Method for creating brassica oleracea haploid and polyploid and application

By combining the corn CenH3 gene with the Brassica CenH3 gene, BMCenH3 was constructed and the CRISPR/Cas9 system was used to solve the species and genotype limitations induced by haploid and polyploids in cabbage vegetables, and the rapid acquisition of haploids and polyploids was achieved, breaking through the technical bottleneck of lethal CenH3 gene.

CN120384101AActive Publication Date: 2025-07-29BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202410112012.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-01-26
Publication Date
2025-07-29
Estimated Expiration
2044-01-26

AI Technical Summary

Technical Problem

The prior art is difficult to widely use haploid and polyploid induction in cabbage vegetables, especially the problem of mutation lethality of the CenH3 gene limits the application of haploid induction in dicotyledon plants.

Method used

By combining the C-terminal of the corn CenH3 gene with the N-terminal of the Brassica CenH3 gene, the synthetic gene BMCenH3 gene was constructed, and the endogenous BolKCenH3 gene of Brassica was knocked out using the CRISPR/Cas9 system, and the BMCenH3 gene was overexpressed at the same time, and knocked out the BolKPLD1 gene in combination with gene editing, functional complementarity and gene deletion were achieved, and Brassica haploid and polyploid materials were obtained.

Benefits of technology

It breaks through the technical bottleneck of homozygous knockout lethality of CenH3 gene, realizes the induction of Brassica haploid and polyploid, provides a method to quickly obtain haploid and polyploid, breaks through species and genotype restrictions, and promotes the breeding process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004683716270000111
    Figure BDA0004683716270000111
  • Figure BDA0004683716270000121
    Figure BDA0004683716270000121
  • Figure BDA0004683716270000131
    Figure BDA0004683716270000131
Patent Text Reader

Abstract

The invention discloses a method for creating haploids and polyploids of brassica oleracea and application of the haploids and polyploids of the brassica oleracea. The invention belongs to the technical field of biology, and particularly relates to a method for creating brassica oleracea haploid and polyploidy and application of the brassica oleracea haploid and polyploidy. The method for preparing the brassica vegetable haploid and / or polyploid comprises the following steps: (1) fusing the C end of corn CenH3 and the N end of brassica CenH3 into BMCenH3, and constructing and editing a complementary vector; (2) constructing a brassica PLD1 gene knockout vector; (3) transforming receptor brassica vegetables by using the vectors constructed in the step (1) and the step (2) to obtain a CenH3 and PLD1 knockout mutant; (4) carrying out continuous selfing on the mutant strain to obtain a cenh3 homozygous mutant strain and a pld1 homozygous mutant strain under the background of expressing the BMCenH3 gene; hybridizing the homozygous mutant strain with other brassica plants, and screening to obtain a brassica haploid and / or polyploid material.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a method for creating haploids and polyploids of brassica vegetables and its applications. Background Art

[0002] Ploidy breeding has always been the core of crop variety improvement, including polyploid breeding and haploid breeding. Polyploid breeding has a glorious history and has achieved remarkable results in various plants. It is an important force promoting biological evolution and genetic diversity. Polyploid plants have strong plasticity, that is, after chromosome polyploidization, the genetic variation range of the species is broadened and the buffering ability against external stresses is enhanced, which is beneficial to creating high-quality and high-yield new varieties, enhancing the disease resistance, stress resistance, growth rate and edibility of plants. The creation of vegetable polyploid germplasm is an important way to cultivate new varieties of high-quality and high-yield vegetables, providing a new idea for the genetic improvement of vegetable quality traits and germplasm innovation.

[0003] Haploid breeding has significant advantages in shortening the breeding cycle, improving the selection efficiency and trait research. In recent years, some progress has been made in various haploid induction techniques mainly based on tissue culture, bringing considerable scientific and economic value. However, the acquisition of haploids still faces the bottleneck of species and genotype limitations. Establishing a widely applicable haploid induction technique is the key to seizing the international advantage in the field of national improved varieties.

[0004] Brassica vegetables belong to the genus Brassica of the Cruciferae family and are an economically important vegetable crop, including cabbage, cauliflower, broccoli, kale, etc., accounting for more than 30% of the national vegetable planting area. Although great progress has been made in the haploid induction technique of microspore culture in Brassica vegetables, there are still technical barriers such as dependence on tissue culture, limitation by species and genotype, and low induction rate. In recent years, rapid progress has been made in the research on creating haploid induction lines of major crops using gene editing technology. This technology only needs to modify individual genes to create haploid induction lines, enabling the direct production of haploid offspring by crossing with wild-type plants. This haploid induction method is not limited by species and genotype and has great application value in production. Moreover, there are many Brassica species and hybridization is easy. If haploid and polyploid induction lines can be created by modifying only one gene, it will have great application value. However, the ploidy induction ability of some genes and their application research in Brassica vegetable crops have not been carried out yet. In particular, the lethal mutation of the CenH3 gene is a technical bottleneck in its application in haploid induction of dicotyledonous plants. Summary of the Invention

[0005] The technical problem to be solved by the present invention is: how to create induction lines and apply them to quickly obtain haploids or polyploids of Brassica.

[0006] To solve the above technical problems, the present invention provides a method for preparing haploid and / or polyploid Brassica vegetables.

[0007] The method for preparing haploid and / or polyploid Brassica vegetables provided by the present invention comprises the following steps:

[0008] (1) Combine the C-terminus of the maize CenH3 gene with the N-terminus of the Brassica CenH3 gene to obtain a synthetic gene BMCenH3, construct a functional complementation editing vector, which contains an editing target, knockout the endogenous BolKCenH3 gene in Brassica, and simultaneously overexpress the introduced BMCenH3 gene as a functional complement of the BolKcenh3 mutant ( Figure 1 in i);

[0009] (2) A phospholipase gene BolKPLD1 highly expressed in cauliflower pollen was obtained through transcriptome data analysis and quantitative expression verification ( Figure 2 ), and a gene editing knockout vector was constructed for this gene ( Figure 1 in ii);

[0010] (3) Transform the functional complementation editing vector described in step (1) into the recipient Brassica vegetables to obtain a functional deletion mutant BolKcenh3 that expresses the BMCenH3 gene and has the BolKCenH3 gene knocked out, denoted as BMCenH3 / BolKcenh3; transform the gene editing knockout vector described in step (2) into the recipient Brassica vegetables to obtain a BolKPLD1 knockout functional deletion mutant denoted as BolKpld1;

[0011] (4) Continuously self-cross the BMCenH3 / BolKcenh3 T0 generation edited plants obtained in step (3) to obtain T1 and T2 generation edited plants. BMCenH3 and BolKcenh3 are separated and combined as two genes alone. Through molecular identification, heterozygous and homozygous plants that only express BMCenH3 (i.e., + / BMCenH3 and BMCenH3 / BMCenH3) and homozygous mutations of BolKcenh3 under the background of expressing BMCenH3 are obtained, denoted as: + / BMCenH3 BolKcenh3 / BolKcenh3, or BMCenH3 / BMCenH3BolKcenh3 / BolKcenh3. Continuously self-cross and identify the BolKpld1 T0 generation edited plants obtained in step (3) to obtain BolKpld1 homozygous edited knockout plants, denoted as BolKpld1 / BolKpld1;

[0012] (5) Use the different types of edited and modified mutants of CenH3 obtained in step (4) as the male or female parent, and use BolKpld1 / BolKpld1 as the male parent to cross with other Brassica plants to obtain hybrid offspring, and screen the hybrid offspring to obtain Brassica haploid and / or polyploid materials.

[0013] The edited and modified mutants can be + / BMCenH3, BMCenH3 / BMCenH3, + / BMCenH3BolKcenh3 / BolKcenh3, BMCenH3 / BMCenH3 BolKcenh3 / BolKcenh3.

[0014] The nucleotide sequence of the BMCenH3 gene is sequence 1 in the sequence listing, and the encoded protein sequence is sequence 2.

[0015] The coding sequence (CDS) of the BolKCenH3 gene is sequence 3 in the sequence listing, the genomic sequence is sequence 4 in the sequence listing, and the encoded protein sequence is sequence 5.

[0016] The coding sequence (CDS) of the BolKPLD1 gene is sequence 6 in the sequence listing, the genomic sequence is sequence 7 in the sequence listing, and the encoded protein sequence is sequence 8.

[0017] In the above method, the gene editing is carried out by knocking out through the CRISPR / Cas9 system.

[0018] In the above method, the functional complementation editing vector contains the gene editing target site of BolKCenH3, and the target site sequence is the 456-477th nucleotide of sequence 3 (corresponding to the 1138-1159th position of genomic sequence 4) (sequence 9).

[0019] In the above method, the gene editing knockout vector contains the gene editing target site of BolKPLD1, and the target site is the 1849-1870th nucleotide of sequence 6 (corresponding to the 2515-2536th position of genomic sequence 7) (sequence 10).

[0020] In the above method, the starting vector used for the gene editing is the knockout vector pBSE401, and the recombinant vectors used for the gene editing are pBSE401-BolKCenH3 or pBSE401-BolKpld1.

[0021] The structure of the knockout vector pBSE401 - BolKCenH3 is described as follows: The pBSE401 vector was digested with the restriction enzyme BsaI and the vector backbone was recovered, and the target double-stranded DNA (sequence 9) of BolKCenH3 was ligated to the vector backbone. The resulting recombinant vector with the correct sequence was denoted as pBSE401 - BolKCenH3.

[0022] Then, the pBSE401 - BolKCenH3 vector was digested with the restriction enzyme EcoRI and recovered, and ligated to the BMCenH3 sequence (sequence 1). The recombinant vector was denoted as pBSE401 - BolKCenH3 - BMCenH3.

[0023] The structure of the recombinant vector pBSE401 - BolKCenH3 - BMCenH3 is described as follows: The restriction enzyme EcoRI cleavage site fragment of the pBSE401 - BolKCenH3 vector was replaced with the BMCenH3 sequence (sequence 1), and the resulting recombinant vector with other sequences of the vector remaining unchanged.

[0024] The structure of the knockout vector pBSE401 - BolKpld1 is described as follows: The pBSE401 vector was digested with the restriction enzyme BsaI and the vector backbone was recovered, and the target double-stranded DNA (sequence 10) of BolKpld1 was ligated to the vector backbone. The resulting recombinant vector with the correct sequence was denoted as pBSE401 - BolKpld1.

[0025] In the above method, the recipient Brassica vegetable in step (3) can be cauliflower "Korso_1401" (articles and patent documents).

[0026] In the above method, the other Brassica plants in step (5) can be cauliflower "y16 - 2 - 11" or "Qingmei 80", broccoli "Yanxiu" or kale "Jingguan Red No. 6".

[0027] In the above method, the screening in step (5) includes the following methods:

[0028] A1), Molecular marker-assisted screening;

[0029] A2), Flow cytometry identification of leaf ploidy-assisted screening.

[0030] In the above method, the molecular marker-assisted screening is specifically the following molecular markers: BrID10303, BrID10041, BrID10275, BrID101185, BrID90295, BrID10729, BrID10703, BrID10205.

[0031] The detection primer information of the molecular markers is shown in Table 1 below.

[0032] Table 1. Detection primer information of molecular markers

[0033] Primer Name Forward Primer (5’-3’) Reverse Primer (5’-3’) BrID10303 GAATACTTACCCCGTTGTTG CTACACCGGTTTTTAAAGTG BrID10041 AGGCCATGTTAGCCATTAC GCACCTGATTACTTCAAAGC BrID10275 AGACCACCGCTAGTTAAAAA ATCTTCCAAAGGGAGAGAAG BrID101185 ATAAGGGGACCCTGTAAAAA TTCTGTCAACTAACATCCCA BrID90295 CACAAAGCTCACTTCTTAGGCA TATAGCCTTGCGGTGGAGTT BrID10729 GTATGATGATGTATCCAGACAG GCTAAAAGCCTAACACAAAG BrID10703 CCTGGCATGATGATGTTTA AGTAATTAAGCAAGCATCGG BrID10205 ACGCAAAGTCACTCAACAA GTTGTCTTTGCTCTTATCGG

[0034] Among them, 4 pairs of molecular markers (BrID10303, BrID10041, BrID10275, BrID10729) are polymorphic in "Korso_1401" and "Qingmei 80"; 5 pairs (BrID10303, BrID10041, BrID10275, BrID101185, BrID90295) are polymorphic in "Korso_1401" and broccoli "Yanxiu"; 7 pairs (BrID10303, BrID10041, BrID10275, BrID90295, BrID10703, BrID10205, BrID10729) are polymorphic in "Korso_1401" and kale "Jingguan Red No. 6".

[0035] The present invention also provides a method for breeding Brassica vegetables, which is carried out by the method described above; the purpose of breeding Brassica vegetables includes cultivating haploid and / or polyploid materials of Brassica.

[0036] The application of the above method in creating haploid and / or polyploid of Brassica also belongs to the scope protected by the present invention.

[0037] The present invention also provides the synthetic genes BMCenH3 and BolKPLD1 described above.

[0038] The present invention also provides the sgRNA described above, and the sgRNA is a DNA molecule of sequence 9 or sequence 10.

[0039] The present invention discloses a method and application for inducing the generation of haploids and polyploids (tetraploids) of various variants of Brassica oleracea vegetables (and even other species of Brassica). Among them, ① the C-terminal of the Brassica CenH3 gene is modified, and the C-terminal of the heterologous CenH3 gene is used to replace (or other modifications), and while overexpressing the modified gene, the CRISPR / Cas9 technology is used to knockout the endogenous CenH3 gene of cauliflower, and different types of edited and modified plant combinations are obtained, including: 1) transformants that only overexpress the modified gene, 2) different combinations that both overexpress the modified CenH3 gene and knockout the endogenous CenH3 gene. Using the above mutant plants as male and female parents to hybridize with other Brassica materials can produce haploids and tetraploids. ② Gene editing is used to knockout the BolKPLD1 gene of Brassica, and the obtained homozygous knockout mutants are used as male parents to hybridize with other Brassica materials, which can produce haploids.

[0040] Since the homozygous knockout of the CenH3 gene will affect the survival and fertility of plants, this knockout lethality has always been a technical difficulty in applying this gene to the induction of ploidy in dicotyledonous plants. The present invention addresses the technical bottleneck of homozygous knockout lethality of the CenH3 gene. The C-terminal of the maize CenH3 gene is combined with the N-terminal of the Brassica CenH3 gene to obtain a synthetic gene BMCenH3; a complementary editing vector is constructed, which contains an editing target. While knocking out the endogenous BolKCenH3 gene in Brassica, the expression of the BMCenH3 gene is introduced as a functional complement to the BolKcenh3 mutant. The technical bottleneck of CenH3 gene knockout lethality is broken through, and for the first time, the application of the CenH3 gene in ploidy induction in Brassica is realized, and haploid and / or polyploid Brassica are obtained.

[0041] Cauliflower plants with overexpression of the heterologous C-terminal modified CenH3 gene, a series of allelic mutations of the CenH3 gene, and combined modification of both. And the haploid and tetraploid induction functions were demonstrated by hybridization.

[0042] The BolKPLD1 gene was edited and knocked out by gene editing. The BolKpld1 mutant cauliflower was used as the male parent to cross with other Brassica materials, and its maternal haploid induction function was demonstrated.

[0043] Heterologous modification (or replacement) overexpression, mutation of cauliflower CenH3, and knockout of the PLD1 gene can lead to the production of haploids and tetraploids of various varieties of Brassica oleracea, providing new ideas and research materials for revealing the biological roles played by centromere functional genes and phospholipase functional genes in the process of haploidization and polyploidization in Brassica.

[0044] At the same time, the modified individual plants obtained by the present invention have the ability to induce haploids, which is of great significance for breaking through the bottleneck that the acquisition of Brassica haploids is restricted by species and genotypes, realizing the wide application of haploid induction lines in the future, and accelerating the breeding process. At the same time, the induction line also has the ability to induce tetraploids. The multi-resistance and high yield of tetraploids in the field provide new ideas for the breeding of polyploid (tetraploid and triploid breeding) of Brassica oleracea vegetables. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Schematic diagrams of the BolKCenH3 knockout complementary vector and gene structure, target, and mutation sites (i); and schematic diagrams of the BolKPLD1 knockout vector and gene structure, target, and mutation sites (ii).

[0046] Figure 2 Expression of the BolKPLD1 gene in different tissues of cauliflower "Korso_1401".

[0047] Figure 3PCR detection of resistant T0 generation plants after Basta test strip detection. M: The standard DNA molecular weight (Trans2K plus DNA Marker) is on the far left; Lane 1 is the positive control (engineered bacteria), and Lane 2 is the negative control (untransformed cauliflower DNA); Lanes 3-24 show the detection results of resistant regenerated plants.

[0048] Figure 4 PCR sequencing results of BolKCenH3 knockout cauliflower plants, and the sequencing primer is: CEN-546.

[0049] Figure 5 Flow cytometry diagrams of diploid "Yanxiu" and haploids and tetraploids in the offspring of the cross between "Yanxiu" and mutants (+ / BMCenH3 BolKcenh3-1 / BolKcenh3-1).

[0050] Figure 6 PCR electrophoresis diagram of molecular marker BrID10729 in the offspring of the cross with mutant (BMCenH3 / BMCenH3 BolKcenh3-2 / BolKcenh3-2) as the female parent and kale "Jingguan Red No. 6" as the male parent. Lane 1 shows the band pattern of "Jingguan Red No. 6", Lane 2 shows the band pattern of the "female parent mutant", Lane 3 is the band pattern of the heterozygous diploid in the offspring, Lanes 4 and 5 are the band patterns of the haploids in the offspring, and Lane 6 is the band pattern of the tetraploid in the offspring.

[0051] Figure 7 Phenotype diagrams of haploids and tetraploids. Among them, a: Phenotype screening of the offspring of the cross between mutant (BMCenH3 / BMCenH3BolKcenh3-2 / BolKcenh3-2) and yellow-leaf cauliflower "y16-2-11". The arrow indicates the haploid plant seedlings with yellow leaves (left) and comparison with the adjacent parent after being transplanted to the greenhouse and growing a little larger (right); b: Offspring of the cross between kale "Jingguan Red No. 6" and mutant BolKpld1-1 / BolKpld1-1. Most plants show intermediate phenotypes of the F1 hybrid of kale and cauliflower, with large plants and strong growth. The left arrow indicates the haploid detected by flow cytometry, which is short and consistent with the traits of the parent kale "Jingguan Red No. 6". The right picture shows the comparison with the adjacent parent after being transplanted to the greenhouse and growing a little larger; c: Seedling stage of diploid "Qingmei 80" and its haploid offspring plants; d: Diploid "Qingmei 80" has many and plump pollen, while its haploid offspring have smaller flowers and no pollen; e: Maturity stage of diploid "Qingmei 80" and its haploid offspring. As shown by the arrow, the seed pods of "Qingmei 80" are plump and contain seeds; the seed pods of the haploid are small and shriveled and contain no seeds; f: The field performance of tetraploids is inconsistent, but most show high yield and high resistance. The arrow indicates the diploid control, and the two plants beside are tetraploids. Specific implementation methods

[0052] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way.

[0053] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0054] In the following embodiments, the quantitative experiments are all set up with three repeated experiments unless otherwise specified.

[0055] The vector pBSE401 in the following embodiments has been described in: Zong Mei, Han Shuo, Guo Ning, Duan Mengmeng, Liu Fan, Wang Guixiang. Obtaining non-transgenic Brassica parachinensis mutants by vacuum infiltration and CRISPR / Cas9 system. Biotechnology Bulletin, 2022, 38(10): 159-163. The public can obtain this biological material from the applicant. This biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0056] The cauliflower "Korso_1401" in the following embodiments is a cauliflower inbred line preserved by this laboratory and has been described in: Guo N, Wang S, Gao L, Liu Y, Wang X, Lai E, Duan M, Wang G, Li J, Yang M, Zong M, Han S, Pei Y, Borm T, Sun H, Miao L, Liu D, Yu F, Zhang W, Ji H, Zhu C, Xu Y, Bonnema G, Li J, Fei Z, Liu F. 2021, Genome sequencing sheds light on the contribution of structural variants to Brassica oleracea diversification. BMC Biol. 2021, 19: 93. doi: 10.1186 / s12915-021-01031-2. The public can obtain this biological material from the applicant. This biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0057] The yellow-leaf cauliflower "y16-2-11" in the following examples was created by our laboratory. It is a leaf-color chlorosis mutant that occurred during the backcross of the somatic hybrid of cauliflower "Korso_1401" and black mustard with "Korso_1401". Through continuous backcrossing and self-crossing, it was identified as a recessive leaf-color chlorosis cauliflower mutant and has now been stabilized as a cauliflower-black mustard introgression line with the background of "Korso_1401". The public can obtain this biological material from the applicant. This biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0058] The cauliflower "Qingmei 80" and broccoli "Yanxiu" in the following examples are commercial varieties and can be purchased from Shouhe Seed Industry Xinxinran Company.

[0059] The kale "Jingguan Red No. 6" in the following examples is a commercial variety and can be purchased from Jingyan Seed Industry Company.

[0060] In the following examples, SPSS 11.5 statistical software was used to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA test was used. P < 0.05 (*) indicates significant difference, P < 0.01 (**) indicates extremely significant difference, and P < 0.001 (***) indicates extremely significant difference.

[0061] Example 1: Creation method of haploid and polyploid induction lines of Brassica oleracea vegetables

[0062] 1. Construction of cauliflower BolKCenH3 gene knockout complementary vector

[0063] (1) Knockout of cauliflower BolKCenH3 gene by CRISPR / Cas9 system

[0064] The BolKCenH3 gene sequence is Sequence 3 in the sequence listing. The structure and schematic diagram of the CRISPR / Cas9 system knockout target site are shown in Figure 1 (i). A target site sequence with a length of 22 bp was designed on the 8th exon sequence of the cauliflower BolKCenH3 gene (the genomic nucleotide sequence is Sequence 4 and the coding sequence is Sequence 3). sgRNA1: 5'-GCTTTGCGCTATCCATGCAAGG-3' (Sequence 9).

[0065] The double-stranded DNA molecule shown in Sequence 9 was inserted into the corresponding site of the sgRNA-Cas9 double-expression vector pBSE401 to obtain the CRISPR / Cas9 knockout vector pBSE401-BolKCenH3 (verified by sequencing).

[0066] The structure of the knockout vector pBSE401 - BolKCenH3 is described as follows: A DNA fragment with the sequence of Sequence 9 in the sequence listing was inserted between the restriction endonuclease BsaI of the pBSE401 vector, and the other sequences of the pBSE401 vector were kept unchanged to obtain the recombinant plasmid. The knockout vector pBSE401 - BolKCenH3 contains an expression cassette for expressing sgRNA1 and a Cas protein expression cassette.

[0067] (2) Complementary overexpression of the BMCenH3 gene in the knockout vector pBSE401 - BolKCenH3

[0068] The C - terminus of the Maize CenH3 gene was combined with the N - terminus of the Brassica CenH3 gene to obtain the synthetic gene BMCenH3. The specific nucleotide sequence is Sequence 1 in the sequence listing, which was synthesized by Beijing Tianyi Huiyuan Company. During synthesis, a 35S promoter and an EcoRI restriction site were added.

[0069] The double - stranded DNA molecule shown in the synthesized Sequence 1 was inserted into the EcoRI site of the pBSE401 - BolKCenH3 vector to obtain the editing complementary vector pBSE401 - BolKCenH3 - BMCenH3 (which has been verified by sequencing). The schematic diagram of the editing complementary vector is as Figure 1 (i), and the schematic diagram of the pBSE401 editing vector is as Figure 1 (ii).

[0070] The structure of the complementary editing vector pBSE401 - BolKCenH3 - BMCenH3 is described as follows: The fragment of the pBSE401 - BolKCenH3 vector restricted by the restriction endonuclease EcoRI was inserted into the DNA fragment with the sequence of Sequence 1, and the other sequences of the pBSE401 - BolKCenH3 vector were kept unchanged to obtain the recombinant plasmid.

[0071] 2. Construction of the cauliflower BolKPLD1 gene knockout vector.

[0072] The BolKPLD1 gene is a phospholipase gene that was found to be highly expressed in cauliflower pollen through transcriptome analysis. Through reverse transcription quantitative analysis, it was found that its expression level is relatively high in cauliflower flower heads and pollen ( Figure 2 ).

[0073] The BolKPLD1 gene sequence is Sequence 6 in the sequence listing. The structure and the schematic diagram of the CRISPR / Cas9 system knockout target site are shown in Figure 1(ii). Design a target site sequence on the second exon sequence of the BolKPLD1 gene (the genomic nucleotide sequence is Sequence 7 and the coding sequence is Sequence 6) in cauliflower, with a length of 22 bp, sgRNA2: 5'-CCTAGAAACTATCTGACGTTCT-3' (Sequence 10).

[0074] Insert the double-stranded DNA molecule shown in Sequence 10 into the corresponding site of the sgRNA-Cas9 dual-expression vector pBSE401 to obtain the CRISPR / Cas9 knockout vector pBSE401-BolKPLD1 (which has been verified by sequencing).

[0075] The structure of the knockout vector pBSE401-BolKPLD1 is described as follows: A DNA fragment with the sequence of Sequence 10 is inserted between the restriction endonuclease BsaI of the pBSE401 vector, and the other sequences of the pBSE401 vector are kept unchanged to obtain the recombinant plasmid. The knockout vector pBSE401-BolKPLD1 contains an expression cassette for expressing sgRNA2 and a Cas protein expression cassette.

[0076] 3. Obtaining and identifying transgenic and gene-edited strains

[0077] (1) Obtaining transgenic plants

[0078] Respectively introduce the pBSE401-BolKCenH3-MBCenH and pBSE401-BolKPLD1 prepared in the above steps 1 and 2 into the competent cells of Agrobacterium tumefaciens EHA105 (Biolegend, MQ0054) to obtain the recombinant bacteria EHA105 / pBSE401-BolKCenH3-MBCenH and EHA105 / pBSE401-BolKPLD1.

[0079] Then, use the above two recombinant bacteria EHA105 / pBSE401-BolKCenH3-MBCenH and EHA105 / pBSE401-BolKPLD1 to transform the hypocotyls of cauliflower by the Agrobacterium-mediated transformation method. After co-cultivation, screening, differentiation, and rooting, T0 generation transgenic cauliflower plants are obtained.

[0080] The specific experimental steps are as follows:

[0081] Unless otherwise specified in the following steps, all are carried out under the conditions of 28°C, 12 h light / 12 h dark, and the EHA105 / pBSE401 empty vector is used as the control recombinant bacterium.

[0082] ① Select healthy and plump cauliflower Korso_1401 seeds, wash them once with sterile water, soak them in 70% (v / v) ethanol aqueous solution for 30 s, and rinse them twice with sterile water; disinfect them with 3% sodium hypochlorite for 15 min (add 2 - 3 drops of Tween - 20, keep in the dark, cover with sealing film and shake constantly); rinse them about 4 times with sterile water (no obvious foam), and place them on sterilized filter paper to dry, obtaining disinfected seeds.

[0083] ② After step ①, transfer the disinfected seeds to a germination medium (i.e., MS medium), and culture them in the dark (weak light) for 3 - 4 d. When the hypocotyl grows to about 3 cm, use a sharp blade to cut off the growing points at both ends of the hypocotyl, cut it into 3 - 5 mm small segments as explants and place them flat on a pre - culture medium (a medium obtained by adding 6 - BA and NAA to the MS medium, with the concentrations of 6 - BA and NAA being 3 mg / L and 0.1 mg / L respectively), and pre - culture them in weak light for 2 days, obtaining pre - cultured hypocotyls.

[0084] ③ Inoculate the recombinant bacteria into 10 mL of LB medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and shake the bacteria overnight at 28 °C to obtain a bacterial solution.

[0085] ④ After step ③, transfer the bacterial solution to a centrifuge tube, centrifuge at 2000 rpm for 15 min, discard the supernatant and collect the precipitate. Resuspend it with liquid MS medium on the ultra - clean bench and then measure the OD 600 value, and adjust the OD 600 value to 0.1 to obtain a bacterial cell resuspension.

[0086] ⑤ Put the pre - cultured hypocotyls in step ② into a petri dish containing 2 ml of liquid MS medium. After all are transferred, suck out the liquid medium, then add the bacterial cell resuspension in step 4, and infect for 5 min. After infection, take out all the explants and place them on sterile filter paper to dry the bacterial solution, obtaining infected explants.

[0087] ⑥ Transfer the infected explants in step ⑤ to a co - culture medium (co - culture medium: a medium obtained by adding 6 - BA and NAA to the MS medium, with the concentrations of 6 - BA and NAA being 3 mg / L and 0.1 mg / L respectively), and co - culture them in the dark for 2 days.

[0088] ⑦ After step ⑥ is completed, transfer the non - contaminated and well - growing co - cultured explants to a selection medium 1 (a medium obtained by adding Basta and carbenicillin (Cb) to the co - culture medium, with the concentrations of Basta and carbenicillin (Cb) being 3 mg / L and 300 mg / L respectively) for screening. During the screening period, change the medium once a week, and screen for 3 - 6 weeks to obtain resistant buds.

[0089] ⑧ Transfer the screened resistant buds to the bud elongation medium (the medium obtained by adding Basta and carbenicillin (Cb) to the MS medium, with the concentrations of Basta and carbenicillin (Cb) being 3 mg / L and 200 mg / L respectively), and continue to grow. Change the medium every two weeks until rooting and seedling emergence, and thus obtain resistant seedlings.

[0090] Further detect and screen the obtained resistant seedlings using Basta test strips to obtain resistant regenerated plants.

[0091] (2) PCR detection of resistant regenerated plants.

[0092] Extract the genomic DNA of T0 generation resistant plants using the CTAB method, and then perform PCR identification on the Cas9 region of the regenerated plants to screen for positive seedlings ( Figure 3 ). The primer sequences are as follows: 35S-F: 5’-CAAGACCCTTCCTC TATATAAGGA-3’; and nCas9-951-R: 5’-GAGGTTATCCAGGTCATCG-3’. The results show that the positive seedlings screened by Basta test strips can all amplify the target bands by PCR.

[0093] For the transformed regenerated seedlings of the EHA105 / pBSE401-BolKCenH3-MBCenH strain, the specific primers for the BMCenH3 gene can also be used for amplification: MCPY-F: 5’-CTGGATCCATGGCGAGAACCAAACAT-3’ and MCPY-R: 5’GACTGCAGTCATGCCCAACGCCTTCCTC-3’ to verify the transfer of the BMCenH3 gene (the amplification results are exactly the same as those amplified by the Cas9 primers).

[0094] (3) Gene editing identification.

[0095] Perform PCR amplification on the DNA target editing region of the positive seedlings identified in step (2), sequence the obtained PCR products, and analyze the gene editing results. The primers used to detect the gene editing of the BolKCenH3 gene are: CEN-237: 5’-GACATTCCGTTACAAGCCTG-3’; and CEN-546: 5’-TCACAATGGTCTGCCTTT TC-3’; the primers used to detect the gene editing of the BolKPLD1 gene are: PLD121: 5’-CGATGTGGCCTGAAGGTATC-3’; and PLD325: 5’-CTCTCCGCAGGC TCATACTC-3’.

[0096] In step 2), 22 positive seedlings of transformed EHA105 / pBSE401-BolKCenH3-BMCenH3 verified by PCR were obtained, and 12 positive seedlings of EHA105 / pBSE401-BolKPLD1 were obtained.

[0097] ① For the positive seedlings of transformed EHA105 / pBSE401-BolKCenH3-BMCenH3, amplification products of different strains were obtained. The PCR amplification products of different strains were sequenced separately, and according to the sequencing results, they were compared with the target region sequence of the eighth exon of the wild-type cauliflower BolKCenH3 gene to identify whether the genes in different strains of T0-generation transgenic cauliflower had mutations.

[0098] The results were as follows: Among the 22 T0-generation BolKCenH3-knockout cauliflower plants, the BolKCenH3 gene in 13 plants had heterozygous or chimeric mutations (forming the mutant gene BolKcenh3 of BolKCenH3). Taking two heterozygous mutant strains as examples, the specific mutation forms were as Figure 4 shown. Figure 4 The results showed that multi-peak variations occurred in the target region; PCR monoclonal sequencing was performed on individual plants respectively. The sequencing results of #1 and #2 showed that the BrCenH3 genes of the two plants had different types of mutations in the target region compared with the wild type.

[0099] The difference between the mutant gene BolKcenh3-1 in the heterozygous mutant strain #1 and the wild-type cauliflower BolKCenH3 gene was that for the BolKCenH3 gene, one homologous chromosome was the same as the wild type, and the BolKCenH3 gene in the other homologous chromosome had the following mutation: "5'-GCTTTGCGCTATCCATGCAAGG-3'" (corresponding to positions 456 to 477 of SEQ ID No. 3 and positions 1138 to 1159 of SEQ ID No. 4) in the BolKCenH3 gene mutated to "5'-GCTTTGCGCTATGCAAGG-3'". This mutation caused a deletion of 4 nucleotides between positions 13 and 16 of sequence 9 in the sequence listing. The deletion of this nucleotide caused a frameshift and premature termination, resulting in the loss of the function of the core region of BolKCenH3 protein localization, thus knocking out the BolKCenH3 gene. The sequencing results of this mutation site and its surrounding nucleotides are shown in Figure 4 .

[0100] The difference between the mutant gene BolKcenh3-2 and the wild-type cauliflower BolKCenH3 gene in the heterozygous mutant line #2 is as follows: for the BolKCenH3 gene, one homologous chromosome is the same as the wild type, and the BolKCenH3 gene in the other homologous chromosome has the following mutation: "5'-GCTTTGCGCTATCCATGCAAGG-3'" (corresponding to positions 456 to 477 of SEQ ID No. 3 and positions 1138 to 1159 of SEQ ID No. 4) in the BolKCenH3 gene is mutated to "5'-GCTTTGCGCTATCCATTGCAAGG-3'". This mutation inserts the nucleotide "T" between positions 16 and 17 of sequence 9 in the sequence listing. The insertion of this nucleotide causes a frameshift and premature termination, resulting in the loss of the function of the BolKCenH3 protein localization core region, thereby knocking out the BolKCenH3 gene.

[0101] The T0 plants with heterozygous mutations in the above BolKCenH3 gene are denoted as + / BolKcenh3-1 and + / BolKcenh3-2.

[0102] ② For the positive seedlings transformed with EHA105 / pBSE401-BolKPLD1, the primers used to detect the gene editing of the BolKPLD1 gene are: PLD121: 5'-CGATGTGGCCTGAAGGTATC-3'; and PLD325: 5'-CTCTCCGCAGGCTCATACTC-3'. The PCR amplification products of 12 different T0 lines were sequenced separately, and the sequencing results were compared with the sequence of the target region of the second exon of the wild-type cauliflower BolKPLD1 gene to identify whether the gene mutated in different lines of T0 transgenic cauliflower.

[0103] The results are as follows: Among the 12 T0 generation BolKPLD1-knockout cauliflower plants, the BolKPLD1 gene mutated homozygously or heterozygously in 8 plants. Taking two homozygous mutant lines as examples, the specific mutation forms are as Figure 1 (ii) shown.

[0104] The difference between the mutant gene BolKpld1-1 in mutant line #1 and the wild-type cauliflower BolKPLD1 gene lies in that for the BolKPLD1 gene, in both of the two homologous chromosomes, the BolKpld1-1 gene has undergone the following mutation: "5'-CCTAGAAACTATCTGACGTTCT-3'" (corresponding to positions 1849 to 1870 of SEQ ID No.6 and positions 2515 to 2536 of SEQ ID No.7) in the BolKPLD1 gene has mutated to "5'-CCTAGAA-CTATCTGACGTTCT-3'". This mutation causes a deletion of 1 nucleotide A between positions 7 and 9 of sequence 10 in the sequence listing. The deletion of this nucleotide causes a frameshift and leads to premature termination of translation, resulting in the loss of the function of the BolKPLD1 protein, thereby knocking out the BolKPLD1 gene.

[0105] The difference between the mutant gene BolKpld1-2 in mutant line #2 and the wild-type cauliflower BolKPLD1 gene lies in that for the BolKPLD1 gene, in both of the two homologous chromosomes, the BolKPLD1 gene has undergone the following mutation: "5'-CCTAGAAACTATCTGACGTTCT-3'" (corresponding to positions 1849 to 1870 of SEQ ID No.6 and positions 2515 to 2536 of SEQ ID No.7) in the BolKCenH3 gene has mutated to "5'-CCTAGACTATCTGACGTTCT-3'". This mutation causes a deletion of 2 nucleotides AA between positions 6 and 9 of sequence 10 in the sequence listing. This deletion causes a frameshift and leads to premature termination of translation, resulting in the loss of the function of the BolKPLD1 protein, thereby knocking out the BolKPLD1 gene.

[0106] The T0 generation plants with homozygous mutations in the above-mentioned BolKPLD1 gene are denoted as BolKpld1-1 / BolKpld1-1 and BolKpld1-2 / BolKpld1-2.

[0107] (4) Self-crossing and seed preservation and identification of offspring

[0108] The + / BolKcenh3-1 and + / BolKcenh3-2 T0 generation plants obtained in step ① of the above (3) are continuously self-crossed for two generations, and the segregation and combination of the BolKcenh3 gene and the BMCenH3 gene are identified for 20 T1 generation plants respectively. And according to whether the BMCenH3 gene segregates in the T2 generation, the heterozygous (+ / BMCenH3) and homozygous (BMCenH3 / BMCenH3) genotypes of BMCenH3 in the T1 generation are verified.

[0109] Homozygous mutations of BolKcenh3 were obtained under the backgrounds of heterozygous and homozygous BMCenH3, denoted as: + / BMCenH3 BolKcenh3-1 / BolKcenh3-1; + / BMCenH3 BolKcenh3-2 / BolKcenh3-2; BMCenH3 / BMCenH3 BolKcenh3-1 / BolKcenh3-1; BMCenH3 / BMCenH3 BolKcenh3-2 / BolKcenh3-2. The pollen of these mutant strains was less than that of the wild type but had partial fertility and could set seeds. At the same time, lines with the BolKCenH3 gene not edited and only the BMCenH3 gene introduced were also obtained. The heterozygous was denoted as: + / BMCenH3, and the homozygous was denoted as: BMCenH3 / BMCenH3.

[0110] The T0 generation cauliflower plants of BolKpld1-1 / BolKpld1-1 and BolKpld1-2 / BolKpld1-2 obtained in step ② of (3) above were self-crossed and the seeds were harvested to obtain the T1 generation BolKpld1 cauliflower knockout mutants BolKpld1-1 / BolKpld1-1 and BolKpld1-2 / BolKpld1-2.

[0111] Example 2. Identification of the ploidy induction ability of the putative inducers (different types of mutant lines) obtained in Example 1

[0112] The mutant lines to be measured included: the lines + / BMCenH3, BMCenH3 / BMCenH3, + / BMCenH3 BolKcenh3-1 / BolKcenh3-1, BMCenH3 / BMCenH3 BolKcenh3-1 / BolKcenh3-1, + / BMCenH3 BolKcenh3-2 / BolKcenh3-2, BMCenH3 / BMCenH3 BolKcenh3-2 / BolKcenh3-2, BolKpld1-1 / BolKpld1-1 and BolKpld1-2 / BolKpld1-2 obtained in Example 2, and the identification of their ploidy induction ability. The specific identification method is as follows:

[0113] Each mutant line was used as the male and female parent in hybrids with four test lines (see Table 2 for specific hybrid combinations). The test lines included: cauliflowers "y16-2-11" and "Qingmei 80," broccoli "Yanxiu," and kale "Jingguanhong 6." All four test lines belong to varieties of the Brassica oleracea species. Cauliflower "y16-2-11" is a recessive chlorotic mutant derived through somatic hybridization from the same genetic background as "Korso_1401," exhibiting a yellowing of the entire plant's leaves. Kale "Jingguanhong 6" is a commercial variety with wrinkled leaves and a distinct red color in mature plants. It exhibits some phenotypic differences from cauliflower in seedling leaf shape (distinct leaf lobes). Cauliflowers "Qingmei 80" and broccoli "Yanxiu" are both commercial varieties. Phenotypic differences from the induced cauliflower lines are not apparent during the seedling stage, but only become apparent in leaf color and curd color later in the experiment. "Qingmei 80" is a type of cauliflower with long stems and loose flowers, which is significantly different from the compact white flower heads of "Korso_1401".

[0114] Table 2. Hybrid combinations and ploidy induction

[0115]

[0116]

[0117] Note: "-" means that the combination was only screened for haploid phenotype key strains by flow cytometry, and not all seedlings were tested, so the tetraploid test results could not be obtained.

[0118] 1. Flow cytometry identification of leaf ploidy

[0119] The hybrid offspring listed in Table 2 above were sown in seedling trays and their characteristics were first observed. The haploid offspring of "y16-2-11" exhibited a chlorotic phenotype, while the haploid offspring of "Jingguanhong 6" exhibited cleft and wrinkled leaves and a short stature. Flow cytometry was performed on the key phenotypic strains and most of the offspring seedlings. The specific method is as follows:

[0120] Nuclei were extracted from young leaves of the test plants, with leaves from the respective diploid test plants used as controls. Signals were then detected using a flow cytometer, with the diploid nuclear signal detected first and the diploid nuclear signal peak set at 100. Because diploid cells contain twice as much genetic material as haploid cells, the haploid nuclear signal peak should appear around 50, and the tetraploid nuclear signal peak should appear around 200.

[0121] Take the offspring flow result diagram of hybridization between "Yanxiu" as the female parent and the mutant line (+ / BMCenH3 BolKcenh3-1 / BolKcenh3-1) as an example: Figure 5As shown in the figure, from left to right are the flow cytometry diagrams of the "Yanxiu" diploid control, the hybrid haploid, and the tetraploid offspring. From the results, the signal peak of "Yanxiu" is set near 100. Most of the hybrid offspring are enriched in the diploid nucleus signal intensity and have the same position, indicating that the tested plant is a normal hybrid diploid F1. If the signal peak of the tested plant's nucleus appears near 50, it is considered that the tested plant is a haploid plant. If the signal peak of the tested plant appears near 200, it is considered that the tested plant is a tetraploid.

[0122] 2. Identification of polymorphic molecular markers

[0123] Eighteen pairs of SSR primers were selected from the SSR primers published on the Brassica database http: / / brassicadb.org, as shown in Table 1 (one pair on each of the 9 chromosomes). Using the genomic DNA of "Korso_1401" and the parents of the tested plants as templates, amplification and polymorphic molecular marker screening were carried out. Finally, 4 pairs of molecular markers were obtained: BrID10303, BrID10041, BrID10275, BrID10729, which were polymorphic between "Korso_1401" and "Qingmei 80"; 5 pairs of molecular markers: BrID10303, BrID10041, BrID10275, BrID101185, and BrID90295, which were polymorphic between "Korso_1401" and the broccoli "Yanxiu"; 7 pairs of molecular markers: BrID10303, BrID10041, BrID10275, BrID90295, BrID10703, BrID10205, and BrID10729 were polymorphic between "Korso_1401" and the kale "Jingguan Red No. 6".

[0124] Table 3. Information on 18 pairs of SSR primers

[0125]

[0126] Taking the PCR electrophoresis diagram of the molecular marker BrID10729 of the hybrid offspring with the mutant (BMCenH3 / BMCenH3 BolKcenh3-2 / BolKcenh3-2) as the female parent and "Jingguan Red No. 6" as the male parent as an example: The results are as Figure 6 shown: Lane 1 is the band pattern of "Jingguan Red No. 6", lane 2 is the band pattern of the "female parent mutant", lane 3 is the band pattern of the heterozygous diploid in the offspring, lanes 4 and 5 are the band patterns of the haploid in the offspring, and lane 6 is the band pattern of the tetraploid in the offspring. If the tested single plant only has the bands of the kale "Jingguan Red No. 6" ( Figure 6In lanes 4 and 5), if the banding pattern of the parental "mutant" is not present in the individual plant, it is considered a haploid; if the bands of the "female parent mutant" and "Jingguan Red No. 6" are both present in the individual plant of the normal diploid F1 hybrid offspring ( Figure 6 In lane 3), lane 6 is the tetraploid offspring, indicating that the tetraploid contains the genetic material of both parents.

[0127] 3. Phenotypic identification

[0128] Continuously observe the phenotypes of the obtained haploid and tetraploid plants.

[0129] Taking the hybrid offspring of the yellow-leaf cauliflower "y16-2-11" and the kale "Jingguan Red No. 6" as an example, if it is a haploid, the phenotype at the seedling stage is consistent with that of the test parent, and there are obvious phenotypic differences from the F1 hybrid generation ( Figure 7 in a and b).

[0130] Among the hybrid offspring of the test plant broccoli "Yanxiu" and the cauliflower "Qingmei 80" as parents, the haploids have no significant phenotypic differences from the early-stage diploid F1. It cannot be completely determined only from the plant size, and there are significant differences in the leaf color and curd color characteristics at the later stage.

[0131] Haploids have characteristics such as shorter plants, narrower leaves, compact plant types, and male sterility compared to diploids. For example, Figure 7 (c, d, e) shows the comparison between the haploid offspring of "Qingmei 80" and diploids. During the hybridization process, tetraploids and aneuploids were also induced. Continuous observation of the phenotypes of the tetraploids found that: the phenotypes of the tetraploids were inconsistent. Some had weak growth or even died, while some had thick and wide leaves, strong growth, large curds, high yields, and obvious resistance to pests and diseases. For example, Figure 7 in f.

[0132] Based on the above identification results, it can be seen that by introducing the BMCenH3 gene to complement the lethal phenotype of BolKcenh3 mutation, the technical bottleneck was broken through, and BolKCenH3 homozygous edited plants could be obtained. It was also confirmed that in the background of BMCenH3, when BolKcenh3 was used as the male or female parent to hybridize with other materials, haploids and polyploids of various variants of the Brassica oleracea species were obtained in the offspring; the heterologous expression lines + / BMCenH3 and BMCenH3 / BMCenH3 of BMCenH3 also had the function of haploid induction; the homozygous knockout mutant BolKpld1 of the BolKPLD1 gene could be used as the male parent to induce the production of haploids in the female parent of Brassica vegetables. The haploid induction rate obtained in this invention was 0.47%-1.65%; the tetraploid induction rate was: 0.60%-2.63%. The induction rate (%) = (the number of haploid or tetraploid plants / the total number of tested plants) × 100%.

[0133] Meanwhile, in some of the combined hybrid offspring in Table 2, no haploids and / or tetraploids were obtained, which may also be due to insufficient hybrid offspring seeds and low induction rate.

[0134] The present invention also attempted to knockout and edit the BolKCenH3 gene and obtained 23 T0 generation BolKCenH3 gene-edited plants that were heterozygous and chimeric. However, when identifying the self-crossed T1 generation of the edited plants, no homozygous edited plants were identified among the 50 T1 offspring of each T0 line (only one plant, which was very weak and died quickly at the seedling stage). This indicates that the homozygous knockout mutation BolKcenh3 of the BolKCenH3 gene is lethal, which is also a technical bottleneck that has been hindering the application of this gene in haploid induction.

[0135] Therefore, the present invention constructs the pBSE401-BolKCenH3-BMCenH3 vector by the method of transforming an editing knockout complementary vector. This vector contains an editing target site. While knocking out the endogenous BolKCenH3 gene in Brassica, the expression of the BMCenH3 gene is introduced as a functional complement to the BolKcenh3 mutant, breaking through the technical bottleneck of CenH3 gene knockout lethality, and for the first time realizing the application of the CenH3 gene in Brassica ploidy induction, and obtaining Brassica haploids and / or polyploids.

[0136] The above has described the present invention in detail. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although the present invention gives specific embodiments, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that are outside the scope disclosed in this application.

Claims

1. A method for preparing haploid and / or polyploid Brassica vegetables: (1) Combine the C-terminal of the maize CenH3 gene with the N-terminal of the Brassica CenH3 gene to obtain a synthetic gene BMCenH3, and construct a functional complementary editing vector; the functional complementary editing vector is obtained by overexpressing the BMCenH3 gene on a starting vector, and the starting vector contains a target sequence for knocking out the endogenous BolKCenH3 gene in Brassica; (2) Through transcriptome data analysis and quantitative expression verification, obtain the cauliflower phospholipase-encoding gene BolKPLD1, and construct a BolKPLD1 gene knockout vector for the BolKPLD1; (3) Transform the functional complementary editing vector described in step (1) into the recipient Brassica vegetables to obtain a function-deficient mutant BolKcenh3 that can express the BMCenH3 gene described in step (1) and knock out the BolKCenH3 gene described in step (1); transform the BolKPLD1 gene knockout vector described in step (2) into the recipient Brassica vegetables to obtain a BolKPLD1 knockout function-deficient mutant BolKpld1; (4) Continuously self-cross the function-deficient mutants BolKcenh3 and the BolKPLD1 knockout function-deficient mutant BolKpld1 obtained in step (3) to obtain a BolKcenh3 homozygous editing mutant strain expressing the BMCenH3 gene, and a BolKpld1 homozygous editing mutant strain; the mutation sites of the homozygous mutant strains are located in the BMCenH3 gene or the BolKcenh3 gene; (5) Use the editing mutant strains obtained in step (4) as female parents and / or male parents, cross them with other Brassica plants to obtain hybrid offspring, screen the hybrid offspring, and obtain Brassica haploid and / or polyploid materials.

2. The method according to claim 1, characterized in that: The gene editing is carried out by knocking out through the CRISPR / Cas9 system.

3. The method according to claim 1 or 2, characterized in that: 1) The functional complementary editing vector contains a BolKCenH3 gene editing target, and the editing target sequence is the nucleotide positions 456-477 of sequence 3, or the 1138-1159th of sequence 4; (2) The BolKPLD1 gene knockout vector contains a BolKPLD1 gene editing target, and the editing target is the nucleotide positions 1849-1870 of sequence 6, or the 2515-2536th of sequence 7.

4. The method according to any one of claims 1-3, characterized in that: The recipient Brassica vegetables in step (3) are cauliflower "Korso_1401".

5. The method according to any one of claims 1-4, characterized in that: The other Brassica plants in step (5) are cauliflower "y16-2-11" or "Qingmei 80", broccoli "Yanxiu" or kale "Jingguan Red No. 6".

6. The method according to any one of claims 1-5, characterized in that: The screening in step (4) includes the following methods: A1) Molecular marker-assisted screening; A2) Flow cytometry identification of leaf ploidy-assisted screening.

7. A method for breeding Brassica vegetables, characterized in that: Selective breeding is carried out by using the method described in any one of claims 1-4; the purpose of Brassica vegetable breeding includes cultivating Brassica haploid and / or polyploid materials.

8. Use of the method according to any one of claims 1-6 in creating Brassica haploids and / or polyploids.

9. The synthetic gene BMCenH3 described in the method of claim 1.

10. The editing target sequence described in the method of claim 3.

Citation Information

Patent Citations

  • Breeding method of brassica vegetable hybrid

    CN109566406A

  • Cauliflower mononucleotide mutation method

    CN111549053A

  • Broccoli BoCENH3 gene and application thereof in haploid induction

    CN117305326A