Application of tea tree CsMADS gene in regulation and control of theobromine content of tea leaves

Through the antisense inhibition technology of the CsMADS gene of tea tree, the cocoa alkali content in tea is regulated, and the problem of regulating tea flavor and nutritional value in the existing technology is solved, and the improvement of tea quality and economic benefits is achieved.

CN120384097APending Publication Date: 2025-07-29CHONGQING ACAD OF AGRI SCI +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510537000.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-27
Publication Date
2025-07-29

AI Technical Summary

Technical Problem

The prior art is difficult to effectively regulate the content of cocoa alkali in tea, and the introduction of foreign fungi may destroy the original flavor and nutritional value of tea.

Method used

Using antisense inhibition technology of the tea tree CsMADS gene, the content of cocoamin in tea leaves is increased by designing specific antisense primers to interfere with or silencing CsMADS gene expression.

Benefits of technology

Significantly increase the content of cocoa alkali in tea, maintain the original flavor and nutritional value of tea, meet the diversified market needs, and improve the quality and economic benefits of tea.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120384097A_ABST
    Figure CN120384097A_ABST
Patent Text Reader

Abstract

The invention provides application of a tea tree CsMADS gene in regulating and controlling the content of theobromine in tea leaves. The invention also provides an antisense inhibition treatment liquid for the tea tree CsMADS gene and a kit thereof. The invention further provides a method for increasing the content of theobromine in tea tree buds and leaves. By means of the antisense inhibition CsMADS gene, the content of theobromine in the tea leaves is remarkably increased, and a new way is opened up for accurately regulating and controlling the content of theobromine in the tea leaves and further improving the quality, flavor, nutritional value and the like of the tea leaves.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology. Specifically, it relates to the application of the CsMADS gene of tea plants in regulating the theobromine content in tea leaves. Background Art

[0002] In the vast world of global beverages, tea, coffee, and cocoa are known as the three major non-alcoholic beverages. Tea, with its unique flavor, rich cultural connotations, and many beneficial properties for the human body, has won the love of people all over the world. As the origin of tea, China is rich in tea germplasm resources. China's tea industry not only has a high output value but also a large scale. The production, processing, sales, and other links of tea form a huge and mature industrial chain, which not only provides employment opportunities for a large number of people in the country but also occupies an important position in the international market.

[0003] The raw material for making tea comes from the buds and leaves of tea plants. Among the buds and leaves, there is a magical substance called theobromine. Theobromine belongs to methylxanthine alkaloids. In tea plants, its content ranks second only to caffeine. Theobromine has a positive promoting effect on cardiovascular health. It has a slight vasodilatory effect, which can appropriately relax the blood vessel wall and make blood flow more smoothly. This is of great significance for maintaining normal blood pressure levels and reducing the risk of cardiovascular diseases. When the blood vessels maintain good elasticity and patency, the heart can pump blood to all parts of the body more easily, providing sufficient nutrients for all organs of the body.

[0004] Theobromine also has a strong antioxidant effect. During various chemical reactions in the body, some free radicals will be generated. These free radicals will attack cells, cause cell damage, and then trigger a series of problems such as aging and inflammation. And theobromine can effectively scavenge these free radicals and reduce the oxidative damage of cells.

[0005] At the same time, the diuretic effect of theobromine is also very significant. It can increase the blood flow to the kidneys, promote the production and excretion of urine. This helps the body excrete excess water and waste, reduces the burden on the kidneys, and maintains the body's water-salt balance.

[0006] In addition, theobromine can also slightly stimulate the central nervous system. Appropriate intake of tea containing theobromine can improve mood, make people feel happy and relaxed, and at the same time relieve physical fatigue and regain vitality.

[0007] In the physiological and biochemical processes of plants, the synthesis mechanisms of theobromine and caffeine involve complex and delicate steps. Regarding theobromine, its synthesis starts from the key substrate adenylate. Adenylate undergoes a series of biochemical reactions under the catalysis of inosine monophosphate dehydrogenase. Subsequently, relying on S-adenosylmethionine-dependent methyltransferase, which uses S-adenosylmethionine as the methyl donor, it adds a methyl group to a specific molecular site, promoting the conversion of the substance towards theobromine.

[0008] The synthesis of caffeine takes theobromine as the direct precursor. Under the action of caffeine synthase, theobromine undergoes another methylation process. Caffeine synthase precisely recognizes the theobromine molecule and adds a methyl group from a specific methyl donor to a specific position on theobromine, enabling its transformation from theobromine to caffeine. In plants, this synthesis pathway does not exist in isolation but is closely connected to the overall metabolic network of plants and is finely regulated by various internal factors and external environmental conditions.

[0009] In the past, when researching the regulatory genes of alkaloids, most researchers focused on caffeine. As an important alkaloid component in plants such as tea, the content and quality of caffeine directly affect the flavor and efficacy of the beverage. It has been found that the genes encoding the key enzymes (such as N-methyltransferase, etc.) in the caffeine synthesis process show significant changes in expression levels in different plant varieties, different growth and development stages, and different environmental stresses. For example, in some tea tree varieties, a specific N-methyltransferase gene is highly expressed, resulting in an increase in the synthesis amount of caffeine and a more intense taste of the tea leaves; under adverse conditions, some regulatory genes may be activated or inhibited, thereby affecting the synthesis rate of caffeine to help the plant adapt to environmental changes.

[0010] In contrast, there is still a large research space for in-depth exploration of the related regulatory genes in the theobromine synthesis pathway. If it is possible to regulate the content of multiple alkaloids in tea simultaneously, it will be of great significance for further improving the flavor and nutritional value of tea.

[0011] Chinese patent document CN 118844259A discloses a method for promoting the production of secondary metabolites in tea trees by using endophytic bacteria. By constructing a symbiotic body of endophytic fungi and host tea trees, the contents of tea polyphenols, theobromine, caffeine, catechins, etc. in the tea leaves of tea trees are increased.

[0012] However, the technology provided in this document requires the introduction of foreign fungi. Although it can improve the content of theobromine, it may damage the original flavor and nutrition of the tea leaves and cannot controllably regulate the content according to requirements.

[0013] Regarding the application of MADS genes, Chinese Patent Document CN 119039410A discloses MADS-box transcription factors derived from tartary buckwheat, their coding genes, and applications. Through this technology, the biosynthesis of flavonoids in tartary buckwheat can be promoted, and it has application prospects in cultivating or breeding tartary buckwheat varieties with high flavonoid content, etc.

[0014] However, this technology does not disclose its application in tea, and the regulatory target mentioned therein is flavonoids.

[0015] US Patent Document US 9238818B2 discloses the regulatory sequences of the MADS gene family, which are used to express recombinant gene products in the reproductive tissues of plants to produce corn plant cobs with altered plant lignin content.

[0016] However, this technology does not disclose its application in tea, and the regulatory target mentioned therein is lignin. Summary of the Invention

[0017] The technical problem to be solved by the present invention is how to regulate the content of theobromine in tea tree buds and leaves.

[0018] To solve the above technical problem, the present invention provides the application of the tea tree CsMADS gene in regulating the theobromine content in tea.

[0019] Preferably, the nucleotide sequence of the CsMADS gene is as shown in SEQ ID NO:1.

[0020] Preferably, the amino acid sequence of the protein encoded by the CsMADS gene is as shown in SEQ ID NO:2.

[0021] More preferably, regulating the theobromine content in tea means increasing the theobromine content.

[0022] Further preferably, the theobromine content is increased through gene interference or gene silencing.

[0023] Further preferably, the gene interference or gene silencing is achieved through antisense primers.

[0024] Even more preferably, the antisense primers are selected from one or a combination of multiple sequences shown in SEQ ID NO:5-9.

[0025] The present invention also provides an antisense inhibition treatment solution for the tea tree CsMADS gene, which is prepared by diluting and mixing five sequences shown in SEQ ID NO:5-9 in equal amounts with distilled water, and the concentration of each primer in the antisense inhibition treatment solution is 20±2 μM.

[0026] The present invention also provides a kit for silencing the CsMADS gene of tea plants, including the above antisense inhibition treatment solution.

[0027] The present invention also provides a method for increasing the theobromine content in the buds and leaves of tea plants, using the above antisense inhibition treatment solution or the above kit to treat the buds and leaves of growing tea plants.

[0028] Beneficial effects

[0029] The present invention conducts in-depth research on the CsMADS gene of tea plants, and for the first time successfully constructs an antisense inhibition gene-silenced plant of the CsMADS gene of tea plants, and systematically explores its function. By accurately measuring the alkaloid content, it is found that the CsMADS gene of tea plants plays a negative inhibitory role in the process of theobromine accumulation, and its presence causes the theobromine content in the buds and leaves of tea plants to decrease. By means of antisense inhibition of the CsMADS gene, this negative inhibitory effect has been successfully reversed, and the theobromine content has been significantly increased. This discovery is of great significance because theobromine not only affects the flavor of tea but also has certain nutritional value. Precise regulation of the theobromine content opens up a new way for improving the quality of tea.

[0030] Using antisense inhibition primers to regulate the theobromine content provides a very simple and efficient method for regulating the flavor and nutritional value of tea. It should be emphasized that the primers are designed based on the internal genes of tea, and during the process of playing a regulatory role, they will not express other additional products and do not need to introduce irrelevant foreign substances, so they will not interfere with the composition of other substances in the original tea. This means that while improving the specific quality of tea, the natural characteristics of the tea itself can be maximally retained, and the purity of the tea flavor and components can be maintained.

[0031] From the perspective of technical application, the antisense inhibition technology involved in the present invention is quite mature, which lays a solid foundation for the industrial application of the present invention. Compared with other complex and costly technologies, this technology has the advantages of simple operation and easy promotion, and can be quickly implemented in the fields of tea planting and processing. Through large-scale application, tea producers can flexibly regulate the theobromine content in tea according to market demand, develop tea products with different flavors and nutritional values, and meet the diverse needs of consumers. This not only helps to improve the economic benefits of the tea industry but also promotes the innovative development of the entire tea industry, enriches the tea market, and brings more high-quality choices to consumers. Description of the drawings

[0032] In order to make the objectives, technical solutions, and advantages of the present invention clearer, the following further details the specific embodiments of the present invention with reference to the accompanying drawings.

[0033] Figure 1It is a statistical data graph of the expression level of the CsMADS gene in the tea tree leaves with antisense inhibition gene silencing of the CsMADS gene.

[0034] Figure 2 It is a statistical data graph of the theobromine content in the tea tree leaves affected by the antisense inhibition gene of the CsMADS gene.

[0035] Among them, Control is the negative control group; CsMADS-silencing is the antisense inhibition treatment group. Different letters represent significant differences between different groups (p<0.05). Specific implementation manners

[0036] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto.

[0037] The materials, reagents, tools and conditions used in the present invention are only illustrative, and those skilled in the art can also select other materials, reagents, tools and conditions with the same or similar functions.

[0038] Those skilled in the art know that the MADS gene plays a key role in the growth and development of tea trees and other processes. The naming of the MADS gene comes from the initials of genes with similar characteristics in multiple different species. Among them, the MCM1 gene of yeast, the AG gene of Arabidopsis thaliana, the DEF gene of Antirrhinum majus, and the serum response factor SRF of humans, these genes all contain a conserved region of about 180bp encoding a DNA binding domain at the N-terminus. Based on this similarity, this type of gene is uniformly named the MADS gene. From the perspective of structural characteristics, the DNA binding domain encoded by this conserved region of about 180bp enables the MADS gene to accurately recognize and bind to specific DNA sequences, thereby initiating a series of subsequent important biological processes.

[0039] In plants, the MADS gene plays many indispensable functions. Taking the tea tree as an example, it plays a key role in regulating the development of floral organs. The formation and development of tea tree flowers is a complex and orderly process. The MADS gene is involved in it, regulating the differentiation and formation of various floral organs such as sepals, petals, stamens and pistils. Different MADS gene members are specifically expressed at different stages and in different parts of floral organ development, and cooperate with each other to ensure the normal development of tea tree flowers, laying a foundation for subsequent pollination and fruit setting.

[0040] In terms of stress resistance response, the MADS gene also exhibits powerful functions. During the growth process of tea plants, they will face various adversities, such as drought, high temperature, low temperature, and pest and disease attacks. When tea plants encounter these adverse environments, the MADS gene in their bodies will be activated. By regulating the expression of a series of downstream genes, the tea plants will undergo corresponding physiological and biochemical changes to adapt to the adversity. For example, under drought stress, the MADS gene may regulate the synthesis of osmoregulatory substances in tea plant cells, enhancing the water retention ability of tea plants; in the face of pests and diseases, it may induce the tea plants to synthesize some antibacterial and insect-resistant secondary metabolites, improving the pest and disease resistance of tea plants, ensuring the healthy growth of tea plants, and maintaining the yield and quality of tea leaves.

[0041] In addition, the MADS gene also plays an important role in the process of seed germination. The germination of tea seeds requires a series of precise regulations, and the MADS gene is involved in it, controlling the synthesis of enzymes required for seed germination and the hormone signaling pathway. It can sense signals such as temperature and moisture in the external environment, coordinate the internal physiological metabolism of seeds, and prompt tea seeds to break dormancy in a timely manner and germinate into seedlings smoothly, starting a new life cycle of tea plants.

[0042] The CsMADS gene used in this invention represents the MADS gene of tea plants, where the initial letter Cs represents the initials of the Latin name Camellia sinensis of tea plants.

[0043] However, there is no report on the regulatory function of the MADS gene on theobromine.

[0044] The experimental reagents not specifically specified in this invention are all conventional reagents purchased by the applicant's unit from the market.

[0045] The "gene interference" or "gene silencing" referred to in this invention means using a specific method to turn off or inhibit the transcription and / or expression of the target gene. Commonly used methods include antisense inhibition, triple-stranded DNA, interfering RNA, etc. In this invention, it specifically refers to gene interference using antisense inhibition technology. Therefore, these terms can be used interchangeably in this invention.

[0046] Antisense inhibition is generally achieved through antisense primers. They are a type of primer that can complementarily bind to the target DNA or RNA sequence, thereby inhibiting the expression of the target gene. From the perspective of the nucleic acid strand, it usually complements the sense strand (coding strand) or a partial sequence of mRNA. By binding to the DNA template strand, the antisense primer can prevent the progress of RNA polymerase, thus inhibiting the transcription process and preventing the synthesis of the corresponding mRNA. Or when the antisense primer binds to mRNA, it will hinder the binding of ribosomes to mRNA or interfere with the movement of ribosomes on mRNA, thereby inhibiting the protein translation process.

[0047] The design of antisense primers must be based on the specific sequence of the target gene to ensure that they can specifically bind to the target sequence and avoid hybridization with other non-target gene sequences. The length is generally around 18-25bp; the GC content is usually controlled at 40%-60% to ensure the stability of the primer binding to the target sequence. Too high or too low GC content may affect the binding effect; the primer itself should not form secondary structures such as hairpin structures and dimers, otherwise it will affect the binding efficiency of the primer to the target sequence.

[0048] The present invention provides some specific examples of antisense primers, but those skilled in the art can design other antisense primers capable of achieving the same inhibitory function based on the above principles by themselves or using sequence design software.

[0049] Antisense inhibition has a wide range of applications. For example, by designing antisense inhibitory primers targeting specific genes, the expression of the gene can be inhibited, and the phenotypic changes of cells or organisms can be observed to infer the function of the gene. Antisense inhibitory primers can be designed for key genes related to the occurrence and development of diseases to inhibit the expression of pathogenic genes and achieve the purpose of treating the disease. For example, in cancer treatment, antisense inhibitory primers can be designed for certain oncogenes. Antisense inhibitory primers can be used to screen drugs that can regulate the expression of target genes. By observing the expression of target genes under the combined action of drugs and antisense inhibitory primers, the effect and mechanism of the drug can be evaluated. In the present invention, the theobromine content in tea can be regulated by antisense inhibition of the expression of specific genes, so that the flavor and nutritional value of tea can be adjusted as needed.

[0050] The term "vector" used in the present invention refers to a self-replicating DNA molecule that transfers DNA fragments to recipient cells in genetic engineering recombinant DNA technology, including bacterial plasmids, bacteriophages, and animal and plant viruses. The vector mentioned in the present invention specifically refers to a plasmid vector, so the two are interchangeable terms. Blunt-Zero vector is a commercially available product from Quanshijin Biotechnology.

[0051] The tea variety Longjing 43 used in the present invention is a national-level clone bred from the Longjing population by the Tea Research Institute of the Chinese Academy of Agricultural Sciences. It was approved (certified) as a national variety by the National Crop Variety Approval Committee in 1987, with the approval number GS13007-1987, and has won the National Science Conference Award. It is a national-level fine variety with a slender appearance, a flat and smooth surface, a tender green color, a rich and long-lasting fragrance, and a sweet and refreshing flavor. It is suitable for producing both black and green teas, especially flat, premium green teas, and is well-suited for cultivation in the tea-growing areas of the middle and lower reaches of the Yangtze River. Its greatest characteristics are its strong bud-raising ability, early budding, and uniform, dense budding. The tea variety Longjing 43 used in the present invention was provided by the Tea Research Institute of the Chinese Academy of Agricultural Sciences.

[0052] The tea tree variety Jianghua Kucha used in the present invention is provided by the National Germplasm Hangzhou Tea Plantation Base of the Tea Research Institute, Chinese Academy of Agricultural Sciences.

[0053] Primer Premier used in the present invention is a commonly used primer design and analysis software in scientific research, with a series of powerful functions such as primer search, design, detection, and screening. By using the closest thermodynamic algorithm and the most accurate melting temperature, the optimal PCR, multiplex PCR, and SNP genotyping primers are found. The primers are screened for secondary structure, dimers, hairpins, homology, and physical properties, and then the best sequences are reported and arranged in order. At the same time, it is equipped with a fast calculation tool, which can conveniently operate the sequences and analyze the results of primer design.

[0054] Example 1 Obtaining the full-length sequence of the CsMADS gene of tea tree:

[0055] Design full-gene amplification primers with Primer Premier 6.0. Take the cDNA of one bud and one leaf of the tea tree variety Longjing 43 planted in the Tea Research Institute, Chinese Academy of Agricultural Sciences as a template (the extraction method of cDNA is a conventional technique, for example, the method described in Chinese Patent Document CN 104561025A can be referred to), and design specific primers CsMADS-F (forward primer, the sequence is shown in SEQ ID NO: 3) and CsMADS-R (reverse primer, the sequence is shown in SEQ ID NO: 4). Use KOD-plus-NEO high-fidelity enzyme (Toyobo (Shanghai) Biotechnology Co., Ltd.) to perform PCR amplification of the CsMADS gene fragment.

[0056] The primer sequences are: CsMADS-F: 5’-ATGGCGAGAGAGAAGATTCAGATCA-3’

[0057] CsMADS-R: 5’-TTAACCTGGCCAAAAGTGTGTGCCT-3’

[0058] The PCR amplification reaction system is: 10xPCR Buffer 5ul, 2mM dNTP 5ul, 25mM MgSO4 3ul, KOD-plus-NEO 1ul, ddH2O 32ul, cDNA 1ul, 1.5ul of each upstream and downstream primer, a total of 50ul. Except for the high-fidelity enzyme, other materials are all conventional and commercially available in the industry.

[0059] The PCR reaction program was as follows: pre-denaturation at 94°C for 2 minutes; denaturation at 98°C for 10 seconds, annealing at 53°C for 30 seconds, extension at 68°C for 2 minutes, for 35 cycles; finally, final extension at 68°C for 5 minutes. The obtained PCR products were identified by 1% agarose gel electrophoresis, and then the amplified bands were recovered and purified using the Axygen DNA Gel Kit. The recovered products were ligated into -Blunt-Zero vector (TransGen Biotech), and the above recombinant plasmid was sent to Hangzhou Youkang Biotechnology Co., Ltd. for sequencing confirmation.

[0060] The nucleotide sequence of the obtained gene CsMADS is shown in SEQ ID NO: 1; the amino acid sequence of the protein encoded by this gene is shown in SEQ ID NO: 2.

[0061] Example 2 Design and synthesis of CsMADS gene antisense inhibition primers and negative control sense primers

[0062] Using the Soligo online design software, the obtained SEQ ID No: 1 nucleotide sequence was submitted. According to the calculation results, oligonucleotides with a length of 20 bp in five regions of the SEQ ID No: 1 nucleotide sequence were obtained. These five regions (starting from the start codon) were the 34-53 bp, 274-293 bp, 385-404 bp, 574-593 bp, and 631-650 bp respectively. Oligonucleotide chains with lower oligonucleotide binding energy were selected in each of the five regions, and deoxynucleotide chains "CsMADS antisense primer-1 to 5" were designed as antisense inhibition primers (numbered SEQ ID NO: 5-9 respectively). The base complementary strands of the antisense inhibition primers were used as negative control sense primers, and the corresponding primers with an OD value of 200 were synthesized by Youkang Company. The specific primer sequences are shown in Table 1 (the primers are all in the 5' to 3' direction).

[0063] Table 1. Nucleotide sequences of CsMADS gene antisense inhibition primers

[0064] CSMADS Antisense Primer-1 GATAACGTAACTGCGAGACA CSMADS Antisense Primer-2 AGCAACTTCTCCAGATTAAG CSMADS Antisense Primer-3 AGGTCCCTCGAAGCTGGGTT CSMADS Antisense Primer-4 ATAAATGAGGAAGGTCAGTC CSMADS Antisense Primer-5 CCACAAGACTATGACAGCTC

[0065] Example 3 Construction and detection of CsMADS gene antisense inhibition materials:

[0066] The five CsMADS antisense primers described in Table 1 were mixed in equal amounts and diluted with distilled water to prepare an antisense inhibition treatment solution containing 20 μM of each primer; the five CsMADS sense primers were mixed in equal amounts and diluted with distilled water to prepare a negative control treatment solution containing 20 μM of each sense primer.

[0067] Pick one bud with one leaf of the tea cultivar Jianghua Kucha from the National Germplasm Hangzhou Tea Plant Nursery Base within the Tea Research Institute, Chinese Academy of Agricultural Sciences, ensuring that the picked one bud with one leaf is healthy bud leaves grown from the current year's new shoots and of the same size and growth state. Randomly divide the picked one bud with one leaf into the above-mentioned blank control group (Control) and antisense inhibition treatment group (CsMADS-silencing), with at least ten biological replicates in each group. Place them in a light incubator with the culture conditions of about 25 °C and a 16h / 8h light / dark cycle. Supplement the treatment liquid for each group every day to avoid drought of the bud leaves.

[0068] On the 5th day of the treatment, freeze the bud leaves in liquid nitrogen, grind them with a ball mill, extract RNA according to the method of the RNAprep Pure Polysaccharide Polyphenol Total RNA Extraction Kit for Plants (DP441, Tiangen Biochemical Technology), and reverse transcribe to extract cDNA. Use the fluorescence quantitative method to measure the expression level of the CsMADS gene in each group. The obtained results are as Figure 1 described. According to Figure 1 it can be known that: antisense inhibition treatment will reduce the expression level of the CsMADS gene.

[0069] Mix 0.05 g of the liquid nitrogen-frozen sample with 10 mL of 70% methanol solution, and ultrasonically dissolve it in a BRANSON 5510 ultrasonic instrument at 80% power for 45 minutes. Subsequently, let the mixture stand at 4 °C for 2 hours to separate the precipitate. Take 1 mL of the supernatant and put it into a vial as a sample for ultra-high performance liquid chromatography (UPLC) analysis. Use a Waters UPLC instrument ACQUITY H-Class equipped with a 1290 Infinity II high-speed pump and a diode array detector to detect the content of purine alkaloids. Inject 20 μL of the sample into the chromatographic column ACQUITY UPLC HSS T3 C18 (1.8 μm, 2.1 mm × 100 mm, Waters), with a flow rate of 0.4 mL / min, and the mobile phase is (A: 0.1% formic acid, B: acetonitrile). The column temperature and detection wavelength are set at 41 °C and 280 nm respectively.

[0070] The obtained results are as Figure 2 described. According to Figure 2 it can be known that: antisense inhibition of the expression of the CsMADS gene will increase the theobromine content in tea tree bud leaves, indicating that the CsMADS gene negatively inhibits the accumulation of theobromine in tea tree bud leaves.

[0071] The above are only embodiments of the present invention. Well-known technical common sense in the solution is not described in detail here. Those of ordinary skill in the art know all the common general technical knowledge in the technical field to which the invention belongs before the filing date, are able to learn all the existing technologies in this field, and have the ability to apply conventional experimental means before this date. Those of ordinary skill in the art can, under the inspiration given in this application, combine their own abilities to improve and implement this solution. Some typical well-known technologies should not become obstacles for those of ordinary skill in the art to implement this application. It should be noted that for those skilled in the art, without departing from the structure of the present invention, several adjustments and improvements can still be made, and these should also be regarded as the protection scope of the present invention, and these will not affect the implementation effect of the present invention and the practicality of the patent. The protection scope required by this application should be based on the content of its claims, and the specific implementation manners and the like recorded in the specification can be used to interpret the content of the claims.

Claims

1. Application of genes in Camellia sinensis in regulating the theobromine content of tea leaves. CsMADS ​ 2. The application according to claim 1, wherein the CsMADS nucleotide sequence of the gene is as shown in SEQ ID NO:

1.

3. The application according to claim 2, the CsMADS amino acid sequence of the protein encoded by the gene is as shown in SEQ ID NO:

2.

4. The application according to any one of claims 1-3, wherein the regulation of the theobromine content in tea leaves is to increase the theobromine content.

5. The application according to claim 4, wherein the theobromine content is increased by gene interference or gene silencing.

6. The application according to claim 4, wherein the gene interference or gene silencing is achieved by antisense primers.

7. The application according to claim 6, wherein the antisense primers are selected from one or a combination of more than one of the sequences shown in SEQ ID NO:5-9.

8. An antisense inhibition treatment solution for tea tree CsMADS is prepared by diluting with distilled water after mixing five sequences shown in SEQ ID NO:5-9 in equal amounts, and the concentration of each primer in the antisense inhibition treatment solution is 20 ± 2 μM.

9. A kit for silencing tea plant CsMADS genes, comprising the antisense inhibition treatment solution described in claim 8.

10. A method for increasing the theobromine content in tea shoots and leaves, which comprises treating the tea shoots and leaves of growing tea plants with the antisense inhibition treatment solution according to claim 8 or the kit according to claim 9.

Citation Information

Patent Citations

  • Tomato SlML1 gene and application

    CN104561025A

  • Method for promoting tea trees to generate secondary metabolites by using endophytic flora

    CN118844259A

  • MADS-box transcription factor derived from tartary buckwheat as well as coding gene and application of MADS-box transcription factor

    CN119039410A

  • Methods and genetic constructs for modification of lignin composition of corn cobs

    US9238818B2