Method for creating diploid and polyploid brassica vegetables and use thereof

By combining the maize CenH3 gene with the Brassica oleracea CenH3 gene, and using the CRISPR/Cas9 system to knock out and overexpress the BMCenH3 and BolKPLD1 genes, the technical bottleneck of haploid and polyploid induction in Brassica oleracea vegetables was solved, enabling rapid breeding and high-yield Brassica oleracea vegetable breeding.

CN120384101BActive Publication Date: 2026-02-13BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410112012.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-26
Publication Date
2026-02-13
Estimated Expiration
2044-01-26

AI Technical Summary

Technical Problem

Existing technologies make it difficult to widely apply haploid and polyploid induction in Brassica vegetables, especially since the lethal mutation of the CenH3 gene is a technical bottleneck for haploid induction in dicotyledonous plants.

Method used

By combining the C-terminus of the maize CenH3 gene with the N-terminus of the Brassica oleracea CenH3 gene, a synthetic gene BMCenH3 was constructed. The endogenous Brassica oleracea BolKCenH3 gene was knocked out using the CRISPR/Cas9 system and BMCenH3 was overexpressed. At the same time, the BolKPLD1 gene, which is highly expressed in cauliflower, was knocked out to achieve functional complementarity and obtain haploid and polyploid materials.

Benefits of technology

Breakthroughs were achieved in overcoming the technical bottleneck of homozygous knockout lethality of the CenH3 gene, enabling the induction of haploids and polyploids in Brassica oleracea, providing a new approach to rapid breeding, and enhancing the disease resistance, stress resistance, and high yield of Brassica vegetables.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004683716270000111
    Figure BDA0004683716270000111
  • Figure BDA0004683716270000121
    Figure BDA0004683716270000121
  • Figure BDA0004683716270000131
    Figure BDA0004683716270000131
Patent Text Reader

Abstract

The application discloses a method for creating a cabbage vegetable haploid and polyploid and application thereof. The application belongs to the technical field of biotechnology, and particularly relates to a method for creating a cabbage vegetable haploid and polyploid and application thereof. The method for preparing a brassica vegetable haploid and / or polyploid comprises the following steps: (1) fusing the C-terminal of corn CenH3 and the N-terminal of brassica CenH3 into BMCenH3 to construct an editing complementary carrier; (2) constructing a brassica PLD1 gene knockout carrier; (3) transforming the carriers constructed in steps (1) and (2) into a receptor brassica vegetable to obtain a CenH3 and PLD1 knockout mutant; and (4) continuously self-crossing the mutant to obtain a cenh3 homozygous mutant in the background of BMCenH3 gene expression and a pld1 homozygous mutant; and crossing the homozygous mutants with other brassica plants to screen a brassica haploid and / or polyploid material.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a method for creating a Brassica vegetable haploid and polyploid and application thereof. BACKGROUND

[0002] Ploidy breeding has always been the core of crop breeding, including polyploidy breeding and haploid breeding. Polyploidy breeding has a glorious history and has achieved remarkable results in many plants, and is an important force to promote biological evolution and genetic diversity. Polyploid plants have strong plasticity, i.e., after chromosome polyploidization, the genetic variation range of the species is widened and the buffering capacity to external stress is enhanced, which is beneficial to creating new varieties with high quality and high yield and enhancing the disease resistance, stress resistance, growth rate and convenience of eating of plants. The creation of vegetable polyploid germplasm is an important way to breed new high-quality and high-yield vegetable varieties, and provides a new idea for genetic improvement and germplasm innovation of vegetable quality traits.

[0003] Haploid breeding has significant advantages in shortening the breeding period, improving the selection efficiency, and studying traits. In recent years, various haploid induction techniques based on tissue culture have made some progress and brought considerable scientific and economic value. However, the acquisition of haploids still has the bottleneck of overcoming species and genotype limitations, and establishing a widely applicable haploid induction technique is the key to the national advantage in the field of good seeds.

[0004] Brassica vegetables belong to the Brassica genus of the Brassicaceae family, and are a kind of important economic vegetables, including cabbage, cauliflower, broccoli and kale, accounting for more than 30% of the national vegetable planting area. Although great progress has been made in the haploid induction technology of Brassica vegetables by microspore culture, there are still technical barriers such as dependence on tissue culture, limitation of species and genotype, and low induction rate. In recent years, the research on creating haploid induction lines of major crops using gene editing technology has made rapid progress. This technology only needs to modify individual genes to create haploid induction lines, so that wild-type plants can directly produce haploid offspring through hybridization. This haploid induction method is not limited by species and genotype, and has great application value in production. Moreover, there are many species in the Brassica genus, and hybridization is easy. If only one gene needs to be modified to create haploid and polyploid induction lines, it will have great application value. However, the ploidy induction ability of some genes and their application research in Brassica vegetables have not been carried out. In particular, the mutation of CenH3 gene is lethal, which is a technical bottleneck in the application of haploid induction in dicotyledonous plants. SUMMARY

[0005] The technical problem to be solved by the present application is how to create an induction line and apply it to quickly obtain a Brassica haploid or polyploid.

[0006] To solve the above technical problems, the application provides a method for preparing Brassica vegetables haploid and / or polyploid.

[0007] The method for preparing Brassica vegetables haploid and / or polyploid provided by the application comprises the following steps:

[0008] (1) combining the C-terminal of the maize CenH3 gene with the N-terminal of the Brassica CenH3 gene to obtain a synthetic gene BMCenH3, and constructing a functional complementation editing vector containing an editing target, which knocks out the endogenous BolKCenH3 gene of Brassica and simultaneously overexpresses the introduced BMCenH3 gene as a functional complement of the BolKcenh3 mutant Figure 1 i);

[0009] (2) obtaining a phospholipase gene BolKPLD1 highly expressed in cauliflower pollen through transcriptome data analysis and quantitative expression verification Figure 2 , constructing a gene editing knockout vector for the gene Figure 1 ii);

[0010] (3) transforming the functional complementation editing vector in step (1) into a recipient Brassica vegetable to obtain a functional deficiency mutant BolKcenh3 expressing the BMCenH3 gene and having the BolKCenH3 gene knocked out, denoted as BMCenH3 / BolKcenh3; transforming the gene editing knockout vector in step (2) into a recipient Brassica vegetable to obtain a BolKPLD1 knockout functional deficiency mutant denoted as BolKpld1;

[0011] (4) continuously self-crossing the T0 generation edited plants of BMCenH3 / BolKcenh3 obtained in step (3) to obtain T1 and T2 generation edited plants, and separating and combining BMCenH3 and BolKcenh3 as two genes, obtaining hybrid and homozygous plants (i.e. + / BMCenH3 and BMCenH3 / BMCenH3) expressing only BMCenH3 and homozygous mutants of BolKcenh3 in the background of expressing BMCenH3, denoted as: + / BMCenH3 BolKcenh3 / BolKcenh3, or BMCenH3 / BMCenH3 BolKcenh3 / BolKcenh3, and continuously self-crossing the BolKpld1 T0 generation edited plants obtained in step (3) to obtain a BolKpld1 homozygous edited knockout plant denoted as BolKpld1 / BolKpld1;

[0012] (5) Taking the edited mutant strains of different types of CenH3 obtained in step (4) as the male or female parent, and the BolKpld1 / BolKpld1 as the male parent, crossing with other Brassica plants to obtain hybrid offspring, screening the hybrid offspring to obtain Brassica haploid and / or polyploid materials.

[0013] The edited mutant strain can be + / BMCenH3, BMCenH3 / BMCenH3, + / BMCenH3 BolKcenh3 / BolKcenh3, BMCenH3 / BMCenH3 BolKcenh3 / BolKcenh3.

[0014] The nucleotide sequence of the BMCenH3 gene is SEQ ID NO: 1 in the sequence listing, and the encoded protein sequence is SEQ ID NO: 2.

[0015] The coding sequence (CDS) of the BolKCenH3 gene is SEQ ID NO: 3 in the sequence listing, the genomic sequence is SEQ ID NO: 4 in the sequence listing, and the encoded protein sequence is SEQ ID NO: 5.

[0016] The coding sequence (CDS) of the BolKPLD1 gene is SEQ ID NO: 6 in the sequence listing, the genomic sequence is SEQ ID NO: 7 in the sequence listing, and the encoded protein sequence is SEQ ID NO: 8.

[0017] In the above method, the gene editing is carried out by CRISPR / Cas9 system.

[0018] In the above method, the functional complementation editing vector contains a BolKCenH3 gene editing target, and the editing target sequence is nucleotides 456-477 of SEQ ID NO: 3 (corresponding to nucleotides 1138-1159 of SEQ ID NO: 4) (SEQ ID NO: 9).

[0019] In the above method, the gene editing knockout vector contains a BolKPLD1 gene editing target, and the editing target is nucleotides 1849-1870 of SEQ ID NO: 6 (corresponding to nucleotides 2515-2536 of SEQ ID NO: 7) (SEQ ID NO: 10).

[0020] In the above method, the starting vector for gene editing is the knockout vector pBSE401, and the recombinant vector for gene editing is pBSE401-BolKCenH3 or pBSE401-BolKpld1.

[0021] The structure of the knockout vector pBSE401-BolKCenH3 is described as follows: the pBSE401 vector is cut with endonuclease BsaI and the vector skeleton is recovered, the vector skeleton is connected with the target double-stranded DNA (sequence 9) of BolKCenH3, and the recombined vector with correct sequence is recorded as pBSE401-BolKCenH3.

[0022] Then the pBSE401-BolKCenH3 vector is cut with endonuclease EcoRI and recovered to be connected with the BMCenH3 sequence (sequence 1), and the recombined vector is recorded as pBSE401-BolKCenH3-BMCenH3.

[0023] The structure of the recombined vector pBSE401-BolKCenH3-BMCenH3 is described as follows: the EcoRI enzyme cutting site fragment of the pBSE401-BolKCenH3 vector is replaced with the BMCenH3 sequence (sequence 1), and the recombined vector is obtained by keeping the other sequences of the vector unchanged.

[0024] The structure of the knockout vector pBSE401-BolKpld1 is described as follows: the pBSE401 vector is cut with endonuclease BsaI and the vector skeleton is recovered, the vector skeleton is connected with the target double-stranded DNA (sequence 10) of BolKpld1, and the recombined vector with correct sequence is recorded as pBSE401-BolKpld1.

[0025] In the above method, the Brassica vegetable receptor in step (3) can be cauliflower "Korso_1401" (article and patent document).

[0026] In the above method, the other Brassica plant in step (5) can be cauliflower "y16-2-11" or "Qingmei80", broccoli "Yanshu" or kale "Jingguan Hong No. 6".

[0027] In the above method, the screening in step (5) includes the following methods:

[0028] A1), molecular marker assisted screening;

[0029] A2), flow cytometry assisted screening of leaf ploidy.

[0030] In the above method, the molecular marker assisted screening is specifically the following molecular markers: BrID10303, BrID10041, BrID10275, BrID101185, BrID90295, BrID10729, BrID10703, BrID10205.

[0031] The detection primer information of the molecular markers is shown in Table 1.

[0032] Table 1, detection primer information of molecular markers

[0033] Primer name Upstream primer (5' - 3') Downstream primer (5' - 3') BrID10303 GAATACTTACCCCGTTGTTG CTACACCGGTTTTTAAAGTG BrID10041 AGGCCATGTTAGCCATTAC GCACCTGATTACTTCAAAGC BrID10275 AGACCACCGCTAGTTAAAAA ATCTTCCAAAGGGAGAGAAG BrID101185 ATAAGGGGACCCTGTAAAAA TTCTGTCAACTAACATCCCA BrID90295 CACAAAGCTCACTTCTTAGGCA TATAGCCTTGCGGTGGAGTT BrID10729 GTATGATGATGTATCCAGACAG GCTAAAAGCCTAACACAAAG BrID10703 CCTGGCATGATGATGTTTA AGTAATTAAGCAAGCATCGG BrID10205 ACGCAAAGTCACTCAACAA GTTGTCTTTGCTCTTATCGG

[0034] Among them, 4 pairs of molecular markers (BrID10303, BrID10041, BrID10275, BrID10729) are polymorphic in "Korso_1401" and "Qingmei80"; 5 pairs (BrID10303, BrID10041, BrID10275, BrID101185, BrID90295) are polymorphic in "Korso_1401" and "Yanxiu" of broccoli; 7 pairs (BrID10303, BrID10041, BrID10275, BrID90295, BrID10703, BrID10205, BrID10729) are polymorphic in "Korso_1401" and "Jingguan Hong No. 6" of kale.

[0035] The present application also provides a method for breeding Brassica vegetables, which comprises the method described above; the purpose of breeding Brassica vegetables includes breeding haploid and / or polyploid materials of Brassica.

[0036] The application of the above method in creating haploid and / or polyploid of Brassica also belongs to the scope of protection of the present application.

[0037] The present application also provides the synthetic genes BMCenH3 and BolKPLD1 described above.

[0038] The present application also provides the sgRNA described above, which is a DNA molecule of sequence 9 or sequence 10.

[0039] The present application discloses a method for inducing the production of haploid and polyploid (tetraploid) of various varieties of Brassica oleracea vegetables (even other species of Brassica) and its application. Among them, ① the C-terminal of Brassica CenH3 gene is modified, and the C-terminal of heterologous CenH3 gene is used instead (or other modification), the modified gene is overexpressed, and the endogenous CenH3 gene is knocked out by CRISPR / Cas9 technology, to obtain different types of edited and modified strain combinations, including: 1) only the transformed strain overexpressing the modified gene, 2) different combinations of overexpressing the modified CenH3 gene and knocking out the endogenous CenH3 gene, using the above mutant strains as the father and mother to cross with other Brassica materials, which can produce haploid and tetraploid. ② Knock out Brassica BolKPLD1 gene by gene editing, and obtain the knockout homozygous mutant as the father to cross with other Brassica materials, which can produce haploid.

[0040] Because homozygous knockout of CenH3 gene will affect the survival and fertility of plants, the knockout lethality has been a technical difficulty for application of the gene in diploid plants polyploidy induction. The present application aims at the technical bottleneck of homozygous knockout lethality of CenH3 gene. The C-terminal of corn CenH3 gene is combined with the N-terminal of Brassica CenH3 gene to obtain a synthetic gene BMCenH3; a complementary editing vector is constructed, which contains an editing target and introduces the expression of BMCenH3 gene while knocking out the endogenous BolKCenH3 gene of Brassica, serving as a functional complement of BolKcenh3 mutant. The technical bottleneck of CenH3 gene knockout lethality is broken, the application of CenH3 gene in Brassica polyploidy induction is realized for the first time, and Brassica haploid and / or polyploid are obtained.

[0041] Heterologous C-terminal CenH3 gene overexpression, and CenH3 gene series allelic mutation, and combination of the two modified cauliflower plants. And through hybridization, the haploid and tetraploid induction function is proved.

[0042] Knocking out BolKPLD1 gene by gene editing, and BolKpld1 mutant cauliflower as the male parent is crossed with other Brassica materials to prove the haploid induction function of the female parent.

[0043] Heterologous modification (or replacement) overexpression and mutation of cauliflower CenH3 and knockout of PLD1 gene can lead to the generation of haploid and tetraploid of various varieties of Brassica oleracea, which provides new ideas and research materials for revealing the biological role of kinetochore functional genes and phospholipase functional genes in the process of haploidization and polyploidization of Brassica.

[0044] At the same time, the modified single plant obtained by the present application has haploid induction ability, which is of great significance for breaking the bottleneck of Brassica haploid production limited by species and genotype, and for realizing the wide application of haploid induction lines in the future and accelerating the breeding process. The induction line also has tetraploid induction ability, and the multiple resistance and high yield of tetraploid in the field provide new ideas for Brassica oleracea vegetable polyploid (tetraploid and triploid breeding). BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1 (i) is a schematic diagram of BolKCenH3 knockout complementary vector and gene structure, target and mutation site; and (ii) is a schematic diagram of BolKPLD1 knockout vector and gene structure, target and mutation site.

[0046] Figure 2 is the expression of BolKPLD1 gene in different tissues of cauliflower "Korso_1401".

[0047] Figure 3PCR detection of Basta test paper detection of resistant T0 generation plants. M: the leftmost is the standard DNA molecular weight (Trans2K plus DNA Marker); lane 1 is the positive control (engineered bacteria), lane 2 is the negative control (untransformed cauliflower DNA); lanes 3-24 are the detection results of resistant regenerated plants.

[0048] Figure 4 PCR sequencing results of BolKCenH3 cauliflower plants with knock-out, sequencing primer: CEN-546.

[0049] Figure 5 Flow cytometry assay diagram of diploid "Yanxiu" and haploid and tetraploid in the offspring of "Yanxiu" and mutant (+ / BMCenH3 BolKcenh3-1 / BolKcenh3-1) hybridization.

[0050] Figure 6 PCR electrophoresis diagram of molecular marker BrID10729 in the hybrid offspring of mutant (BMCenH3 / BMCenH3 BolKcenh3-2 / BolKcenh3-2) as the female parent and kale "Jingguan Hong 6" as the male parent. Lane 1 is the band type of "Jingguan Hong 6", lane 2 is the band type of "female mutant", lane 3 is the band type of heterozygous diploid in the offspring, lanes 4 and 5 are the band types of haploid in the offspring, and lane 6 is the band type of tetraploid in the offspring.

[0051] Figure 7 Phenotype diagram of haploid and tetraploid. Wherein a: phenotype screening of the hybrid offspring of mutant (BMCenH3 / BMCenH3 BolKcenh3-2 / BolKcenh3-2) and yellow leaf cauliflower "y16-2-11", the arrow indicates the haploid plant seedlings (left) and the slightly larger plants in the transplant greenhouse (right) compared with the parent on the side; b: hybrid offspring of kale "Jingguan Hong 6" and mutant BolKpld1-1 / BolKpld1-1. Most plants show the intermediate phenotype of kale and cauliflower F1 hybrid, with large plants and strong growth. The left arrow indicates the haploid determined by flow cytometry, which is dwarf and has the same characteristics as the parent kale "Jingguan Hong 6", and the right figure is compared with the parent in the transplant greenhouse; c: diploid "Qingmei 80" and its haploid offspring at the seedling stage. d: Diploid "Qingmei 80" has abundant and plump pollen, and the flowers of its haploid offspring are small and pollen-free. e: Diploid "Qingmei 80" and its haploid offspring at the mature stage. As shown by the arrow, the "Qingmei 80" seed pod is full and contains grains; the haploid seed pod is small and dry, and contains no grains. f: Tetraploid field performance is inconsistent, but most show high yield and high resistance, the arrow indicates the diploid control, and the two plants on the side are tetraploid. DETAILED DESCRIPTION

[0052] The present application will be further described in details in connection with the specific embodiments. The examples given are only for the purpose of illustrating the present application and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the present application.

[0053] The experimental methods in the following examples are all routine methods, unless otherwise specified, which are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained commercially.

[0054] The quantitative experiments in the following examples, unless otherwise specified, are all set up with three replicates.

[0055] The vector pBSE401 in the following examples has been described in: Zong M, Han S, Guo N, Duan M, Liu F, Wang G. Obtaining non-transgenic Brassica rapa mutants using vacuum infiltration and CRISPR / Cas9 system. Biotechnol Lett. 2022, 38(10): 159-163. The biological material can be obtained from the applicant, which is only used for repeating the experiments of the present application and cannot be used for other purposes.

[0056] The cauliflower "Korso_1401" in the following examples is a selfing line of cauliflower preserved by the laboratory, which has been described in: Guo N, Wang S, Gao L, Liu Y, Wang X, Lai E, Duan M, Wang G, Li J, Yang M, Zong M, Han S, Pei Y, Borm T, Sun H, Miao L, Liu D, Yu F, Zhang W, Ji H, Zhu C, Xu Y, Bonnema G, Li J, Fei Z, Liu F. 2021, Genome sequencing sheds light on the contribution of structural variants to Brassica oleracea diversification. BMC Biol. 2021, 19:93. doi: 10.1186 / s12915-021-01031-2. The biological material can be obtained from the applicant, which is only used for repeating the experiments of the present application and cannot be used for other purposes.

[0057] The yellow leaf broccoli "y16-2-11" in the following examples is created by the laboratory, which is a leaf color chlorosis mutant occurring in the backcross with "Korso_1401" after the somatic hybridization of broccoli "Korso_1401" and black mustard, and is identified as a recessive leaf color chlorosis broccoli mutant through continuous backcrossing and self-segregation. It has been stabilized as a broccoli-black mustard introgression line in the background of "Korso_1401". The biological material can be obtained from the applicant for the purpose of repeating the experiments of the present application, and cannot be used for other purposes.

[0058] The broccoli "Qingmei 80" and the green broccoli "Yanxiu" in the following examples are commercial varieties, which can be purchased from Shuohe Seed Company.

[0059] The kale "Jingguan Hong 6" in the following examples is a commercial variety, which can be purchased from Jingyan Seed Company.

[0060] The data in the following examples are processed by SPSS11.5 statistical software, and the experimental results are expressed as mean ± standard deviation. One-way ANOVA test is used, P<0.05 (*) indicates significant difference, P<0.01 (**) indicates extremely significant difference, and P<0.001 (***) indicates extremely significant difference.

[0061] Example 1, Method for creating Brassica oleracea L. haploid and polyploid induction lines

[0062] 1. Construction of broccoli BolKCenH3 gene knockout complementary vector

[0063] (1) CRISPR / Cas9 system knockout of broccoli BolKCenH3 gene

[0064] The BolKCenH3 gene sequence is sequence 3 in the sequence listing, and the structure and CRISPR / Cas9 system knockout target site are shown in Figure 1 (i) The target site sequence is designed on the 8th exon sequence of the broccoli BolKCenH3 gene (genomic nucleotide sequence is sequence 4, coding sequence is sequence 3), with a length of 22 bp, sgRNA1: 5'-GCTTTGCGCTATCCATGCAAGG-3'(sequence 9).

[0065] The double-stranded DNA molecule shown in sequence 9 is inserted into the corresponding site of sgRNA-Cas9 double expression vector pBSE401 to obtain CRISPR / Cas9 knockout vector pBSE401-BolKCenH3 (which has been sequenced and verified).

[0066] The structure of the knock-out vector pBSE401-BolKCenH3 is described as follows: a DNA fragment with the sequence of SEQ ID NO: 9 is inserted between the restriction enzyme BsaI of the pBSE401 vector, and the other sequences of the pBSE401 vector remain unchanged to obtain a recombinant plasmid. The knock-out vector pBSE401-BolKCenH3 contains an expression cassette for expressing sgRNA1 and a Cas protein expression cassette.

[0067] (2) Overexpression of the BMCenH3 gene in the knock-out vector pBSE401-BolKCenH3

[0068] The C-terminal of the Maize CenH3 gene is combined with the N-terminal of the Brassica CenH3 gene to obtain a synthetic gene BMCenH3, and the specific nucleotide sequence is SEQ ID NO: 1 in the sequence listing, which is synthesized by Beijing Tianyi Huiyuan Company, and a 35S promoter and an EcoRI enzyme cutting site are added during synthesis.

[0069] The double-stranded DNA molecule of SEQ ID NO: 1 is inserted into the EcoRI site of the pBSE401-BolKCenH3 vector to obtain the editing complementary vector pBSE401-BolKCenH3-BMCenH3 (which has been sequenced and verified). The schematic diagram of the editing complementary vector is as follows Figure 1 (i), the schematic diagram of the pBSE401 editing vector is as follows Figure 1 (ii).

[0070] The structure of the complementary editing vector pBSE401-BolKCenH3-BMCenH3 is described as follows: a DNA fragment with the sequence of SEQ ID NO: 1 is inserted into the fragment of the restriction enzyme EcoRI of the pBSE401-BolKCenH3 vector, and the other sequences of the pBSE401-BolKCenH3 vector remain unchanged to obtain a recombinant plasmid.

[0071] 2. Construction of the cauliflower BolKPLD1 gene knock-out vector.

[0072] The BolKPLD1 gene is a phospholipase gene found to be highly expressed in cauliflower pollen through transcriptome analysis, and it is found to have a high expression level in cauliflower florets and pollen through reverse transcription quantitative analysis Figure 2 ).

[0073] The sequence of the BolKPLD1 gene is SEQ ID NO: 6, and the structure and the CRISPR / Cas9 system knock-out target site are shown in Figure 1(ii). The target site sequence was designed on the sequence of the 2nd exon of the BolK PPLD1 gene (genomic nucleotide sequence is sequence 7, coding sequence is sequence 6), with a length of 22 bp, sgRNA2: 5'-CCTAGAAACTATCTGACGTTCT-3' (sequence 10).

[0074] The double-stranded DNA molecule shown in sequence 10 was inserted into the corresponding site of the sgRNA-Cas9 double expression vector pBSE401 to obtain the CRISPR / Cas9 knockout vector pBSE401-BolK PPLD1 (which has been sequenced and verified).

[0075] The structure of the knockout vector pBSE401-BolK PPLD1 is described as follows: the DNA fragment with sequence 10 is inserted between the restriction endonuclease BsaI of the pBSE401 vector, and the other sequences of the pBSE401 vector remain unchanged to obtain the recombinant plasmid. The knockout vector pBSE401-BolK PPLD1 contains an expression cassette for expressing sgRNA2 and a Cas protein expression cassette.

[0076] 3. Obtaining and identification of transgenic and gene edited strains

[0077] (1) Obtaining of transgenic plants

[0078] The pBSE401-BolK CenH3-MB CenH and pBSE401-BolK PPLD1 prepared in steps 1 and 2 above were introduced into the Agrobacterium EHA105 competent cells (Biolab, MQ0054) to obtain the recombinant bacteria EHA105 / pBSE401-BolK CenH3-MB CenH and EHA105 / pBSE401-BolK PPLD1.

[0079] The two recombinant bacteria EHA105 / pBSE401-BolK CenH3-MB CenH and EHA105 / pBSE401-BolK PPLD1 were used to transform the hypocotyls of broccoli by Agrobacterium infection method, and after co-cultivation, selection, differentiation and rooting, the T0 generation of transgenic broccoli plants was obtained.

[0080] The specific experimental steps are as follows:

[0081] In the following steps, unless otherwise specified, the operation was carried out at 28°C under the condition of 12h light / 12h dark, and EHA105 / pBSE401 empty vector was the control recombinant bacteria.

[0082]

[0083]

[0084]

[0085] 600 600

[0086]

[0087]

[0088]

[0089] ​​​​​​​​​⑧ The selected resistant shoots were transferred to shoot elongation medium (medium obtained by adding Basta and carbenicillin (Cb) to MS medium, with concentrations of Basta and carbenicillin (Cb) of 3 mg / L and 200 mg / L, respectively) to continue growth. The medium was changed every 2 weeks until roots were formed and seedlings emerged, thus obtaining resistant seedlings.

[0090] The obtained resistant seedlings were further tested and screened using Basta test strips to obtain resistant regenerated plants.

[0091] (2) PCR detection of resistant regenerated plants.

[0092] Genomic DNA was extracted from the T0 generation resistant strains using the CTAB method, and then the Cas9 region of the regenerated strains was identified by PCR to screen for positive seedlings. Figure 3 The primer sequences are as follows: 35S-F: 5'-CAAGACCCTTCCTC TATATAAGGA-3'; and nCas9-951-R: 5'-GAGGTTATCCAGGTCATCG-3'. The results showed that all positive seedlings selected using Basta test strips were able to amplify the target band by PCR.

[0093] Transformed and regenerated seedlings of the EHA105 / pBSE401-BolKCenH3-MBCenH strain can also be amplified using BMCenH3 gene-specific primers: MCPY-F: 5'-CTGGATCCATGGCGAGAACCAAACAT-3' and MCPY-R: 5'GACTGCAGTCATGCCCAACGCCTTCCTC-3' to verify the introduction of the BMCenH3 gene (the amplification results are completely consistent with those of the Cas9 primers).

[0094] (3) Identification of gene editing.

[0095] The DNA target editing segments identified in step (2) were amplified by PCR, and the resulting PCR products were sequenced to analyze the gene editing results. The primers used to detect the gene editing status of BolKCenH3 were: CEN-237: 5'-GACATTCCGTTACAAGCCTG-3'; and CEN-546: 5'-TCACAATGGTCTGCCTTTTC-3'; the primers used to detect the gene editing status of BolKPLD1 were: PLD121: 5'-CGATGTGGCCTGAAGGTATC-3'; and PLD325: 5'-CTCTCCGCAGGC TCATACTC-3'.

[0096] In step 2), 22 strains of PCR-verified transformed EHA105 / pBSE401-BolKCenH3-BMCenH3 and 12 strains of EHA105 / pBSE401-BolKPLD1 were obtained.

[0097] In step 2), 22 strains of PCR-verified transformed EHA105 / pBSE401-BolKCenH3-BMCenH3 and 12 strains of EHA105 / pBSE401-BolKPLD1 were obtained.

[0098] The results are as follows: among the 22 strains of T0 generation BolKCenH3-knocked-out cauliflower plants, the BolKCenH3 gene in 13 strains was heterozygously or chimerically mutated (forming the mutant gene BolKcenh3 of BolKCenH3), and two heterozygous mutant strains were taken as examples, and the specific mutation forms are shown in Figure 4 Figure 4 The results show that multiple peaks occur in the target region; PCR monoclonal sequencing is performed on a single plant, and the sequencing results of #1 and #2 show that the BrCenH3 genes of the two plants are both mutated in the target region compared with the wild type.

[0099] The difference between the mutant gene BolKcenh3-1 in the heterozygous mutant strain #1 and the wild-type BolKCenH3 gene of cauliflower is that for the BolKCenH3 gene, one homologous chromosome is consistent with the wild type, and the other homologous chromosome has the following mutation: in the BolKCenH3 gene, “5'-GCTTTGCGCTATCCATGCAAGG-3'” (corresponding to positions 456-477 of SEQ ID No. 3 and positions 1138-1159 of SEQ ID No. 4) is mutated to “5'-GCTTTGCGCTATGCAAGG-3'”. This mutation causes the deletion of 4 nucleotides between positions 13-16 of SEQ ID No. 9 in the sequence table, and the deletion of the nucleotides causes a frameshift and an early termination, resulting in the loss of function of the BolKCenH3 protein localization core region and thus the knockout of the BolKCenH3 gene. The sequencing results of the mutation site and the surrounding nucleotides are shown in Figure 4 .

[0100] ​The difference between the mutant gene BolKcenh3-2 in hybrid mutant line #2 and the wild type BolKCenH3 gene of cauliflower is that for the BolKCenH3 gene, one homologous chromosome is consistent with the wild type, and in the other homologous chromosome, the BolKCenH3 gene is mutated as follows: "5'-GCTTTGCGCTATCCATGCAAGG-3'" (corresponding to positions 456 to 477 of SEQ ID No. 3, positions 1138 to 1159 of SEQ ID No. 4) in the BolKCenH3 gene is mutated to "5'-GCTTTGCGCTATCCATTGCAAGG-3'". The mutation causes the insertion of a nucleotide "T" between positions 16-17 of sequence 9 in the sequence listing, and the insertion of the nucleotide causes a frame shift and a premature termination, resulting in the loss of function of the BolKCenH3 protein localization core region, thereby knocking out the BolKCenH3 gene.

[0101] The T0 plants with the above-mentioned hybrid mutation of the BolKCenH3 gene are denoted as + / BolKcenh3-1 and + / BolKcenh3-2.

[0102] ②For the positive seedlings transformed with EHA105 / pBSE401-BolKPLD1, the primers used to detect the editing of the BolKPLD1 gene are: PLD121: 5'-CGATGTGGCCTGAAGGTATC-3'; and PLD325: 5'-CTCTCCGCAGGCTCATACTC-3'. The PCR amplification products of 12 different lines of T0 plants are sequenced, and according to the sequencing results, the sequences of the second exon target region of the wild type BolKPLD1 gene of cauliflower are compared to identify whether the gene in different lines of T0 transgenic cauliflower plants is mutated.

[0103] The results are as follows: among the 12 T0 generation knockout BolKPLD1 cauliflower plants, the BolKPLD1 gene in 8 plants is homozygously or heterozygously mutated, and two homozygous mutant lines are taken as examples, and the specific mutation forms are as shown in Figure 1 (ii).

[0104] The difference between the mutant gene BolKpld1-1 in mutant line #1 and the wild-type BolKPLD1 gene in cauliflower is that for the BolKPLD1 gene, in both homologous chromosomes, the BolKpld1-1 gene has the following mutation: "5'-CCTAGAAACTATCTGACGTTCT-3'" (corresponding to positions 1849 to 1870 of SEQ ID No. 6, positions 2515 to 2536 of SEQ ID No. 7) in the BolKPLD1 gene is mutated to "5'-CCTAGAA-CTATCTGACGTTCT-3'". This mutation results in the deletion of one nucleotide A between positions 7-9 of sequence 10 in the sequence listing, and this deletion causes a frame shift and leads to premature termination of translation, resulting in loss of function of the BolKPLD1 protein, thereby knocking out the BolKPLD1 gene.

[0105] The difference between the mutant gene BolKpld1-2 in mutant line #2 and the wild-type BolKPLD1 gene in cauliflower is that for the BolKPLD1 gene, in both homologous chromosomes, the BolKpld1-2 gene has the following mutation: "5'-CCTAGAAACTATCTGACGTTCT-3'" (corresponding to positions 1849 to 1870 of SEQ ID No. 6, positions 2515 to 2536 of SEQ ID No. 7) in the BolKPLD1 gene is mutated to "5'-CCTAGACTATCTGACGTTCT-3'". This mutation results in the deletion of two nucleotides AA between positions 6-9 of sequence 10 in the sequence listing, and this deletion causes a frame shift and leads to premature termination of translation, resulting in loss of function of the BolKPLD1 protein, thereby knocking out the BolKPLD1 gene.

[0106] The T0 generation plants homozygous for the above-mentioned BolKPLD1 gene mutation are denoted BolKpld1-1 / BolKpld1-1 and BolKpld1-2 / BolKpld1-2.

[0107] (4) Progeny selfing and identification

[0108] The + / BolKcenh3-1 and + / BolKcenh3-2 T0 generation plants obtained in step ① in the above (3) are successively selfed for two generations, and 20 T1 generation plants are respectively identified for the segregation combination of the BolKcenh3 gene and the BMCenH3 gene. And according to whether the BMCenH3 gene segregates in the T2 generation, the heterozygous (+ / BMCenH3) and homozygous (BMCenH3 / BMCenH3) genotypes of the BMCenH3 in the T1 generation are verified.

[0109] BolKcenh3-1 / BolKcenh3-1; + / BMCenH3 BolKcenh3-2 / BolKcenh3-2; BMCenH3 / BMCenH3 BolKcenh3-1 / BolKcenh3-1; BMCenH3 / BMCenH3 BolKcenh3-2 / BolKcenh3-2. These mutant strains have less pollen than wild type but have partial fertility and can set seeds. Strains with only BMCenH3 gene introduced, heterozygous is denoted as + / BMCenH3, homozygous is denoted as BMCenH3 / BMCenH3, were also obtained.

[0110] The T0 generation of BolKpld1-1 / BolKpld1-1 and BolKpld1-2 / BolKpld1-2 cauliflower plants obtained in step ② of (3) above were selfed and seeds were harvested to obtain T1 generation of BolKpld1 cauliflower knockout mutant strains BolKpld1-1 / BolKpld1-1 and BolKpld1-2 / BolKpld1-2.

[0111] Example 2, Identification of ploidy induction ability of the induced lines (different types of mutant lines) obtained in Example 1

[0112] The mutant lines to be tested include: the ploidy induction ability of the lines + / BMCenH3, BMCenH3 / BMCenH3, + / BMCenH3 BolKcenh3-1 / BolKcenh3-1, BMCenH3 / BMCenH3 BolKcenh3-1 / BolKcenh3-1, + / BMCenH3 BolKcenh3-2 / BolKcenh3-2, BMCenH3 / BMCenH3 BolKcenh3-2 / BolKcenh3-2, BolKpld1-1 / BolKpld1-1 and BolKpld1-2 / BolKpld1-2 obtained in Example 2. The identification method is as follows:

[0113] Each mutant line was used as the male and female parent to cross with four test strains (see Table 2 for specific crossing combinations), including: cauliflower "y16-2-11" and "Qingmei 80", broccoli "Yanxiu", and kale "Jingguan Hong 6". The four test strains all belong to Brassica oleracea var. The cauliflower "y16-2-11" is a recessive leaf color chlorosis mutant with the same genetic background as "Korso_1401" obtained by somatic hybridization, showing the whole plant turning yellow. The kale "Jingguan Hong 6" is a commercial variety, with wrinkled leaves and red color in adult plants, and has some phenotypic differences in leaf shape (clear leaf splitting) with cauliflower at the seedling stage. Cauliflower "Qingmei 80" and broccoli "Yanxiu" are both commercial varieties, and have no obvious phenotypic differences with the induced line cauliflower at the seedling stage, only showing differences in leaf color and flower head at later stages. "Qingmei 80" is a long-stemmed loose flower type cauliflower, which is obviously different from the compact white flower head of "Korso_1401".

[0114] Table 2, each crossing combination and ploidy induction

[0115]

[0116]

[0117] Note: "-" indicates that only haploid phenotypic key plants were screened for flow cytometry in this combination, not all seedlings were measured, and tetraploid measurement results could not be obtained.

[0118] 1. Flow cytometry for identifying leaf ploidy

[0119] The offspring of the crosses in Table 2 above were sown in seed trays. First, the seedlings were observed for traits. The haploid offspring of "y16-2-11" showed a chlorosis phenotype, and the haploid offspring of "Jingguan Hong 6" showed leaf splitting, dwarfism. Flow cytometry was performed on the phenotypic key plants and most of the offspring seedlings, with the specific method as follows:

[0120] The nuclei of the young leaves of the plants to be tested were extracted, and the leaves of the respective diploid test strains were used as controls. The flow cytometry instrument was then used to detect the signals. First, the diploid nuclear signal was detected, and the diploid nuclear signal peak was set to 100. Since the genetic material in diploid cells is twice that in haploid cells, the haploid nuclear signal peak should appear around 50, and the tetraploid nuclear signal peak should appear around 200.

[0121] Taking the flow result of the offspring of the cross between "Yanxiu" as the female parent and the mutant line (+ / BMCenH3 BolKcenh3-1 / BolKcenh3-1) as an example: Figure 5The flow cytometry results of the diploid control, the hybridized haploid and tetraploid offspring of Yanxiu are shown from left to right. The signal peak of Yanxiu is set at 100, and most of the hybridized offspring are enriched in the signal intensity of diploid cell nuclei, and have the same position, so the tested plant is considered to be a normal hybrid diploid F1. If the signal peak of the tested plant appears near 50, it is considered to be a haploid plant. If the signal peak of the tested plant appears near 200, it is considered to be a tetraploid.

[0122] 2. Polymorphic molecular marker identification

[0123] From the published SSR primers on the Brassica database http: / / brassicadb.org, 18 pairs were selected, as shown in Table 1 (one pair on each of the 9 chromosomes). The genomic DNA of Korso_1401 and the test strain parent was used as a template for amplification and polymorphic molecular marker screening. Finally, 4 pairs of molecular markers, BrID10303, BrID10041, BrID10275 and BrID10729, were obtained, which were polymorphic in Korso_1401 and Qingmei80; 5 pairs of molecular markers, BrID10303, BrID10041, BrID10275, BrID101185 and BrID90295, were polymorphic in Korso_1401 and Qinghuacai Yanxiu; and 7 pairs of molecular markers, BrID10303, BrID10041, BrID10275, BrID90295, BrID10703, BrID10205 and BrID10729, were polymorphic in Korso_1401 and Brassica oleracea Jingguan Hong No. 6.

[0124] Table 3, 18 pairs of SSR primer information

[0125]

[0126] The PCR electrophoresis map of molecular marker BrID10729 of the hybrid offspring of the mutant (BMCenH3 / BMCenH3 BolKcenh3-2 / BolKcenh3-2) as the female parent and Jingguan Hong No. 6 as the male parent is shown as follows: Figure 6 Lane 1 is the band type of Jingguan Hong No. 6, lane 2 is the band type of the mutant female parent, lane 3 is the band type of the heterozygous diploid in the offspring, lanes 4 and 5 are the band types of the haploid in the offspring, and lane 6 is the band type of the tetraploid in the offspring. If the tested single plant only has the band of Brassica oleracea Jingguan Hong No. 6, Figure 6If the single plant does not have the band pattern of the parent "mutant" and is a haploid (Fig. 4 and 5, lane 4), it is considered that the single plant does not have the band pattern of the parent "mutant" and is a haploid; if the bands of the "mother mutant" and "Jingguan Hong 6" are present in the single plant of the normal diploid F1 hybrid offspring (Fig. 4 and 5, lane 5), it is considered that the single plant has the band pattern of the parent "mutant" and is a diploid. Figure 6 If the single plant does not have the band pattern of the parent "mutant" and is a haploid (Fig. 4 and 5, lane 4), it is considered that the single plant does not have the band pattern of the parent "mutant" and is a haploid; if the bands of the "mother mutant" and "Jingguan Hong 6" are present in the single plant of the normal diploid F1 hybrid offspring (Fig. 4 and 5, lane 5), it is considered that the single plant has the band pattern of the parent "mutant" and is a diploid.

[0127] 3. Phenotypic identification

[0128] The obtained haploid and tetraploid plants were continuously observed for phenotypes.

[0129] Taking the hybrid offspring of yellow-leaved broccoli "y16-2-11" and kale "Jingguan Hong 6" as an example, if it is a haploid, it has the same phenotype as the test parent at the seedling stage and has a more obvious phenotypic difference from the hybrid F1 generation (Fig. 6, lanes a and b). Figure 7

[0130] In the hybrid offspring of the test plants broccoli "Yanxu" and "Qingmei 80", the haploids have no significant phenotypic difference from the diploid F1 at an early stage, and only the plant size cannot be completely determined, and the leaf color and flower ball color characteristics are significantly different at a later stage.

[0131] The haploid has the characteristics of shorter plant, narrower leaves, compact plant type, male sterility, etc. compared with the diploid, such as Figure 7 (c, d, e) are the comparison of the haploid offspring of "Qingmei 80" and the diploid. During the hybridization process, tetraploids and aneuploids were also induced, and the phenotype of the tetraploids was continuously observed: the tetraploids showed inconsistent performance, some were weak and even died, some had wide and thick leaves, strong growth, large flower balls, high yield, and obvious disease and pest resistance, such as Figure 7 f in Fig. 6.

[0132] Based on the above identification results, it can be seen that by introducing the BMCenH3 gene to complement the BolKcenh3 mutation lethal phenotype, the technical bottleneck is broken, and BolKCenH3 homozygous edited strains can be obtained. It is proved that in the background of BMCenH3, BolKcenh3 as a male or female parent is crossed with other materials, and the haploid and polyploid of Brassica oleracea varieties are obtained in the offspring; BMCenH3 heterologous expression strain + / BMCenH3 and BMCenH3 / BMCenH3 also have haploid induction function; the knockout homozygous mutant BolKPLD1 of BolKPLD1 gene can be used as a male parent to induce the haploid of the female parent of Brassica oleracea vegetables, the haploid induction rate obtained by the present application is 0.47%-1.65%; the tetraploid induction rate is 0.60%-2.63%. Induction rate (%) = (number of haploid or tetraploid plants / total number of test plants) x 100%.

[0133] ​Meanwhile, in Table 2, some combinations of hybrid offspring did not obtain haploid and / or tetraploid, which may be caused by insufficient seed quantity of hybrid offspring and low induction rate.

[0134] The present application also attempts to knock out and edit the BolKCenH3 gene, and 23 hybrid and chimeric BolKCenH3 gene editing strains T0 are obtained, but when the T1 generation of the editing strains is identified, no homozygous editing strain is identified in 50 T1 offspring of each T0 strain, (only one strain is very weak and dies quickly at the seedling stage). It is proved that BolKCenH3 gene homozygous knockout mutation BolKcenh3 is lethal, which is also a technical bottleneck that has been hindering the application of haploid induction of the gene.

[0135] Therefore, the present application adopts the method of transforming the editing knockout complementary vector to construct the pBSE401-BolKCenH3-BMCenH3 vector, which contains an editing target, introduces the expression of BMCenH3 gene while knocking out the endogenous BolKCenH3 gene of Brassica, as a functional complement of BolKcenh3 mutant, breaks through the technical bottleneck of CenH3 gene knockout lethality, realizes the application of CenH3 gene in Brassica ploidy induction for the first time, and obtains Brassica haploid and / or polyploid.

[0136] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that the present application can be further improved. In general, according to the principle of the present application, the present application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which deviates from the range disclosed in the present application.

Claims

1. A method for preparing Brassica oleracea L.var.botrytis L.vegetable haploid and / or tetraploid: (1) the C-terminal of the maize CenH3 gene is combined with the N-terminal of the Brassica CenH3 gene to obtain a synthetic gene BMCenH3 , a functional complementation editing vector is constructed; the functional complementation editing vector is obtained by overexpressing the BMCenH3 gene in a starting vector; the starting vector contains a target sequence for knocking out the endogenous BolKCenH3 gene in Brassica napus (2) Through transcriptome data analysis and quantitative expression verification, the cauliflower phospholipase coding gene BolKPLD1 , the method comprising the steps of BolKPLD1 constructing BolKPLD1 a gene knockout vector; (3) transforming the functional complementation editing vector of step (1) into a Brassica oleracea vegetable of the recipient to obtain a Brassica oleracea vegetable capable of expressing the gene of step (1) and knocking out the loss-of-function mutant of the gene of step (1) BMCenH3 (4) transforming the gene knockout vector of step (2) into a Brassica oleracea vegetable of the recipient to obtain a Brassica oleracea vegetable of the recipient BolKCenH3 (5) the Brassica oleracea vegetable of the recipient is broccoli Korso_1401 BolKcenh3 (6) the Brassica oleracea vegetable of the recipient is broccoli Korso_1401 BolKPLD1 (7) the Brassica oleracea vegetable of the recipient is broccoli Korso_1401 BolKPLD1 (8) the Brassica oleracea vegetable of the recipient is broccoli Korso_1401 BolKpld1 (9) the Brassica oleracea vegetable of the recipient is broccoli Korso_1401 (4) continuously self-crossing the T0 generation functional deletion mutant obtained in step (3) to obtain a homozygous edited mutant strain of the gene or the gene BolKcenh3 and the BolKPLD1 knockout functional deletion mutant BolKpld1 is continuously self-crossed to obtain a homozygous edited mutant strain of the gene or the gene BMCenH3 BolKcenh3 BolKpld1 The homozygous mutant strain; the mutation site of the homozygous mutant strain is located in the gene or the gene BolKCenH3 BolKPLD1 gene​​​ (5) obtaining the plant of Brassica oleracea L. var. capitata L. from the plant of Brassica oleracea L. var. capitata L. obtained in step (4) BolKcenh3 The homozygous edited mutant strain is used as a male parent to cross with other Brassica oleracea plants to obtain hybrid offspring, and the hybrid offspring is screened to obtain a haploid of Brassica oleracea, and the other Brassica oleracea plant is broccoli Qiming 80. or, obtaining said BolKcenh3 The homozygous edited mutant strain is used as a female parent to cross with other Brassica napus plants to obtain hybrid offspring, and the hybrid offspring is screened to obtain a Brassica napus haploid, and the other Brassica napus plants are broccoli y16-2-11 or kale Jingguanred No.

6. or, obtaining said BolKcenh3 The homozygous edited mutant strain is used as a male parent to cross with other Brassica napus plants to obtain hybrid offspring, and the hybrid offspring is screened to obtain a Brassica napus tetraploid material, and the other Brassica napus plants are broccoli Qianmei 80 or Qinghuacai Yanshu. or, obtaining said BolKpld1 The homozygous edited mutant strain is used as a male parent to cross with other Brassica napus plants to obtain hybrid offspring, and the hybrid offspring is screened to obtain a haploid material of Brassica napus, and the other Brassica napus plants are broccoli y16-2-11 or green broccoli yanxiu or kale jingguan red No.

6. The BMCenH3 The nucleotide sequence of the gene is SEQ ID 1 in the sequence listing; The BolKCenH3 The coding sequence of the gene is SEQ ID NO: 3 in the sequence listing; The BolKPLD1 The coding sequence of the gene is SEQ ID NO: 6 in the sequence listing.

2. The method of claim 1, wherein: The gene editing is knockout by CRISPR / Cas9 system. 3.The method according to claim 1 or 2, characterized in that: 1) the functional complementation editing vector contains BolKCenH3 a gene editing target point, the editing target sequence is nucleotides 456-477 of SEQ ID NO: 3; 2) said BolKPLD1 The gene knockout vector contains BolKPLD1 The gene editing target is nucleotides 1849-1870 of SEQ ID NO:

6.

4. The method of claim 1 or 2, wherein: The screening in step (5) comprises the following methods: A1) molecular marker assisted screening; A2) flow cytometry assisted screening of leaf ploidy.

5. A method of breeding Brassica oleracea vegetables, characterized by: The breeding is performed by the method according to any one of claims 1-4; the purpose of Brassica oleracea L.var.botrytis L.vegetable breeding comprises cultivating Brassica oleracea L.var.botrytis L.haploid and / or tetraploid material. 6.The use of the method according to any one of claims 1-3 in creating Brassica oleracea L.var.botrytis L.haploid and / or tetraploid.

7. Synthetic gene BMCenH3 the nucleotide sequence of which is represented in the sequence listing as SEQ ID 1.

Citation Information

Patent Citations

  • Broccoli BoCENH3 gene and application thereof in haploid induction

    CN117305326A