Method for establishing Agrobacterium rhizogenes-mediated catalpa transformation system
By optimizing the Agrobacterium rhizobium transformation system mediated by Agrobacterium rhizobium, the problem of low genetic transformation efficiency of cataloga is solved, and efficient induction and stable expression of cataloga hairy roots is achieved, providing technical support for the study of cataloga gene function and the synthesis of medicinal ingredients.
Patent Information
- Application Number
- CN202510589506.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-08
- Publication Date
- 2025-07-29
AI Technical Summary
At present, there is no stable and efficient genetic transformation system for catalogous trees, which limits the progress of gene function research and related applications of catalogous trees.
By optimizing the concentration of Agrobacter rhizobacter rhizobacter rhizobacter rhizobacter rhizobacter rhizobacter rhizobacterrhea infection solution, vacuum treatment time and treatment location, a Agrobacterrhea rhizobacterrhea mediated catalytic tree transformation system was established, including the preparation of Agrobacterrhea infection solution, pretreatment of catalytic tree seedlings, injection infection at the root-capillary junction, vacuum soaking and coculture, and the hairy root induction conditions were optimized.
It has achieved efficient induction of hairy roots of catalogica tree and screened positive plants, with a short transformation cycle and high transformation efficiency, providing a stable transformation system, providing a technical platform for genetic improvement and functional gene research of catalogica tree, and promoting the biosynthesis of medicinal ingredients.
Smart Images

Figure BDA0005392768260000061 
Figure BDA0005392768260000071 
Figure BDA0005392768260000072
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant genetic engineering and relates to a method for establishing a transformation system of Catalpa ovata mediated by Agrobacterium rhizogenes. Background Art
[0002] Catalpa ovata is a tall deciduous tree in the genus Catalpa of the family Bignoniaceae. Catalpa ovata is native to the woodlands in the northeast, north and west of China. It has strong environmental adaptability and grows rapidly. It is one of the earliest arbors artificially planted in ancient China and has high economic value. The young leaves of Catalpa ovata are edible, and the old leaves, fruits, root bark and wood have good medicinal effects. The wood of Catalpa ovata is light, soft and decay-resistant, and is a good material for making furniture and musical instruments. It is one of the important timber tree species in China. The light yellow bell-shaped corolla of Catalpa ovata has high ornamental value.
[0003] Agrobacterium rhizogenes is a Gram-negative bacterium in the soil, which can cause the proliferation of plant roots to form "hairy roots". This bacterium contains a large plasmid - Ri plasmid, and the T-DNA on it can be integrated into the plant genome during the infection of plants. The transformation of plants mediated by Agrobacterium rhizogenes is an effective plant genetic engineering technology and is widely used in plant functional genomics research.
[0004] Through the transformation method mediated by Agrobacterium rhizogenes, transgenic hairy roots can be induced in a variety of plants. These transgenic hairy roots can not only be used to study the functions of plant genes, but also be used to produce some valuable secondary metabolites. However, there has been no report on a stable and efficient genetic transformation system for Catalpa ovata, which limits the progress of gene function research and related applications of Catalpa ovata. Summary of the Invention
[0005] In order to solve the above problems, the present invention provides a method for establishing a transformation system of Catalpa ovata mediated by Agrobacterium rhizogenes.
[0006] A method for establishing a transformation system of Catalpa ovata mediated by Agrobacterium rhizogenes includes the following steps:
[0007] 1) Prepare an Agrobacterium rhizogenes infection solution;
[0008] 2) Provide Catalpa ovata seedlings and perform cleaning pretreatment;
[0009] 3) Inject and infect near the root-cap junction of Catalpa ovata seedlings;
[0010] 4) Vacuum soaking of the seedlings after injection and infection: Place the seedlings after injection and infection in a sealed container, ensuring that the infection solution completely covers the roots of the seedlings. Use a vacuum pump to evacuate the container, controlling the vacuum pressure at 50 to 80 KPa. During the operation, take 2 seconds of vacuuming and 2 seconds of deflation as a group, and repeat 5 to 10 times. The entire treatment process lasts for 20 to 40 seconds. Through the vacuum operation, it can promote the entry of the infection solution into the interior of the plant tissue to achieve an ideal transformation effect.
[0011] 5) Co-cultivation and hairy root induction.
[0012] Among them, the method for preparing the Agrobacterium rhizogenes infection solution includes: culturing Agrobacterium in a medium containing a selection pressure until the OD 600 value is 0.6 - 1.0. After centrifugation, discard the supernatant and collect the bacterial cells, and dissolve the bacterial cells in an equal volume of MES buffer containing MgCl2 and acetosyringone to the infection concentration.
[0013] Among them, the MES buffer contains 5 mmol·L -1 of MgCl2 and 250 mg·L -1 of acetosyringone.
[0014] Among them, the OD600 value of the Agrobacterium rhizogenes infection solution is 0.6 - 1.0.
[0015] Among them, the pretreatment of the Catalpa ovata seedlings includes obtaining 1 - 2 - month - old Catalpa ovata seedlings through seedling sowing, cleaning the Catalpa ovata seedlings, and soaking the roots in water for later use.
[0016] Among them, the injection and infection near the root - crown junction include performing injection and infection with a depth of 0.5 - 1 mm within 0 - 3 cm above the root - crown junction of the Catalpa ovata seedlings, and the dosage of the infection solution for each injection and infection is 20 - 30 μL. Preferably, a single seedling is injected and infected 8 - 15 times.
[0017] Among them, the co - cultivation and hairy root induction include planting the seedlings after vacuum treatment, covering them with a black plastic bag, and culturing them in the dark in a darkroom for 2 - 3 days, and then transferring them to a climate chamber for hairy root induction culture.
[0018] The present invention has the following advantages:
[0019] 1. The present invention optimizes key factors such as the concentration of bacterial liquid, treatment site, vacuum time, and plant height, and conducts comprehensive optimization through scientific methods such as orthogonal experiments to screen out the combination of conditions with the best genetic transformation efficiency of hairy roots. When the OD600 of the bacterial liquid concentration reaches 0.6, the vacuum treatment time is 30 seconds, the treatment site is 1 - 1.5 cm above the junction of the root cap, and the plant height is 13 - 15 cm, the hairy root induction efficiency and the screening of positive plants perform best, which is suitable for optimizing the transformation system. The operation process is simple, and the transformation cycle only takes 30 days from infection to obtaining positive hairy roots. At the same time, the induction rate of positive hairy root plants is as high as 67%. Compared with traditional tissue culture or somatic embryo transgenic methods, transgenic materials can be obtained in a shorter time, and the transformation efficiency is also greatly improved.
[0020] 2. The present invention provides a stable transformation system for Catalpa ovata. At present, only the somatic embryo transformation method of Catalpa bungei in the genus Catalpa has been reported, and the relevant literature on the stable transformation technology of Catalpa ovata has not been reported. The stable transformation system of the present invention realizes the long-term stable expression of foreign genes in the genome of Catalpa ovata, avoiding the problems of low efficiency and poor stability of transient transformation methods, and providing a reliable technical platform for the genetic improvement and functional gene research of Catalpa ovata.
[0021] 3. The transformation system of the present invention can be used for the biosynthesis application of target compounds. Through genetic engineering technology, a large amount of synthesis and accumulation of medicinal components can be achieved in hairy roots, providing a new way for the modernization of traditional Chinese medicine and the development of natural products, and having important economic value and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 The plant height of the Catalpa ovata seedlings shown.
[0023] Figure 2 Observation of hairy roots is shown. Figure A shows the hairy roots under bright field of a stereomicroscope, with a scale of 1000 μm; Figure B shows the hairy roots under fluorescence of a stereomicroscope, with a scale of 1000 μm.
[0024] Figure 3 The relative expression level of overexpressed PbTPS25 in the hairy roots of Catalpa ovata is shown. DETAILED DESCRIPTION OF THE INVENTION
[0025] The following examples are used to illustrate the present invention, but are not used to limit the scope of the present invention.
[0026] In order to better understand the above technical solutions, the above technical solutions will be described in detail below in combination with the drawings of the specification and specific embodiments.
[0027] 50 mg·mL -1 Kanamycin (Kan); 50 mg·mL -1Spectinomycin (Spec); 0.5 mol·L -1 2-(N-morpholino)ethanesulfonic acid (MES) (pH 5.7); 50 mg·mL -1 Acetosyringone (AS); 0.5 mol·L -1 MgCl2; TY medium (1 L): Tryptone 5.0 g, Yeast Extract 3.0 g, pH = 7.0, sterilization conditions: 121 °C, 20 min. Prepare 1 M calcium chloride aqueous solution and sterilize it at 121 °C for 20 min. Add 1 mL of sterile 1 M calcium chloride aqueous solution to every 100 mL of sterilized TY liquid medium. If preparing TY solid medium, add Agar 15.0 g. Agrobacterium rhizogenes Ar.A4 strain (Weidi, Shanghai).
[0028] Example 1
[0029] I. Sowing and breeding
[0030] Sow the seeds in wet sand and germinate them until they grow to 3 - 5 leaves and the plant height reaches 5 - 20 cm to obtain the required Catalpa ovata seedlings. During the Catalpa ovata seedling stage, after germination, use a temperature of 26 °C / 22 °C (day / night), light for 16 h / dark for 8 h, and the light intensity is 30 - 50 μmol·m -2 ·s -1 , and spray water with a watering can once every two days to ensure the moisture and humidity during the seed germination and seedling growth process.
[0031] II. Agrobacterium rhizogenes transformation
[0032] Take out the preserved Ar.A4 Agrobacterium rhizogenes competent cells from the -80 °C ultra-low temperature refrigerator and melt them on ice. Add 1 μg of pK7WGF2-GFP and pK7WGF2-GFP-PbTPS25 vector plasmids to every 100 μL of competent cells, mix well, and then place them on ice for 5 min, in liquid nitrogen for 5 min, in a 37 °C water bath for 5 min, and in an ice bath for 5 min in sequence. Take them out from the ice bath and place them at room temperature, add 700 μL of TY liquid medium without antibiotics, and culture them with shaking at 28 °C for 2 hours. Centrifuge at 6000 rpm for 1 minute to collect the bacteria, retain about 100 μL of the supernatant, gently pipette and resuspend the bacterial pellet, and spread it on a TY plate containing 50 mg·L -1 kanamycin and 50 mg·L -1 spectinomycin, invert it and place it in an incubator at 28 °C for 2 - 3 d. Pick a single colony into 700 μL of TY containing 50 mg·L -1 kanamycin and 50 mg·L-1 Spectinomycin was cultured overnight at 28 °C with shaking at 200 rpm in liquid TY medium.
[0033] III. Preparation of Agrobacterium infection solution
[0034] 500 μL of the Agrobacterium liquid of the empty vector control pK7WGF2-GFP (Ar. A4 strain) and the target gene pK7WGF2-GFP-PbTPS25 (Ar. A4 strain) was inoculated into TY liquid medium containing 50 mg·L -1 kanamycin and 50 mg·L -1 spectinomycin, and cultured with shaking at 28 °C and 200 rpm until the bacterial liquid concentration was expanded to an OD 600 value of 0.6 - 1.0. After centrifugation at 5500 rpm for 15 min, the bacterial liquid was collected, the supernatant was discarded, and the enriched bacteria were resuspended in an equal volume (50 mL) of 2-(N-morpholino)ethanesulfonic acid (MES) buffer (10 mmol·L -1 MES-KOH, pH = 5.7, 5 mmol·L -1 MgCl2, 250 mg·L -1 acetosyringone) for use in infection. PbTPS25 is the caryophyllene synthase gene of Phoebe bournei, which is transformed into the hairy roots of Catalpa ovata, enabling Catalpa ovata to synthesize caryophyllene, and caryophyllene has an antibacterial effect.
[0035] IV. Agrobacterium infection
[0036] Prepare Catalpa ovata seedlings (about 3 - 5 leaves) that are 1 - 2 months old, plastic pots, paper towels, 1 mL syringes, 50 mL / 100 mL syringes, two 120 mm glass petri dishes, black plastic bags, seedling pots, etc. Divide 100 mL of freshly prepared infection solution into two parts and pour them into glass petri dishes for standby. One part of the infection solution is used for vacuum pumping, and the other part is used for syringe aspiration of the infection solution. Wash the Catalpa ovata seedlings clean and soak the roots in water for later use. Take a 1 mL syringe and aspirate 200 - 300 μL of the infection solution. Place the seedlings on a clean paper towel, gently insert the needle 0.5 - 1 mm deep within the range of 0 - 3 cm above the junction near the root cap of the Catalpa ovata seedlings and inject 20 - 30 μL of the infection solution until the paper towel is wet. Do not pierce through the stem of the seedlings with the needle. One seedling can be injected 8 - 15 times. Continuous injection from top to bottom in the same direction and angle is convenient for operation. If the roots near the seeds of the seedlings are thick, about 3 - 4 mm in diameter, and there is more white part in the roots, the stem can be wound around for infection.
[0037] V. Vacuum pumping method to promote transformation efficiency
[0038] Place the inoculated seedlings in a sealed container, ensuring that the inoculation solution completely covers the roots of the seedlings. Evacuate the container to a vacuum pressure of 50 to 80 KPa. Take 2 seconds of evacuation and 2 seconds of deflation as a group, repeat 5 to 10 groups, and the entire treatment process lasts for 20 to 40 seconds. Then take out the seedlings, soak the roots of the seedlings in the inoculation solution, repeat the above steps until all Catalpa ovata seedlings have been treated with vacuum evacuation, and then plant the seedlings back into the sand together. Cover the infected part with sand and water thoroughly with a watering can to prevent the seedlings from dying of drought due to water loss.
[0039] VI. Co-culture and hairy root induction
[0040] Cover the inoculated seedlings with black plastic bags and culture them in the dark for 2 d, and then transfer them to a climate chamber for hairy root induction culture. The conditions for induction culture are: temperature 26°C / 22°C (day / night), light 16 h / dark 8 h, light intensity is 50 μmol·m -2 ·s -1 , humidity 70 - 85%. After inoculation, cover the seedlings with a moisturizing transparent plastic cover on the seedling tray to maintain a moist environment. After culturing for one week, lift the lid. When starting hairy root induction, irrigate with a rooting-promoting nutrient solution (Stanley, USA) every 10 - 15 d until the sand fully absorbs the nutrient solution.
[0041] VII. Detection of transformed hairy roots
[0042] After 60 days, observe and count the rooting situation of the stems of Catalpa ovata seedlings, and use a handheld fluorometer to detect the Catalpa ovata seedlings to count the number of plants with successfully induced transformed hairy roots. Then detect the fluorescence of the hairy roots under a stereoscopic fluorescence microscope and take pictures for recording. Identify the expression of PbTPSa25 by fluorescence quantitative PCR.
[0043] Experimental example 1
[0044] Based on the careful observation of the factors that may affect the hairy root induction during the experiment in the early stage, an orthogonal experiment with three levels was carefully designed for the four key factors of the concentration of the inoculated bacterial solution, the vacuum treatment time, the treatment site, and the plant height ( Figure 1 ). Using the L9(4 3 ) orthogonal experiment table (Table 1), after 40 - 60 days of careful cultivation, in order to optimize the existing transformation system and screen out the key factors and optimal conditions affecting the induction of hairy roots on the stems of Catalpa ovata seedlings, detailed observation and statistical work were carried out.
[0045] Induction rate of hairy root plants / % = (number of plants with hairy roots / total number of inoculated plants) × 100
[0046] Positive rate of hairy root plants / % = (number of plants with positive hairy roots / number of plants with hairy roots) × 100
[0047] Positive hairy root plant induction rate / % = (Number of positive hairy root plants / Total number of infected plants) × 100
[0048] Positive rate of hairy roots / % = (Number of positive hairy roots / Total number of hairy roots) × 100
[0049] Table 1 Orthogonal experiment design of four factors and three levels
[0050]
[0051]
[0052] 1) Optimization results of the hairy root transformation system
[0053] From the results of the orthogonal experiment design (Table 2), it can be seen that the bacterial liquid concentration, vacuum treatment time, and treatment site have significant effects on the induction rate and positive rate of hairy roots. The positive rate of hairy root plants in treatment group 8 (bacterial liquid concentration 1.0, vacuum treatment time 30 s, treatment site 0 - 0.5 cm above the junction of root cap, plant height 18 - 20 cm) is the highest, indicating that these factors can induce a higher positive rate of hairy roots in plants. Treatment group 2 (bacterial liquid concentration 0.6, vacuum treatment time 30 s, treatment site 1 - 1.5 cm above the junction of root cap, plant height 13 - 15 cm) shows a higher induction rate of hairy roots and positive rate of hairy root plants, indicating that treatment group 2 can be used as the optimal conditions for the induction of Catalpa ovata G. Don hairy roots and the screening of positive plants.
[0054] Table 2 Effects of different treatments on the genetic transformation of Catalpa ovata G. Don hairy root plants
[0055]
[0056] 2) Identification of the hairy root transformation system
[0057] After the infection treatment of Catalpa ovata G. Don seedlings with Agrobacterium rhizogenes, transgenic positive root tissue materials were successfully obtained. To verify the effectiveness of the hairy root transformation system, Catalpa ovata G. Don hairy roots were observed under bright field and fluorescence microscopes respectively. The results showed that there was a green fluorescence signal in the hairy roots ( Figure 2 ). It indicates that the target gene PbTPS25 has been successfully integrated into and expressed in the hairy roots of Catalpa ovata G. Don.
[0058] RNA of hairy roots with GFP fluorescence in Catalpa ovata G. Don seedlings transformed with empty vector and PbTPSa25 was extracted using the RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (Tiangen, Beijing), and PrimeScript TMcDNA was obtained by reverse transcription using RT MasterMix (Takara, Dalian). The reverse transcription program was: 37°C for 15 min; 85°C for 5 sec. According to TB Premix Ex Taq TM Ⅱ fluorescence quantitative kit (Takara, Dalian) was used for real-time fluorescence quantitative detection (qRT-PCR). In this experiment, a 10 μL reaction system was used, including: 5 μL TB Green Premix Ex TaqⅡ, 0.5 μL each of the upstream and downstream primers, 3 μL cDNA, and 1 μL ddH2O. The reaction program was: first pre-denaturation at 95°C for 30 sec, then 95°C for 5 sec, 60°C for 30 sec, 72°C for 20 sec, for 39 cycles, followed by 65°C for 5 sec, and finally 95°C for 5 min.
[0059] PbTPSa25: Upstream primer (5’-3’): GTTTTTGCAAGGGCAACTCT; Downstream primer (5’-3’): GCATCCTTTCTGGGGACATA.
[0060] Internal reference gene EF1α: Upstream primer (5’-3’): CATTCAAGTATGCGTGGGT; Downstream primer (5’-3’): ACGGTGACCAGGAGCA.
[0061] Using the above primers of PbTPSa25 and the internal reference gene EF1α, with the untransformed wild-type material as a control, a qRT-PCR experiment was carried out, and the 2-ΔΔCT method was used to calculate the expression level of PbTPSa25 in the hairy roots of Catalpa ovata G. Don.
[0062] As Figure 3 shown, the expression level of the PbTPS25 gene in the transgenic hairy roots was significantly higher than that of the wild type (WT), indicating that the target gene had been successfully integrated and highly expressed.
[0063] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the technical principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.
Claims
1. A method for establishing an Agrobacterium rhizogenes-mediated transformation system for Catalpa ovata G. Don, characterized in that, It includes the following steps: 1) Prepare the Agrobacterium rhizogenes infection solution; 2) Provide Catalpa ovata seedlings and conduct cleaning pretreatment; 3) Inject and infect near the junction of the root and crown of the Catalpa ovata seedlings; 4) Vacuum soak the seedlings after injection and infection: Place the seedlings after injection and infection in a sealed container, ensure that the infection solution completely covers the roots of the seedlings, conduct vacuum treatment on the container, control the vacuum pressure at 50 to 80 KPa, take 2 seconds of vacuum pumping and 2 seconds of air release as a group, repeat 5 to 10 groups, and the entire treatment process lasts for 20 to 40 seconds; 5) Co-culture and hairy root induction.
2. The establishment method according to claim 1, wherein The OD600 value of the Agrobacterium rhizogenes infection solution is 0.6 - 1.
0.
3. The establishment method according to claim 1, wherein The step of providing Catalpa ovata seedlings and conducting cleaning pretreatment includes obtaining Catalpa ovata seedlings that are 1 - 2 months old through direct seeding, cleaning the Catalpa ovata seedlings, and soaking the roots in water for later use.
4. The establishment method according to claim 3, characterized in that The plant height of the Catalpa ovata seedlings is 5 - 20 cm.
5. The establishment method according to claim 1, characterized in that, The injection and infection near the junction of the root and crown includes injecting and infecting at a depth of 0.5 - 1 mm within 0 - 3 cm above the junction of the root and crown of the Catalpa ovata seedlings, and the dosage of the infection solution for each injection and infection is 20 - 30 μL.
6. The establishment method according to claim 5, characterized in that, Inject and infect a seedling 8 - 15 times.
7. The establishment method according to claim 1, characterized in that, The co-culture and hairy root induction includes planting the seedlings after vacuum treatment, covering them with a black plastic bag and culturing them in a dark room away from light for 2 - 3 d, and then moving them to a climate chamber for hairy root induction culture.