, and use endogenous promoters to achieve the correct expression of the target protein.
It improves the efficiency and versatility of gene editing, can produce DSB in introns, reduces the risk of gene knockout caused by HDR repair, maintains the correct expression of target proteins, reduces the risk of random insertion of exogenous genes, and improves cell screening efficiency.
Smart Images

Figure CN120381535A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering and relates to a gene editing system based on mRNA splicing reconstruction and non-homologous end joining repair. Background Art
[0002] Gene editing is a powerful tool for biomedical research and the development of disease therapies. Since the discovery and application of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas system in the field of gene editing, it has become one of the most efficient and popular gene editing tools. The CRISPR-Cas complex can precisely bind and cleave genomic DNA, thereby generating double-stranded DNA breaks (DSBs). Further, the DSBs can be repaired through the non-homologous end joining (NHEJ) pathway, resulting in imprecise repairs such as insertions or deletions (Indels), which in most cases inactivate genes by disruption. Alternatively, the homologous recombination repair (HDR) pathway can use homologous template dsDNA or ssDNA to precisely repair the DSBs, thereby achieving the editing of target genes.
[0003] More than 10,000 human diseases are caused by mutations in single genes, and targeted repair of the corresponding endogenous genes is considered one of the best gene therapy strategies. Most of the previous precise gene editing strategies relied on the HDR pathway, which has low efficiency and highly depends on the protospacer adjacent motif (PAM) sequence near the site to be edited and the cleavage efficiency of the single guide RNA (sgRNA) determined by it. For genomic variations carried by different individuals, it is necessary to develop specific sgRNAs and homologous templates, which greatly hinders the development of related treatment methods. Therefore, there is an urgent need for a gene editing system and method with high efficiency, high versatility and easy editing at present.
[0004] Alternative splicing is a naturally occurring mechanism in cells that regulates gene expression and generates proteome diversity. In the nucleus, precursor mRNA removes introns through splicing and splices adjacent exons into mature mRNA. Important components in the splicing process include the trans-acting element spliceosome and the cis-acting elements 5' splice site (5'SS, also known as the splice donor site, SD site), 3' splice site (3'SS, also known as the splice acceptor site, AC site), and branch site. The core reason for alternative splicing is that the selection efficiency of different splice sites varies under different cellular states, with competition and balance existing. When the core motif of the splice site changes, it may disrupt the old splice site or form a new splice site, thereby affecting normal splicing and leading to the production of abnormal mRNA. However, there has been no relevant report on effectively using alternative splicing for gene editing yet. Summary of the Invention
[0005] The object of the present invention is to overcome the deficiencies of the prior art and provide a gene editing system based on mRNA splicing reconstruction and non-homologous end joining repair. The present invention utilizes the principle of alternative splicing and designs sgRNA on a suitable intron upstream of the 5' of the site to be repaired. When performing gene editing on cells, Cas, sgRNA, and donor template DNA containing the sgRNA recognition sequence, a new splice acceptor site, the downstream CDS of the corresponding gene, and the polyA tail sequence are simultaneously introduced. Through the more efficient NHEJ pathway, rather than the HDR pathway, the donor template DNA is inserted into the corresponding DSB, disrupting and replacing the original downstream genomic sequence. Finally, using the original endogenous promoter, the edited new target protein can be correctly expressed.
[0006] The object of the present invention can be achieved through the following solutions:
[0007] In a first aspect, the present invention provides a gene editing system based on mRNA splicing reconstruction and non-homologous end joining repair, comprising the following modules:
[0008] The Cas9 protein and sgRNA expression module, which includes a Cas9 protein expression cassette and an sgRNA expression cassette; wherein, the Cas9 protein expression cassette contains an RNA polymerase II promoter and a Cas9 gene sequence; the sgRNA expression cassette contains an RNA polymerase III promoter and an sgRNA sequence;
[0009] The donor module, which includes an sgRNA recognition sequence, a splicing reconstruction cassette, and a polyA tail transcription termination sequence; wherein, the splicing reconstruction cassette contains a splicing sequence of the 3' splice acceptor site, a complete CDS sequence composed of a fragment to be replaced and a downstream exon.
[0010] As an embodiment of the present invention, the RNA polymerase II promoter includes the CBh promoter, and the RNA polymerase III promoter includes the U6 promoter.
[0011] As an embodiment of the present invention, the Cas9 gene sequence is as shown in SEQ ID NO.1.
[0012] As an embodiment of the present invention, the design strategy of the sgRNA sequence includes: selecting an sgRNA target sequence in the intron upstream of the 5' of the site to be repaired, and designing and synthesizing the sgRNA sequence; the 3' end of the sgRNA target sequence has a protospacer adjacent motif (PAM) sequence (5'-NGG-3'). Preferably, the sgRNA target site is within 20-200 bases from the 3' edge of the intron.
[0013] In some embodiments, the sgRNA sequence is as shown in SEQ ID NO.2.
[0014] In the present invention, the Cas9 protein and sgRNA expression module can express Cas9 and sgRNA, and the sgRNA binds to the Cas9 protein and guides it to the target sequence to form double-stranded DNA cleavage.
[0015] As an embodiment of the present invention, the sgRNA recognition sequence is a sequence that matches the sgRNA sequence. The sgRNA recognition sequence matches the sgRNA sequence and is located upstream of other elements, so that the donor plasmid can be cleaved and linearized by the complex formed by Cas9 and sgRNA.
[0016] As an embodiment of the present invention, the splicing sequence of the 3' splice acceptor site is the (classical) AG motif at the 3' end. A simple method to obtain the sgRNA recognition site and the 3' splice acceptor site sequence in the donor module is to directly use the sequence of the intron upstream of the 5' of the endogenous site to be repaired, including all bases from the sgRNA recognition site to the intron / exon boundary.
[0017] Furthermore, the sgRNA recognition sequence and the splicing sequence of the 3' splice acceptor site are as shown in SEQ ID NO.3.
[0018] As an embodiment of the present invention, the sgRNA recognition sequence and the 3' splice acceptor site sequence in the donor module are amplified from the target cell gDNA.
[0019] As an embodiment of the present invention, the complete CDS sequence composed of the fragment to be replaced and the downstream exon is an unmutated sequence amplified from the normal target cell cDNA.
[0020] In some embodiments, the complete CDS sequence composed of the fragment to be replaced and the downstream exon is shown in SEQ ID NO.4.
[0021] As an embodiment of the present invention, the polyA tail transcription termination sequence includes the SV40 polyA signal sequence shown in SEQ ID NO.5. The PolyA tail transcription termination sequence (polyadenylate tail) is used to ensure transcription termination.
[0022] As an embodiment of the present invention, the donor module further comprises a screening cassette, and the screening cassette is a fluorescent protein gene and / or a resistance gene linked by a 2A peptide. The screening cassette is used for screening cells with correct insertion.
[0023] Further, the fluorescent protein gene includes the enhanced green fluorescent protein (EGFP) gene shown in SEQ ID NO.6; the resistance gene includes the BSD resistance gene shown in SEQ ID NO.7.
[0024] Further, if the screening cassette element is used, the stop codon of the complete CDS sequence composed of the fragment to be replaced and the downstream exon in the splicing reconstruction cassette element needs to be removed, otherwise it does not need to be removed.
[0025] In the present invention, the elements in the donor module are sequentially and operably connected in the upstream to downstream direction. After linearization, the donor module is inserted into a specific cleavage site in the cell through the cell's inherent non-homologous end joining repair mechanism.
[0026] In the case where the donor module is inserted in the correct direction, it is expected that the exons downstream of the original gene cleavage site will no longer be transcribed. The donor module does not have a promoter sequence, and the genes in the splicing reconstruction cassette and the screening cassette are expressed only when correctly inserted and spliced and reconstructed.
[0027] In a second aspect, the present invention provides an application of the gene editing system in the preparation of a drug for gene editing.
[0028] In a third aspect, the present invention provides a gene editing method based on splicing reconstruction and non-homologous end joining repair, comprising the following steps:
[0029] S1. Cloning an RNA polymerase III promoter and an sgRNA sequence, and an RNA polymerase II promoter and a Cas9 gene sequence into a CRISPR plasmid;
[0030] S2. Cloning an sgRNA recognition sequence, a splicing sequence of a 3' splice acceptor site, a complete CDS sequence composed of a fragment to be replaced and a downstream exon, and a polyA tail transcription termination sequence into a donor vector in sequence;
[0031] Alternatively, clone the complete CDS sequence composed of the sgRNA recognition sequence, the splicing sequence of the 3' splice acceptor site, the fragment to be replaced, and the downstream exon, the fluorescent protein gene linked by 2A peptide, the resistance gene linked by 2A peptide, and the polyA tail transcription termination sequence into the donor vector in sequence; the complete CDS sequence does not contain a stop codon;
[0032] S3. Co-transfect the target cells with the CRISPR plasmid in step S1 and the donor vector in step S2 to correctly express the edited gene to be repaired.
[0033] As an embodiment of the present invention, in step S1, the CRISPR plasmid includes the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid;
[0034] In step S2, the donor vector includes the pGL3-promoter plasmid.
[0035] Compared with the prior art, the present invention has the following beneficial effects:
[0036] 1. The present invention utilizes the principle of alternative splicing to design sgRNA on a suitable intron upstream of the 5' of the site to be repaired. When performing gene editing on cells, Cas9, sgRNA, and a donor plasmid containing the sgRNA recognition site, a new splice acceptor site, the downstream CDS of the corresponding gene, and the polyA tail sequence are simultaneously introduced. Through the more efficient NHEJ pathway rather than the HDR pathway, the donor template DNA cleaved and linearized by the Cas9-sgRNA complex is inserted into the corresponding DSB, destroying and replacing the original downstream genomic sequence. Due to the polyA tail transcription termination signal on the inserted fragment, the newly generated pre-mRNA will not contain the downstream exon with mutations; the inserted fragment contains a splice acceptor site, so a splicing event occurs between the upstream exon and the inserted CDS, forming a fused mRNA. Finally, using the original endogenous promoter, the edited new target protein can be correctly expressed.
[0037] 2. Based on the design concept of splicing reconstruction, the present invention includes the position selection of sgRNA and the introduction of new splicing sites on the donor template, resulting in DSB occurring in the intron, so that the selection of the PAM sequence is no longer limited to the vicinity of the site to be edited, solving the problem that some mutation sites cannot be edited or are difficult to edit. In addition, when performing gene editing based on HDR, because the HDR efficiency is low and the position where DSB is induced usually needs to be adjacent to the editing site, most likely in the exon region, if indel occurs at this time, it often causes the knockout of the gene to be edited. However, the DSB generation site of the present invention is in the intron, and when indel occurs, it has little impact on cells.
[0038] 3. The present invention combines the use of the NHEJ fragment insertion method to improve gene editing efficiency; and in the design of the donor module in NHEJ repair, in one embodiment, it may include splicing sites, all downstream CDS and polyA tails. This design enables various different mutations in all downstream regions to be repaired by this general design method. In principle, different mutants in the downstream sequence or multiple cis mutations can be repaired in the same optimized selected system, greatly improving the versatility of this strategy. Further, a suitable screening cassette element can be added to the downstream CDS to help screen cells with correct direction insertion, significantly improving the acquisition efficiency of target cells.
[0039] 4. Compared with the gene therapy strategy of exogenous transgenic expression, the present invention can effectively utilize endogenous regulatory elements, enabling the repaired gene to maintain the spatio-temporal expression characteristics of the original gene, reducing the genomic risk of random insertion of exogenous transgenes, and reducing potential problems caused by differences in exogenous gene expression levels or time windows. BRIEF DESCRIPTION OF THE DRAWINGS
[0040] By reading the detailed description of the non-limiting embodiments with reference to the following drawings, other features, objects and advantages of the present invention will become more obvious:
[0041] Figure 1 It is a schematic diagram of the principle of a gene editing system based on splicing reconstruction and non-homologous end joining repair;
[0042] Figure 2 It is a schematic diagram showing the enrichment of human TP53 gene mutations in exon 4 and subsequent regions;
[0043] Figure 3 It is a map of the construction of the CRISPR plasmid;
[0044] Figure 4 It is a schematic diagram of the sequence of the donor vector inserted with the TP53 gene;
[0045] Figure 5Flow cytometry results of EGFP inserted into K562 cells after resistance screening;
[0046] Figure 6 Schematic diagram of the positions of the amplification primers used for identification in the sequence;
[0047] Figure 7 Gel electrophoresis image showing that the amplified fragment of the target size can be identified in the enriched cells after treatment;
[0048] Figure 8 WB results of p53 protein expression in K562 cells with the target fragment inserted by the NHEJ method;
[0049] Figure 9 IC50 of K562 repair and control cell lines against etoposide and imatinib. Detailed implementation mode
[0050] The present invention will be described in detail below in conjunction with the accompanying drawings and specific embodiments. The following examples are implemented on the premise of the technical solution of the present invention, providing detailed implementation methods and specific operation processes, which will help those skilled in the art to further understand the present invention. It should be noted that the protection scope of the present invention is not limited to the following embodiments. Several adjustments and improvements made under the premise of the concept of the present invention all fall within the protection scope of the present invention.
[0051] In the gene editing system of the present invention, the main components include the Cas9 gene sequence, an sgRNA sequence that can bind to and target the upstream intron sequence of the fragment to be replaced for cleavage, an sgRNA recognition sequence, a donor fragment that at least contains a new splice site, the fragment to be replaced, and a complete CDS sequence and polyA tail signal composed of downstream exons. As Figure 1 shown, the donor fragment is located on a general donor vector, and there is an sgRNA recognition sequence upstream of it. The sgRNA recognition sequence can match the above sgRNA sequence. When the donor vector and the sgRNA recognition sequence are transfected simultaneously, it is equivalent to transfecting a linearized insertion sequence. In vitro, through appropriate methods such as electroporation and transfection, the above components are introduced into cells simultaneously. Inside the cells, cleavage of Cas9-sgRNA and NHEJ-mediated fragment insertion occur. Subsequently, on the allele with the fragment inserted in the correct direction, splicing will be carried out using the introduced new splice site. On the one hand, it directly destroys the production of the original mRNA. On the other hand, the upstream exon is spliced with the newly inserted CDS and polyA sequences to form a new mRNA, achieving precise gene repair.
[0052] Example 1
[0053] The gene editing method (NHEJ method) of the present invention is used to repair the mutation of the tumor suppressor gene TP53, making cancer cells more sensitive to chemotherapeutic drugs.
[0054] According to the statistical data of the TP53 database, although there are hotspot mutation sites such as R175, G245, R248, R249, R273, and R282 in the TP53 gene mutation, almost the entire DNA binding domain may have mutations that affect the function of p53. Therefore, if homologous recombination is used for repair, separate sgRNAs and donor ODNs need to be designed for each mutation. On the other hand, both the hotspot mutations and the DNA domain are in exon 4 and the subsequent parts. Therefore, if the gene editing method of the present invention is used for repair, the same sgRNA and donor plasmid can be used to repair all mutations after exon 4, covering the complete DNA binding domain, which is also the part with the highest mutation rate (as Figure 2 shown). Therefore, the gene editing method of the present invention has advantages in TP53 gene repair.
[0055] The K562 cell line was selected as the cell line for verification. K562 cells are a commonly used immortalized human cell line derived from a bone marrow sample of a female patient with chronic myelogenous leukemia (CML). The K562 cells in this example were purchased from the Cell Bank of the Chinese Academy of Sciences Committee for Type Culture Collection (Catalog No.: TCHu191). The TP53 of K562 cells is homozygous for the Q136fs*13 mutation, which occurs in exon 4.
[0056] In this example, the TP53 gene intron 3 was selected, and the sgRNA target sequence was chosen in the upstream region near the boundary of exon 4. The sgRNA design strategy employed included the following: the 3' end of the target DNA sequence must contain a protospacer motif (PAM) sequence (5'-NGG-3'). The 20 nucleotides upstream of the PAM sequence constitute the targeting sequence, ensuring high sequence specificity and low off-target risk. Online sgRNA design tools such as CRISPOR (http: / / crispor.tefor.net / ) can be used to assist in design. sgRNAs with target sequences within 20-200 nt of the 3' edge of the intron are preferred. This not only facilitates the inclusion of a portion of the intron sequence during subsequent donor fragment cloning but also ensures that the sgRNA cleavage itself does not disrupt the original splice site. Assuming only the target sequence is cleaved without the donor fragment inserting, indels caused by NHEJ will have minimal impact on the original spliced donor sequence, minimizing the impact on cells. Finally, the target sequence used in this example was agagttggcgtctacacctc (SEQ ID NO. 2), which was cloned into the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid backbone (from Addgene #42230) to construct the map. Figure 3 The main plasmid skeleton contains the CBh promoter (i.e. Figure 3 The Cas9 gene sequence (as shown in SEQ ID NO. 1) controlled by the Chicken-β-actin promoter in the plasmid and the sgRNA controlled by the U6 promoter and the sgRNA scaffold (included in the plasmid) are used to cause DSB in intron3.
[0057] Then, primers were designed to amplify the C-terminal CDS sequences starting from partial intron 3 and exon 4 from the gDNA and cDNA of the cells, respectively. The partial intron 3 (i.e., the sequence containing the sgRNA recognition site and the 3'-splice acceptor site, as shown in SEQ ID NO.3) was amplified from the gDNA using the primers p53-part1-F (binding upstream of the sgRNA target sequence) and p53-part1-R (binding to the 3' end of intron 3) (the sequences are shown in SEQ ID NOs.8-9 respectively). The C-terminal CDS sequence starting from exon 4 (i.e., the complete CDS sequence TP53 partial CDS composed of the fragment to be replaced and the downstream exon, as shown in SEQ ID NO.4) was amplified from the cDNA of the Nalm6 cell line without TP53 gene mutation using p53-part2-F and p53-part2-R (shown in SEQ ID NOs.10-11 respectively). The 2A-EGFP fragment (as shown in SEQ ID NO.6) was amplified from an existing plasmid (pUC57-P2A-EGFP) using p53-part3-F and p53-part3-R (shown in SEQ ID NOs.12-13 respectively). Then, the above fragments were constructed into the donor plasmid of the pGL3-promoter (purchased from Promega) backbone digested with XhoI and XbaI by Gibson assembly. The polyA tail signal for terminating transcription is located in the vector plasmid and is the SV40 polyA signal (as shown in SEQ ID NO.5). Then, the 2A-BSD sequence (as shown in SEQ ID NO.7) was cut with BsrGI and XbaI and cloned downstream of the EGFP sequence. The schematic diagram of the final donor vector is as shown in Figure 4 shown, the sgRNA recognition sequence matches the sgRNA sequence shown in SEQ ID NO.2 above. The green fluorescent protein EGFP and the BSD resistance gene sequence are sequentially linked after the TP53 gene and are connected by P2A in the middle. Finally, the SV40 poly(A) signal ensures transcription termination.
[0058] The partial intron 3 shown in SEQ ID NO.3 (i.e., the sequence containing the sgRNA recognition site and the 3' splice acceptor site, where the underlined part represents the sgRNA recognition sequence) is TCGAGgagtgacagagcaagaccctatctcaaaaaa aaaaaaaaaaaagaaaagctcctgaggtgtagacgccaactctctctagctcgctagtgggttgcaggaggtgcttacgcatgtttgttt ctttgctgccgtcttccagttgctttatctgttcacttgtgccctgactttcaactctgtctccttcctcttcctacag.
[0059] The CRISPR plasmid and the donor vector were co-transfected into K562 cells using JetPrime transfection reagent. After 24 hours of transfection, 30 μg / mL Blasticidin was added to the medium to screen and enrich positive cells. After 5 days, K562 cells were collected, and the positive rate of EGFP was detected by flow cytometry. It was found that after resistance screening, the positive rate of EGFP-positive cells was 100%, indicating that EGFP was expressed in all cells ( Figure 5 ).
[0060] Furthermore, cells were collected to extract genomic DNA, and two pairs of primers were designed for PCR electrophoresis respectively to determine whether site-directed insertion had occurred. The NHEJ-p53-5'-F primer is located on the original genome upstream of the cleavage site, and NHEJ-p53-5'-R is located on the linearized plasmid fragment; similarly, NHEJ-p53-3'-F is located on the linearized plasmid fragment, while NHEJ-p53-3'-R is located on the original genome downstream of the cleavage site. When the linearized plasmid is inserted in the expected site and the desired direction, the two pairs of primers should amplify fragments of 1484 bp and 886 bp respectively ( Figure 6 ). The gel electrophoresis results showed the correct insertion of the target fragment ( Figure 7 , where C is the control group, T is the treatment group, Taq and FS are two different manufacturers' amplification enzymes selected, with the product numbers 10102ES03 from Yeasen Biotech and AG12206 from Aike Rui respectively).
[0061] NHEJ-p53-5'-F: tccacgtgtattccttggct (SEQ ID NO.14);
[0062] NHEJ-p53-5'-R: gctgaacttgtggccgttta (SEQ ID NO.15), the correct product size is 1484 bp;
[0063] NHEJ-p53-3'-F: TCGCCCTGATAGACGGTTTT (SEQ ID NO.16);
[0064] NHEJ-p53-3'-R: tcagtgaggaatcagaggcc (SEQ ID NO.17). The correct product size is 886 bp.
[0065] Furthermore, it was verified that in the cell line with the inserted fragment, correct splicing events could occur, enabling the correct translation of the TP53 protein. Therefore, the K562 cells after treatment were treated with 5 μM etoposide (also known as VP-16) for 8 hours to induce p53 expression. After collecting the cells, Western Blot was used to detect the p53 protein. Etoposide is a leukemia chemotherapy drug, and its mechanism of action is to induce DNA damage. This treatment helps to inhibit the degradation of wild-type rather than mutant p53 protein due to deubiquitination and can enrich wild-type p53 protein. The original K562 cells themselves are homozygous for a p53 frameshift mutation, and p53 expression cannot be detected by WB. If NHEJ successfully repairs the mutation, p53 expression can be detected, and wild-type p53 has increased stability under the condition of etoposide treatment. It is expected that WB should detect the accumulation of p53 protein. The experimental results confirmed the restoration of wild-type p53 protein expression in the treated K562 cells ( Figure 8 , its stability increased after VP16 treatment, indicating that the expressed p53 protein is wild-type; wt is the untreated K562 cell line, p53 is the K652 cell line with NHEJ insertion, and Nalm6 is a positive control cell line).
[0066] Finally, through cell proliferation experiments, it was detected that the sensitivity of K562 cells after NHEJ repair to chemotherapy drugs increased. The specific experimental method is as follows: Cells were seeded in 96-well plates, 8000 K562 cells per well, 100 μL of medium per well. After adding gradient-diluted test drugs to different wells, they were further cultured in an incubator for 72 hours. The number of cells in different wells was measured using CTG (Promega), and a cell proliferation curve for different drug concentrations was plotted based on the CTG measurement data. K562 is CML expressing the BCR-ABL fusion gene. Two commonly used drugs for CML were tested, namely the targeted drug imatinib and the chemotherapy drug etoposide. The results showed that the IC50 values of the cells after NHEJ repair for both drugs were smaller than those of the pre-repair K562 cells, indicating that the restored expression of wild-type p53 protein made the cells more sensitive to the drugs ( Figure 9 ).
[0067] In summary, in Example 1, the NHEJ method was used to repair the mutation on the tumor suppressor gene TP53 in the K562 cell line. It was demonstrated from multiple aspects such as EGFP expression, genome identification, protein expression, and drug sensitivity functional experiments that not only was the insertion of the target sequence occurred, but also correct splicing reconstruction could occur in the cells, enabling the correct expression of wild-type p53 protein in cancer cells and making them more sensitive to chemotherapy drugs.
[0068] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art can make various deformations or modifications within the scope of the claims, which do not affect the essence of the present invention.
Claims
1. A gene editing system based on mRNA splicing reconstruction and non-homologous end joining repair, characterized in that It includes the following modules: The Cas9 protein and sgRNA expression module, which contains a Cas9 protein expression cassette and an sgRNA expression cassette; among them, the Cas9 protein expression cassette contains an RNA polymerase II promoter and a Cas9 gene sequence; the sgRNA expression cassette contains an RNA polymerase III promoter and an sgRNA sequence; The donor module, which contains an sgRNA recognition sequence, a splicing reconstruction cassette, and a polyA tail transcription termination sequence; among them, the splicing reconstruction cassette contains a complete CDS sequence composed of a splicing sequence of the 3' splice acceptor site, a fragment to be replaced, and a downstream exon.
2. The gene editing system according to claim 1, wherein The RNA polymerase II promoter includes the CBh promoter, and the RNA polymerase III promoter includes the U6 promoter.
3. The gene editing system according to claim 1, characterized in that, It also includes at least one of the following technical features: The target site of the sgRNA sequence is located in the intron 5' upstream of the site to be repaired, within 20 - 200 bases from the 3' edge of the intron; The target site of the sgRNA has a protospacer adjacent motif (PAM) sequence.
4. The gene editing system according to claim 1, wherein The Cas9 gene sequence is as shown in SEQ ID NO.1; the sgRNA sequence is as shown in SEQ ID NO.
2.
5. The gene editing system according to claim 1, wherein The sgRNA recognition sequence is a sequence matching the sgRNA sequence; the splicing sequence of the 3' splice acceptor site is the AG motif at the 3' end; the sgRNA recognition sequence and the splicing sequence of the 3' splice acceptor site are as shown in SEQ ID NO.
3.
6. The gene editing system according to claim 1, wherein The complete CDS sequence composed of the fragment to be replaced and the downstream exon is as shown in SEQ ID NO.4; the polyA tail transcription termination sequence includes the SV40 polyA signal sequence as shown in SEQ ID NO.
5.
7. The gene editing system according to claim 1, wherein The donor module also contains a screening cassette, and the screening cassette is a fluorescent protein gene and / or a resistance gene linked by a 2A peptide.
8. The gene editing system according to claim 7, wherein The fluorescent protein gene includes the enhanced green fluorescent protein (EGFP) gene as shown in SEQ ID NO.6; the resistance gene includes the BSD resistance gene as shown in SEQ ID NO.
7.
9. Use of a gene editing system according to any one of claims 1 - 8 in the preparation of a drug for gene editing.
10. A gene editing method based on splicing reconstruction and non-homologous end joining repair, characterized in that, It includes the following steps: S1. Clone the RNA polymerase III promoter and the sgRNA sequence, and the RNA polymerase II promoter and the Cas9 gene sequence into the CRISPR plasmid; S2. Clone the sgRNA recognition sequence, the splicing sequence of the 3' splice acceptor site, the complete CDS sequence composed of the fragment to be replaced and the downstream exon, and the polyA tail transcription termination sequence into the donor vector in sequence; Or, clone the sgRNA recognition sequence, the splicing sequence of the 3' splice acceptor site, the complete CDS sequence composed of the fragment to be replaced and the downstream exon, the fluorescent protein gene linked by a 2A peptide, the resistance gene linked by a 2A peptide, and the polyA tail transcription termination sequence into the donor vector in sequence; the complete CDS sequence does not contain a stop codon; S3. Co-transfect the CRISPR plasmid in step S1 and the donor vector in step S2 into the target cells to correctly express the edited gene to be repaired.
Citation Information
Patent Citations
New method for gene point mutation repair
CN109536527A
Allele efficient replacement system and establishment method thereof
CN111944847A
SgRNA and use thereof in repairing abnormal splicing of introns
CN112391410A
Slicing variant induced by substitution of 767-site basic group of ABO gene and application of splicing variant
CN116334110A
Method for improving WAS protein expression in human cells
CN116355958A