Glucose-6-phosphate dehydrogenase mutants, biomaterials, catalysts and applications

By mutating specific amino acid residues of glucose-6-phosphate dehydrogenase and optimizing its amino acid sequence, the problems of low catalytic efficiency and limited reaction conditions of wild-type G6PD were solved, and efficient NADPH regeneration and wide reaction conditions were achieved, making it suitable for a variety of industrial and medical applications.

CN120384059BActive Publication Date: 2025-09-26NANJING UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510874299.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-27
Publication Date
2025-09-26
Estimated Expiration
2045-06-27

AI Technical Summary

Technical Problem

Wild-type glucose-6-phosphate dehydrogenase (G6PD) has low catalytic efficiency, strong structural sensitivity, and insufficient dynamic regulation mechanism, resulting in insufficient NADPH regeneration rate, which makes it difficult to meet the needs of industrial applications.

Method used

By mutating amino acid residues 111, 127, 214, and 217 of wild-type glucose-6-phosphate dehydrogenase, glucose-6-phosphate dehydrogenase mutants, such as K111L/T217L, are formed, and their amino acid sequences are optimized to improve catalytic activity and broadness of reaction conditions.

Benefits of technology

The NADPH regeneration efficiency of the mutant was significantly improved, and the catalytic efficiency was increased to 2.06 times that of the wild type. The reaction conditions were extended to 20-50°C and pH 6-10, while maintaining good catalytic efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120384059B_ABST
    Figure CN120384059B_ABST
Patent Text Reader

Abstract

The present invention discloses a glucose-6-phosphate dehydrogenase mutant, biomaterial, catalyst and application, belonging to the field of protein engineering. Aspergillus nidulans FGSC A4 The amino acid sequence of the wild-type glucose-6-phosphate dehydrogenase derived from the present invention has one or more mutations in amino acid residues at positions 111, 127, 214, and 217. The NADPH regeneration efficiency of the mutant disclosed in the present invention is significantly improved. The catalytic efficiency of the preferred mutant K111L / T217L is 2.06 times that of the wild-type glucose-6-phosphate dehydrogenase. The reaction conditions of the obtained mutant are wider, and the NADPH regeneration efficiency is good under the conditions of temperature of 20-50°C and pH of 6-10.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of protein engineering, and in particular to a glucose-6-phosphate dehydrogenase mutant, a biomaterial, a catalyst and applications. Background Art

[0002] Glucose-6-phosphate dehydrogenase (G6PD) is the core rate-limiting enzyme of the pentose phosphate pathway (PPP), responsible for catalyzing the oxidation of glucose-6-phosphate (G6P) to gluconolactone-6-phosphate and converting NADP to + Reduction to NADPH. This reaction not only provides cells with ribose-5-phosphate to support nucleotide synthesis but also maintains redox homeostasis by generating NADPH. As a key reducing coenzyme, NADPH participates in the synthesis of biomacromolecules such as fatty acids and cholesterol. It also scavenges reactive oxygen species (ROS) by reducing glutathione (GSH), protecting cells from oxidative damage.

[0003] G6PD also has important applications in multiple industries. For example, in medical diagnostics, highly catalytically active G6PD mutants can significantly improve sensitivity and specificity, becoming a key tool for clinical testing. They not only significantly shorten detection time but also enable highly precise quantitative detection, meeting the needs of high-throughput screening. In industrial biomanufacturing, NADPH is an essential cofactor for the synthesis of drug intermediates (such as antibiotics and chiral compounds) and biofuels. Using G6PD to regenerate NADPH can reduce production costs in microbial cell factories. In agriculture, the introduction of highly active G6PD mutants into transgenic plants can enhance antioxidant systems and improve crop resistance to drought and salt, providing new approaches to addressing climate change. However, the low catalytic efficiency of wild-type G6PD severely limits its effectiveness.

[0004] This core issue stems from the structural sensitivity and dynamic regulation of wild-type G6PD. First, environmental fluctuations, such as pH deviations from the optimal range (typically 7.8-8.5) or temperature changes, can induce conformational changes, reducing substrate binding and affecting enzyme activity. Second, the insufficient affinity of the NADP⁺ binding pocket prevents effective competitive binding in complex systems. Furthermore, feedback inhibition by the product NADPH further weakens catalytic processivity. These deficiencies result in insufficient NADPH regeneration rates, making it difficult to meet the demands of industrial applications. Summary of the Invention

[0005] Purpose of the invention: The purpose of the present invention is to provide a glucose-6-phosphate dehydrogenase mutant with high catalytic activity and broader reaction conditions; the second purpose is to provide biomaterials and catalysts related to the mutant; the third purpose is to provide the use of the mutant and catalyst in the synthesis of the reduced coenzyme NADPH.

[0006] Technical solution: The glucose-6-phosphate dehydrogenase mutant described in the present invention is based on the wild-type glucose-6-phosphate dehydrogenase amino acid sequence shown in SEQ ID NO: 1, and has one or more amino acid residue mutations at positions 111, 127, 214, and 217, wherein the reference sequence of the wild-type glucose-6-phosphate dehydrogenase amino acid sequence is NCBI Reference Sequence: XP_660585.1.

[0007] Preferably, in the amino acid mutations, the lysine residue at position 111 mutates to a leucine residue, the glutamine residue at position 127 mutates to a threonine residue, the phenylalanine residue at position 214 mutates to a glycine residue, and the threonine residue at position 217 mutates to a leucine residue.

[0008] Preferably, the glucose-6-phosphate dehydrogenase mutant has an amino acid sequence as shown in any one of SEQ ID NOs: 2-7.

[0009] The nucleotide sequence of the present invention is based on the wild-type glucose-6-phosphate dehydrogenase nucleotide sequence, contains corresponding base mutations, and encodes the amino acid sequence of the aforementioned glucose-6-phosphate dehydrogenase mutant.

[0010] Preferably, the wild-type glucose-6-phosphate dehydrogenase nucleotide sequence is shown in SEQ ID NO: 8, which is Aspergillus nidulans FGSC A4 Source Codon-optimized nucleotide sequence of glucose-6-phosphate dehydrogenase.

[0011] The recombinant vector of the present invention comprises the aforementioned nucleotide sequence.

[0012] The recombinant microorganism of the present invention comprises the aforementioned nucleotide sequence or recombinant vector.

[0013] The catalyst of the present invention comprises the aforementioned glucose-6-phosphate dehydrogenase mutant.

[0014] Application of the glucose-6-phosphate dehydrogenase mutant or catalyst of the present invention in synthesizing NADPH.

[0015] Preferably, the reaction temperature is 20-50° C. and the pH is 6-10.

[0016] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The NADPH regeneration efficiency of the obtained mutant is significantly improved. The catalytic efficiency of the preferred mutant K111L / T217L is 2.06 times that of the wild-type glucose-6-phosphate dehydrogenase; 2. The reaction conditions of the obtained mutant are wider, and the NADPH regeneration efficiency is good under the conditions of temperature 20-50°C and pH 6-10. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The glucose-6-phosphate dehydrogenase mutant obtained in Example 1-7 catalyzes the oxidation of coenzyme NADP + Comparison of relative activities of NADPH reduced to reduced coenzyme;

[0018] Figure 2 The glucose-6-phosphate dehydrogenase mutant K111L / T217L catalyzes the oxidation of coenzyme NADP at different temperatures + Comparison of relative activities of NADPH reduced to reduced coenzyme;

[0019] Figure 3 The glucose-6-phosphate dehydrogenase mutant K111L / T217L catalyzes the oxidation of the coenzyme NADP at different pH + Comparison of relative activities of NADPH reduced to reduced coenzyme. DETAILED DESCRIPTION

[0020] The technical solution of the present invention is further described below.

[0021] Example 1 Construction of wild-type glucose-6-phosphate dehydrogenase plasmid and preparation of crude enzyme solution

[0022] The sequence shown in SEQ ID NO: 8 is from Aspergillus nidulans FGSC A4 The codon-optimized wild-type glucose-6-phosphate dehydrogenase gene was synthesized by Suzhou GeneWeizhi Co., Ltd. and constructed on the pET22b vector to obtain pET22b-G6PD, wherein the pET22b vector was provided by GeneWeizhi Co., Ltd.

[0023] pET22b-G6PD was transformed into E. coli DH5α strain, the recombinant bacteria E. coli DH5α / pET22b-G6PD was inoculated into a test tube containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin and cultured at 37°C and 220 rpm for 12 h.

[0024] After the culture was completed, the bacteria were centrifuged at 12000 rpm for 1 min and the cells were collected. A high-purity plasmid extraction kit was used to extract the pET22b-G6PD plasmid as a template for iterative mutagenesis for the construction of G6PD mutants.

[0025] At the same time, pET22b-G6PD was transferred into E. coli BL21 (DE3), construction of recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-G6PD. The successfully constructed recombinant mutant expression strain was spread onto a plate containing ampicillin at a final concentration of 100 mg / mL and cultured at 37°C for 18 h.

[0026] After the culture was completed, a single colony was picked and inoculated into a test tube containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin and cultured at 37 °C and 200 rpm for 18 h. All the colonies were transferred to 500 mL of LB medium with a final concentration of 100 μg / mL ampicillin and the OD was 0. 600 =0.6, add isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM, and induce at 18 °C for 14 h.

[0027] After centrifugation at 4000 rpm for 10 min, the cells were resuspended in 100 mM phosphate buffer (pH 7.5) to an OD of 600 = 1. Disrupt cells by sonication at 65W for 2 seconds with 5 seconds intervals in an ice bath for a total of 30 minutes. Centrifuge at 12,000 rpm for 20 minutes at 4°C. Collect the supernatant and filter through a 0.22 μm water filter to obtain the crude enzyme solution containing the wild-type enzyme.

[0028] Example 2 Construction of Glucose-6-phosphate Dehydrogenase Mutant K111L and Preparation of Crude Enzyme Solution

[0029] 1. Recombinant Escherichia coli E. coli Construction of BL21(DE3) / pET22b-G6PD-K111L mutant

[0030] Gene mutation was performed using whole plasmid PCR to obtain the target mutant gene. The primers are as follows:

[0031] SEQ ID NO: 9, K111L upstream primer: GATAGCTTTCTGAACCTGGCCAAACATCTGG

[0032] SEQ ID NO: 10, K111L downstream primer: GGCCAGGTTCAGAAAGCTATCATCCTGATC

[0033] The PCR system is shown in Table 1, and the reaction conditions are shown in Table 2.

[0034] Table 1 PCR reaction system

[0035]

[0036] Table 2 PCR reaction conditions

[0037]

[0038] After PCR amplification, the amplified product was detected by 0.9% agarose gel electrophoresis, and the results showed that the amplified product was a single band with a size of approximately 7000 bp. The amplified product was purified and recovered using a DNA recovery and purification kit.

[0039] The purified gene fragment was digested with DpnI to remove the template and then recombined with recombinase. E. coli DH5a competent cells were spread on LB solid culture plates containing 100 mg / mL ampicillin and cultured at 37°C for 12 h.

[0040] After the culture was completed, a single colony was picked and cultured in LB liquid containing 100 mg / mL ampicillin. After culture, it was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing to verify the correctness of the mutation site. After verification, part of the bacterial solution was stored at -80°C for use, and part of the bacterial solution was used to extract the recombinant plasmid pET22b-G6PD-K111L and stored in a -20°C refrigerator.

[0041] The recombinant expression plasmid pET22b-G6PD-K111L that was successfully sequenced was transferred into E. coli BL21 (DE3), construction of recombinant mutant expression strain E. coli BL21(DE3) / pET22b-G6PD-K111L.

[0042] 2. Cultivation of Glucose-6-phosphate Dehydrogenase Mutants and Preparation of Crude Enzyme Solution

[0043] The successful recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-G6PD-K111L, spread on a culture plate containing ampicillin at a final concentration of 100 mg / mL, and culture at 37 °C for 18 h.

[0044] After the incubation, a single colony was picked and inoculated into a test tube containing 5 mL of LB medium with a final concentration of 100 μg / mL ampicillin. The tube was cultured at 37 °C and 200 rpm for 18 h. A 1% inoculum was transferred to 500 mL of LB medium with a final concentration of 100 μg / mL ampicillin. The inoculum was then inoculated at OD 600 =0.6, IPTG was added to a final concentration of 0.5 mM, and the cells were induced at 18 °C for 14 h.

[0045] After centrifugation at 4000 rpm for 10 min, the cells were resuspended in 100 mM phosphate buffer (pH 7.5) to an OD of 600 = 1. Disrupt cells by sonication at 65W for 2 seconds with 5 seconds intervals in an ice bath for a total of 30 minutes. Centrifuge at 12,000 rpm for 20 minutes at 4°C. Collect the supernatant and filter through a 0.22 μm water filter to obtain the crude enzyme solution containing the wild-type enzyme.

[0046] The amino acid sequence of the glucose-6-phosphate dehydrogenase mutant K111L is shown in SEQ ID NO: 2.

[0047] Example 3 Construction of Glucose-6-phosphate Dehydrogenase Mutant Q127T and Preparation of Crude Enzyme Solution

[0048] The construction of the Q127T mutant and the preparation of the crude enzyme solution were based on Example 2. In step 1, the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0049] SEQ ID NO: 11, Q127T upstream primer: CAGAAGGAGACCAACCGCGTTTTCTATATG

[0050] SEQ ID NO: 12, Q127T downstream primer: CGCGGTTGGTCTCCTTCTGATTCTTTTCAATTT

[0051] The amino acid sequence of the glucose-6-phosphate dehydrogenase mutant Q127T is shown in SEQ ID NO: 3.

[0052] Example 4 Construction of Glucose-6-phosphate Dehydrogenase Mutant F214G and Preparation of Crude Enzyme Solution

[0053] The construction of the F214G mutant and the preparation of the crude enzyme solution were based on Example 2. In step 1, the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0054] SEQ ID NO: 13, F214G upstream primer: CAATGAATTTGGCAACGCAACCTGGAATCGT

[0055] SEQ ID NO: 14, F214G downstream primer: GTTGCGTTGCCAAATTCATTGCCGAAACGC

[0056] The amino acid sequence of the glucose-6-phosphate dehydrogenase mutant F214G is shown in SEQ ID NO:4.

[0057] Example 5 Construction of Glucose-6-phosphate Dehydrogenase Mutant T217L and Preparation of Crude Enzyme Solution

[0058] The construction of the T217L mutant and the preparation of the crude enzyme solution were based on Example 2. In step 1, the primers were changed, and the other conditions remained unchanged. The primers were as follows:

[0059] SEQ ID NO: 15, T217L upstream primer: TTCAACGCACTGTGGAATCGTCATCATAT

[0060] SEQ ID NO: 16, T217L downstream primer: CGATTCCACAGTGCGTTGAAAAATTCATTGC

[0061] The amino acid sequence of the glucose-6-phosphate dehydrogenase mutant T217L is shown in SEQ ID NO:5.

[0062] Example 6 Construction of Glucose-6-Phosphate Dehydrogenase Mutant K111L / T217L and Preparation of Crude Enzyme Solution

[0063] The construction of the K111L / T217L mutant and the preparation of the crude enzyme solution were based on Example 2, using the mutant K111L obtained in Example 2 as the DNA template in step 1, and changing the primers while keeping the other conditions unchanged. The primers are as follows:

[0064] SEQ ID NO: 15, T217L upstream primer: TTCAACGCACTGTGGAATCGTCATCATAT

[0065] SEQ ID NO: 16, T217L downstream primer: CGATTCCACAGTGCGTTGAAAAATTCATTGC

[0066] The amino acid sequence of the glucose-6-phosphate dehydrogenase mutant K111L / T217L is shown in SEQ ID NO: 6.

[0067] Example 7 Construction of Glucose-6-Phosphate Dehydrogenase Mutant Q127T / T217L and Preparation of Crude Enzyme Solution

[0068] The construction of the Q127T / T217L mutant and the preparation of the crude enzyme solution were carried out based on Example 2, using the mutant Q127T obtained in Example 3 as the DNA template in step 1, and changing the primers while keeping the other conditions unchanged. The primers are as follows:

[0069] SEQ ID NO: 15, T217L upstream primer: TTCAACGCACTGTGGAATCGTCATCATAT

[0070] SEQ ID NO: 16, T217L downstream primer: CGATTCCACAGTGCGTTGAAAAATTCATTGC

[0071] The amino acid sequence of the glucose-6-phosphate dehydrogenase mutant Q127T / T217L is shown in SEQ ID NO: 7.

[0072] Test Example 1 Performance test of glucose-6-phosphate dehydrogenase mutants

[0073] 1. Glucose-6-phosphate dehydrogenase and its mutants catalyze the oxidation of coenzyme NADP + Reduced to reduced coenzyme NADPH

[0074] NADPH was prepared at concentrations of 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, and 1 mM. The absorbance at 340 nm was detected using a microplate reader. A standard curve was drawn as y = 2.6016x - 0.0727, where x was the NADPH concentration and y was the absorbance.

[0075] The crude enzyme solution obtained in Example 2-7 was used as catalyst. The reaction system was: the cell concentration before lysis was OD 600 =0.01 crude enzyme solution, 2.5mM oxidized coenzyme NADP + , 5 mM glucose-6-phosphate, 200 mM phosphate buffer, pH 7.5, total volume 300 μL. The reaction temperature was controlled at 30°C in a water bath for 5 min. The absorbance change of the product NADPH at 340 nm after 5 min was measured using a microplate reader. The change in NADPH concentration over the same time period was used to represent enzyme activity. The wild-type enzyme activity was set as 100% for comparison of relative activities.

[0076] The test results are shown in Table 3 and Figure 1 .

[0077] Table 3 Glucose-6-phosphate dehydrogenase reduces reduced coenzyme NADPH

[0078]

[0079] Depend on Figure 1 The results showed that the catalytic conversion rates of all mutants were higher than that of wild-type glucose-6-phosphate dehydrogenase. In particular, the catalytic efficiency of mutant K111L / T217L was 2.06 times that of wild-type glucose-6-phosphate dehydrogenase.

[0080] 2. Glucose-6-phosphate dehydrogenase mutant (K111L / T217L) catalyzes the oxidation of coenzyme NADP + Optimal temperature for reduction to reduced coenzyme NADPH

[0081] NADPH was prepared at concentrations of 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, and 1 mM. The absorbance at 340 nm was detected using a microplate reader. A standard curve was drawn as y = 2.6016x - 0.0727, where x was the NADPH concentration and y was the absorbance.

[0082] The crude enzyme solution obtained in Example 6 was used as a catalyst, and the reaction system was: the cell concentration before lysis was OD 600 =0.01 crude enzyme solution, 2.5mM oxidized coenzyme NADP + , 5mM glucose-6-phosphate, 200mM phosphate buffer, pH = 7.5, total volume 300μL. The reaction temperature was controlled at 15℃, 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, and 50℃ in a water bath for 5 minutes. The absorbance change of the product NADPH at 340 nm after 5 minutes was detected by a microplate reader. The change in NADPH concentration at the same time was used to reflect the enzyme activity. The enzyme activity at 15℃ was set as 100% to compare the relative activity. The test results are shown in Figure 2 .

[0083] Depend on Figure 2 It can be seen that the best catalytic effect was observed at 35°C, and the enzyme activity was good in the range of 20-50°C.

[0084] 3. Glucose-6-phosphate dehydrogenase mutant (K111L / T217L) catalyzes the oxidation of coenzyme NADP + Optimal pH for reduction to reduced coenzyme NADPH

[0085] NADPH was prepared at concentrations of 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, and 1 mM. The absorbance at 340 nm was detected using a microplate reader. A standard curve was drawn as y = 2.6016x - 0.0727, where x was the NADPH concentration and y was the absorbance.

[0086] The crude enzyme solution obtained in Example 6 was used as a catalyst, and the reaction system was: the cell concentration before lysis was OD 600=0.01 crude enzyme solution, 2.5mM oxidized coenzyme NADP + , 5mM glucose-6-phosphate, 50mM citric acid-sodium citrate buffer or 50mM potassium phosphate buffer or 50mM Tris-HCl buffer or 50mM Gly-NaOH buffer, with a total volume of 300μL. The citric acid-sodium citrate buffer controls the reaction pH to 5, the potassium phosphate buffer controls the reaction pH to 6, 6.5 or 7, the Tris-HCl buffer controls the reaction pH to 7.5, 8 or 8.5, and the Gly-NaOH buffer controls the reaction pH to 9, 9.5 or 10. The reaction temperature was controlled at 35°C in a water bath for 5 minutes. The absorbance change of the product NADPH at 340 nm after 5 minutes was detected by a microplate reader. The change in NADPH concentration at the same time was used to reflect the enzyme activity. The enzyme activity at pH = 5 was set as 100% to compare the relative activity. The test results are shown in Figure 3 .

[0087] Depend on Figure 3 It can be seen that different pH has a significant effect on the catalytic effect of G6PD. The best catalytic effect is observed at pH 7, and the enzyme catalytic activity is good when the pH is in the range of 6-10.

Claims

1. A glucose-6-phosphate dehydrogenase mutant, characterized in that: Based on the amino acid sequence of the wild-type glucose-6-phosphate dehydrogenase shown in SEQ ID NO: 1, the threonine residue at position 217 is mutated to a leucine residue, or the glutamine residue at position 127 is mutated to a threonine residue and the threonine residue at position 217 is mutated to a leucine residue, or the lysine residue at position 111 is mutated to a leucine residue and the threonine residue at position 217 is mutated to a leucine residue, and the amino acid sequence of the mutant is any one of the sequences shown in SEQ ID NO: 5-7.

2. A nucleotide, characterized in that Based on the wild-type glucose-6-phosphate dehydrogenase nucleotide sequence, the amino acid sequence of the glucose-6-phosphate dehydrogenase mutant according to claim 1 is encoded, including corresponding base mutations.

3. The nucleotide according to claim 2, characterized in that The wild-type glucose-6-phosphate dehydrogenase nucleotide sequence is shown in SEQ ID NO:

8. Aspergillus nidulans FGSC A4 Source Codon-optimized nucleotide sequence of glucose-6-phosphate dehydrogenase.

4. A recombinant vector, characterized in that The recombinant vector comprises the nucleotide according to claim 2.

5. A recombinant microorganism, characterized in that The recombinant microorganism comprises the nucleotide according to claim 2 or the recombinant vector according to claim 4.

6. A catalyst, characterized in that The catalyst comprises the glucose-6-phosphate dehydrogenase mutant according to claim 1.

7. Use of the glucose-6-phosphate dehydrogenase mutant according to claim 1 or the catalyst according to claim 6 in synthesizing NADPH.

8. The application according to claim 7, characterized in that: The reaction temperature for the application is 20-50° C. and the pH is 6-10.

Citation Information

Patent Citations

  • Polyphosphokinase mutant, biological material, catalyst and application

    CN120310769A