Marker developed based on short indel and application

Abstract

The invention provides a marker developed based on short indel and application, and belongs to the technical field of genetic typing. The invention provides a method for designing primers aiming at short indel, a first primer is designed near an indel sequence existing in two genomes, the last basic group at the 3'end of the first primer is required to fall on an insertion sequence, and it is ensured that the first primer can only form double strands with parent DNA with an insertion fragment. Designing a second primer at the same position of another genome, wherein the second primer is required to cross the deletion site and the 5'end of the second primer cannot form double strands with the insertion sequence; the primer designed by the method is subjected to PCR (Polymerase Chain Reaction) amplification, a product is subjected to agarose gel electrophoresis, then genetic typing and parent identification can be completed based on an electrophoretic band, and indel as short as 1bp between parent genomes can be distinguished.

Description

Technical Field

[0001] The present invention belongs to the technical field of genotyping, and particularly relates to a marker developed based on short indels and its application. Background Art

[0002] The development of whole-genome sequencing and re-sequencing technologies has brought great convenience to animal and plant breeding. There are many natural variations among different varieties of the same species, and SNPs and indels are the most common types of variations in chromosomes. Currently, many molecular markers have been designed for SNP and indel for molecular design breeding. In natural populations, indels vary in length, and the genome includes indels ranging from dozens of kb to as short as 1 bp. Usually, the indels developed into molecular markers have lengths between dozens and hundreds of bp. By designing primers at both ends of the indel marker, a product containing the indel is amplified by PCR, and then the differences at the indel in different varieties can be identified by agarose gel electrophoresis detection.

[0003] However, the more common indels in the genome are those with lengths of 10 bp or even 5 bp or less. For this type of indel marker, due to the low accuracy of agarose gel electrophoresis and its inability to distinguish too short sequences, and the time and complexity of polyacrylamide gel electrophoresis required to distinguish such fragments are much higher than those of ordinary agarose gel electrophoresis. Therefore, it is necessary to improve the primer design scheme and identification method for short indels. Summary of the Invention

[0004] The present invention provides a marker developed based on short indels and its application, which can simply genotype indels as short as 1 bp by agarose gel electrophoresis, with high accuracy and good specificity.

[0005] The present invention provides a method for designing primers for short indel sequences on a genome, comprising the following steps: using a first genome and a second genome with indel variations, designing a first primer near the short indel sequence on the first genome with an insertion sequence, and the last base at the 3' end of the first primer falling on the insertion sequence;

[0006] Designing a second primer at the same position on the second genome with a deletion sequence, the second primer spanning the deletion sequence, and the 5' end of the second primer not forming a double strand with the insertion sequence;

[0007] The length of the short indel sequence is not more than 10 bp.

[0008] In a preferred embodiment of the present invention, both the first primer and the second primer are upstream primers.

[0009] In a preferred embodiment of the present invention, after designing the upstream primer, a universal downstream primer is further designed.

[0010] The present invention also provides the application of the primer set designed by the above primer design method in the development of indel molecular markers.

[0011] In a preferred embodiment of the present invention, it includes configuring a PCR amplification system with the primer set and then performing PCR amplification, and performing genotyping on the amplification product by agarose gel electrophoresis.

[0012] In a preferred embodiment of the present invention, the procedure of the PCR amplification includes: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 3 min, annealing at (Tm - 5)°C for 30 s, extension at 72°C, with extension carried out at 1 kb / min, for 35 cycles; and further extension at 72°C for 5 min.

[0013] The present invention also provides an indel molecular marker kit developed for the quinoa epidermal vesicle cell density, including insertion-F with the nucleotide sequence shown in SEQ ID No.1, Deletion-F with the nucleotide sequence shown in SEQ ID No.2, and the universal primer R with the nucleotide sequence shown in SEQ ID No.3.

[0014] The present invention also provides a method for differentiating quinoa using the epidermal vesicle cell density, including using the genomic DNA of the test sample as a template, performing PCR amplification using the above indel molecular marker kit, and performing genotyping on the amplification product by agarose gel electrophoresis;

[0015] When only a single band can be amplified using the primer insertion-F and the universal primer R, it is a variety with a high epidermal vesicle cell density;

[0016] When only a single band can be amplified using the primer Deletion-F and the universal primer R, it is a variety with a low epidermal vesicle cell density;

[0017] When a single band can be amplified using both the primer pair consisting of insertion-F and the universal primer R and the primer pair consisting of Deletion-F and the universal primer R, it is a hybrid of a variety with a high epidermal vesicle cell density and a variety with a low epidermal vesicle cell density.

[0018] The present invention also provides an indel molecular marker kit developed for the rice brown planthopper resistance, including insertion-F with the nucleotide sequence shown in SEQ ID No.4, Deletion-F with the nucleotide sequence shown in SEQ ID No.5, and the universal primer R with the nucleotide sequence shown in SEQ ID No.6.

[0019] The present invention also provides a method for differentiating rice by using brown planthopper resistance, which includes using the genomic DNA of a sample to be tested as a template, performing PCR amplification by using the above-mentioned indel molecular marker kit of the claims, and performing gene typing on the amplification product by using agarose gel electrophoresis;

[0020] When only one band can be amplified by using the primer insertion-F and the universal primer R, it is a high brown planthopper-resistant variety;

[0021] When only one band can be amplified by using the primer Deletion-F and the universal primer R, it is a low brown planthopper-resistant variety;

[0022] When one band can be amplified by using the primer pair composed of insertion-F and the universal primer R and the primer pair composed of Deletion-F and the universal primer R, it is a hybrid of a high brown planthopper-resistant variety and a low brown planthopper-resistant variety.

[0023] The present invention also provides an indel molecular marker kit developed for rice sheath blight resistance, which includes OsERF65 insertion-F with the nucleotide sequence shown in SEQ ID No.7, OsERF65 deletion-F with the nucleotide sequence shown in SEQ ID No.8, and the universal primer R with the nucleotide sequence shown in SEQ ID No.9.

[0024] Beneficial effects: The present invention provides a method for designing primers for short indels. The first primer is designed near the indel sequence in two genomes, and it is required that the last base at the 3' end of the first primer falls on the inserted sequence, ensuring that the first primer can only form a double strand with the parental DNA with the inserted fragment. Then, the second primer is designed at the same position in the other genome, and it is required that the second primer spans the deletion site and the 5' end of the second primer cannot form a double strand with the inserted sequence.

[0025] After PCR amplification of the primers designed by the above method, the present invention performs agarose gel electrophoresis on the products, and then gene typing and parental identification can be completed based on the electrophoresis bands. It has been verified that the method of the present invention can differentiate indels as short as 1 bp between parental genomes, which has made a great leap in the selection of gene markers and simplified the operation process. Brief Description of the Drawings

[0026] Figure 1 It is a schematic diagram for the design of short indel markers;

[0027] Figure 2Schematic diagram and results of short indel markers distinguishing quinoa Faro and QQ65. Figure A is the EBC density map of the parent Faro and the parent QQ65, B is the sequence alignment of the indel fragments of Faro and QQ65; C is the molecular marker results map;

[0028] Figure 3 A diagram showing the genotypes of rice B5 and Nip on Bph14 differentiated by short indel markers. Figure A shows the sequence alignment of the indel fragments of rice B5 and Nip on Bph14; Figure B shows the molecular marker results.

[0029] Figure 4 A diagram showing the genotypes of wild-type rice varieties and gene-edited mutants distinguished by short indel markers. Figure A shows the sequence alignment of indel fragments in wild-type rice varieties and gene-edited mutants; Figure B shows the molecular marker results. DETAILED DESCRIPTION

[0030] The present invention provides a method for designing primers for short indel sequences on a genome, comprising the following steps: using a first genome and a second genome having indel variations, designing a first primer near the short indel sequence on the first genome having an insertion sequence, wherein the last base at the 3' end of the first primer falls on the insertion sequence;

[0031] Designing a second primer at the same position on the second genome where the deleted sequence exists, wherein the second primer spans the deleted sequence, and the 5' end of the second primer does not form a double strand with the inserted sequence;

[0032] The length of the short indel sequence is no longer than 10 bp.

[0033] The mechanism and process of the primer design method of the present invention are as follows Figure 1 As shown, first, two genomes with indel variations are compared, such as the two parental genomes of a hybrid, to find suitable indels and design primers. In an embodiment of the present invention, both parental genomes are compared in Geneious 10.2.6 to find short indel sequences, such as indel sequences less than 10 bp in length. Then, a fragment region to be amplified is selected near the selected short indel sequence, that is, the last base of the 3' end of a primer falls on the insertion sequence, ensuring that this primer can only form a double strand with the parental DNA with the inserted fragment; then, a primer is designed for the same position in the other genome, requiring this primer to cross the deletion site and ensuring that the 5' end of this primer cannot form a double strand with the insertion sequence. The present invention performs primer design based on the selected position and the primer design function of the Geneious 10.2.6 software.

[0034] Both of the two primers designed in the present invention are upstream primers. It is also necessary to design a universal downstream primer. The universal downstream primer can search for a completely identical sequence near the indel or in other regions, and design the universal downstream primer based on the fragment that is completely identical in both genomes, ensuring that it can match both parents.

[0035] The present invention also provides the application of the primer set obtained by the above primer design method in the development of indel molecular markers.

[0036] Using the primers designed by the method of the present invention, after PCR amplification, the product is subjected to agarose gel electrophoresis, such as 1% concentration agarose gel electrophoresis used in the examples, to ensure that each parent can amplify a unique band pattern, and the product is recovered and the correctness of the amplified sequence can be proved by sanger sequencing. Through the two pairs of primers designed at the indel marker in two genomes or two parents, indels as short as 1 bp between the parental genomes can be distinguished.

[0037] In a preferred embodiment of the present invention, the program of the PCR amplification includes: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 3 min, annealing at (Tm - 5) °C for 30 s, extension at 72 °C, extending at a rate of 1 kb / min, for 35 cycles; and then extension at 72 °C for 5 min.

[0038] The present invention also provides an indel molecular marker kit developed for the epidermal vesicle cell density of quinoa, which includes insertion-F with the nucleotide sequence shown in SEQ ID No.1, Deletion-F with the nucleotide sequence shown in SEQ ID No.2, and the universal primer R with the nucleotide sequence shown in SEQ ID No.3.

[0039] In an embodiment of the present invention, a relative trait difference in the density of epidermal bladder cells (EBCs) was found in quinoa varieties Faro and QQ65. Among them, the EBC density of the parent Faro (variety number P0267, USDA number PI 634920) is much higher than that of the parent QQ65 (variety number P0220, USDA number PI 614880). The candidate gene regulating the EBC density is in the interval of 53.55 Mb - 53.86 Mb on chromosome 10 (QQ74-V2), and this interval contains some short indels. The present invention takes Figure 2The indel fragment shown in B, that is, there is a 5bp insertion in the parental Faro genome, and this sequence is deleted in QQ65. Based on the indel fragment, the present invention designs two pairs of marker primers. The last base at the 3' end of insertion-F is located within the insertion, while deletion-F spans after the insertion, and the last base at its 3' end is after spanning the insertion. Then, a completely identical sequence is found in the Faro and QQ65 genomes to design the R primer. Their sequences are as follows:

[0040] Faro insertion F primer (SEQ ID No.1): GAAGGGACACCCTTACATT;

[0041] QQ65 deletion F primer (SEQ ID No.2): GAAGGGACACCCTTACAACC;

[0042] Universal R primer (SEQ ID No.3): ACCTTGACTATCGTAGGAGTAAGT.

[0043] The present invention also provides a method for distinguishing quinoa by using the epidermal vesicle cell density, including using the genomic DNA of the sample to be tested as a template, performing PCR amplification using the above indel molecular marker kit, and performing genotyping on the amplification product using agarose gel electrophoresis;

[0044] When only a single band can be amplified using primer insertion-F and the universal primer R, it is a variety with a high epidermal vesicle cell density;

[0045] When only a single band can be amplified using primer Deletion-F and the universal primer R, it is a variety with a low epidermal vesicle cell density;

[0046] When a single band can be amplified using both the primer pair consisting of insertion-F and the universal primer R and the primer pair consisting of Deletion-F and the universal primer R, it is a hybrid of a variety with a high epidermal vesicle cell density and a variety with a low epidermal vesicle cell density.

[0047] In one embodiment of the present invention, three primers shown in SEQ ID No.1 to SEQ ID No.3 were created based on the Faro and QQ65 genomes. After verification, it was found that the insertion-F and R primers could specifically amplify the insertion fragment of Faro, and the corresponding deletion-F and R primers could specifically amplify the deletion fragment of QQ65. Therefore, the primer pairs composed of SEQ ID No.1 and SEQ ID No.3, and the primer pairs composed of SEQ ID No.2 and SEQ ID No.3 can specifically identify the two parents, Faro and QQ65, respectively. At the same time, the genomes of the hybrid offspring contain genomic sequences from both Faro and QQ65. Therefore, bands can be amplified when using the pair of insertion-F and R primers and the pair of deletion-F and R primers to identify F1. In summary, using the primer pairs of the present invention, two parents and heterozygous genotypes can be distinguished.

[0048] The present invention also provides an indel molecular marker kit developed for rice brown planthopper resistance, including insertion-F with a nucleotide sequence as shown in SEQ ID No.4, Deletion-F with a nucleotide sequence as shown in SEQ ID No.5, and a universal primer R with a nucleotide sequence as shown in SEQ ID No.6.

[0049] Rice in this field includes varieties with significant resistance to brown planthopper, such as indica rice variety B5, and there are also brown planthopper-susceptible varieties, such as rice varieties like Nipponbare. According to the genomic sequencing information, there is a 3bp indel in the gene coding region of the brown planthopper resistance gene Bph14 in B5 and Nipponbare.

[0050] B5 Bph14-F (SEQ ID No.4): CGTGTGTTCTTAGCTGCTCTAG;

[0051] Nip Bph14-F (SEQ ID No.5): CGTGTGTTCTTAGCTCTAGGAG;

[0052] Universal R primer for B5 and Nip in the Bph14 gene region (SEQ ID No.6): GCTAAGGTGGTCTTGCCCAT.

[0053] The present invention also provides a method for distinguishing rice using brown planthopper resistance, including using the genomic DNA of the sample to be tested as a template, performing PCR amplification using the above indel molecular marker kit of the claim, and performing gene typing on the amplification product using agarose gel electrophoresis;

[0054] When only one band can be amplified using primer insertion-F and universal primer R, it is a high brown planthopper-resistant variety;

[0055] When only one band can be amplified using primer Deletion-F and universal primer R, it is a low brown planthopper-resistant variety;

[0056] When using the primer pair composed of insertion-F and universal primer R and the primer pair composed of Deletion-F and universal primer R, and one band can be amplified for both, it is a hybrid of a high brown planthopper-resistant variety and a low brown planthopper-resistant variety.

[0057] In an embodiment of the present invention, two pairs of primers are designed using the above method. The last base at the 3' end of B5 Bph14-F is located in the insertion, and after NipBph14-F crosses the insertion, the last base at its 3' end also crosses the insertion. Then, a completely identical sequence is found in the B5 and NipBph14 gene sequences to design the Bph14-R primer. Therefore, the B5 Bph14-F and Bph14-R primers can specifically amplify this fragment of B5, and the corresponding NipBph14-F and Bph14-R primers can specifically amplify this fragment of Nip. These two pairs of primer combinations can specifically identify the two parents B5 and Nip respectively. At the same time, since the F1 generation is a heterozygote and its genome contains genomic sequences from both B5 and Nip, both the primer pair B5 Bph14-F and Bph14-R and the primer pair Nip Bph14-F and Bph14-R can amplify bands when used to identify F1. These two pairs of primers can distinguish the two parents and the heterozygous genotype.

[0058] The present invention also provides an indel molecular marker kit for developing rice sheath blight resistance, which includes OsERF65 insertion-F with the nucleotide sequence shown in SEQ ID No.7, OsERF65 deletion-F with the nucleotide sequence shown in SEQ ID No.8, and universal primer R with the nucleotide sequence shown in SEQ ID No.9.

[0059] The gene related to rice sheath blight resistance in the present invention is ERF65 (Os07g0617000). When gene editing means are used to edit the ERF65, a series of mutations are found in the offspring through sequencing, and there is a 1bp indel mutation among them. Using the primer design method of the present invention, primers are designed for this short indel site: the last base at the 3' end of OsERF65 insertion-F is located in the insertion, and after OsERF65 deletion-F crosses the insertion, the last base at its 3' end also crosses the insertion. Then, a completely identical sequence is found in the wild-type and mutant gene sequences, and the OsERF65-R primer is designed.

[0060] OsERF65 insertion-F (SEQ ID No.7): GGAAGAGGAAGACGCGATACC;

[0061] OsERF65 deletion-F (SEQ ID No.8): GGAAGAGGAAGACGCGATACG;

[0062] Universal R primer (SEQ ID No.9): TGCATGTAGCTCGGATCGTC.

[0063] Then, gene amplification is carried out by means of PCR amplification, and agarose gel electrophoresis is performed on the amplification product. The mutation type of the indel site can be confirmed according to the bands after electrophoresis.

[0064] In order to further illustrate the present invention, the following describes in detail a marker and its application developed based on short indels provided by the present invention in combination with examples, but they cannot be understood as limiting the protection scope of the present invention.

[0065] Example 1 Using short indels to design markers to distinguish the genotypes of specific regions on chromosome 8 of two quinoa parents

[0066] A relative trait difference in the density of epidermal bladder cells (EBCs) was found in quinoa varieties Faro and QQ65. Among them, the EBC density of parent Faro is much higher than that of parent QQ65 ( Figure 2 in A), and it was found that the candidate gene regulating this trait is in the interval of 53.55 Mb to 53.86 Mb on chromosome 10. According to Figure 2As shown by the principle of B, there is a 5bp insertion in the parental Faro genome, and QQ65 lacks this sequence segment. Therefore, two pairs of marker primers were designed here:

[0067] Faro insertion F primer (SEQ ID No.1): GAAGGGACACCCTTACATT;

[0068] QQ65 deletion F primer (SEQ ID No.2): GAAGGGACACCCTTACAACC;

[0069] Universal R primer (SEQ ID No.3): ACCTTGACTATCGTAGGAGTAAGT.

[0070] The configured PCR system is: 1μL of Faro insertion F primer / QQ65 deletion F primer, 1μL of universal R primer, 10μL of 2× Taq enzyme, and supplemented with ddH2O to 20μL.

[0071] The set PCR reaction program is as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 3 min, annealing at 60°C for 30 s, extension at 72°C for 30 s, 35 cycles; re-extension at 72°C for 5 min.

[0072] The results are as Figure 2 shown in C. The primer pair composed of Faro insertion F primer and universal R primer can amplify a band containing the inserted fragment in the parental Faro; the primer pair composed of QQ65 deletion F primer and universal R primer can amplify a band lacking the inserted fragment in the parental QQ65; while for the hybrid F1 generation of Faro and QQ65, a band containing the inserted fragment and a band lacking the inserted fragment can be amplified simultaneously.

[0073] Example 2 Use short indel to design markers to distinguish the genotypes of two rice parents in specific regions on specific chromosomes

[0074] Bph14 (Os03g0848700) is a typical gene resistant to brown planthopper, and the indica rice variety B5 has significant resistance to brown planthopper. However, rice varieties such as Nipponbare are susceptible to brown planthopper. According to the genome sequencing information, it is found that as Figure 3As shown, there are many SNPs and some indels in the gene coding regions of Bph14 in B5 and Nipponbare. It was also found that there is a 3-bp indel in the gene coding region of Bph14. Therefore, two pairs of marker primers were designed here. The last base at the 3' end of B5 Bph14-F is located in the insertion, while after Nip Bph14-F crosses the insertion, the last base at its 3' end also crosses the insertion. Then, a completely identical sequence was found in the B5 and Nip Bph14 gene sequences to design the Bph14-R primer.

[0075] B5 Bph14-F (SEQ ID No.4): CGTGTGTTCTTAGCTGCTCTAG;

[0076] Nip Bph14-F (SEQ ID No.5): CGTGTGTTCTTAGCTCTAGGAG;

[0077] Universal R primer for B5 and Nip in the Bph14 gene region (SEQ ID No.6): GCTAAGGTGGTCTTGCCCAT.

[0078] The configured PCR system is as follows: 1 μL of B5 Bph14-F / Nip Bph14-F, 1 μL of the universal R primer, 10 μL of 2× Taq enzyme, and supplemented with ddH2O to 20 μL.

[0079] The set PCR reaction program is as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 3 min, annealing at 60°C for 30 s, extension at 72°C for 20 s, for 35 cycles; then extension at 72°C for 5 min.

[0080] The results are as Figure 3 shown. The B5 Bph14-F and Bph14-R primers can specifically amplify this fragment of B5, and the corresponding Nip Bph14-F and Bph14-R primers can specifically amplify this fragment of Nip. These two pairs of primer combinations can specifically identify the two parents B5 and Nip respectively. At the same time, since the F1 generation is a heterozygote and its genome contains the genomic sequences from both B5 and Nip, both the pair of primers B5 Bph14-F and Bph14-R and the pair of primers Nip Bph14-F and Bph14-R can amplify bands when used to identify the F1. These two pairs of primers can distinguish the two parents and the heterozygous genotype.

[0081] Example 3 Using short indels to design markers to distinguish rice parents and genotypes of gene-edited offspring in specific regions on specific chromosomes

[0082] ERF65 (Os07g0617000) plays an important role in resisting sheath blight and is thus widely used in breeding. The wild-type variety was used to perform gene editing on ERF65. Sequencing revealed a series of mutations in the offspring. One type of them is the deletion of 1 bp, as Figure 4 shown. To more conveniently identify related mutants subsequently, two pairs of marker primers were designed here. The last base at the 3' end of OsERF65 insertion-F is located in the insertion, while OsERF65 deletion-F spans after the insertion, and the last base at its 3' end also spans the insertion. Then, a completely identical sequence was found in the wild-type and mutant gene sequences to design the OsERF65-R primer.

[0083] OsERF65 insertion-F (SEQ ID No.7): GGAAGAGGAAGACGCGATACC;

[0084] OsERF65 deletion-F (SEQ ID No.8): GGAAGAGGAAGACGCGATACG;

[0085] Universal R primer (SEQ ID No.9) for wild-type and mutant in the OsERF65 gene region: TGCATGTAGCTCGGATCGTC.

[0086] The configured PCR system is: 1 μL of OsERF65 insertion-F / OsERF65 deletion-F, 1 μL of universal R primer, 10 μL of 2× Taq enzyme, and ddH2O is added to make up to 20 μL.

[0087] The set PCR reaction program is as follows: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 3 min, annealing at 60 °C for 30 s, extension at 72 °C for 20 s, 35 cycles; extension at 72 °C for another 5 min.

[0088] The results are as Figure 4 shown. OsERF65 insertion-F and the universal R primer can specifically amplify this fragment of the wild-type, and correspondingly, OsERF65 deletion-F and the universal R primer can specifically amplify this fragment of the F2 mutant. These two pairs of primer combinations can specifically identify the wild-type and F2 mutants respectively.

[0089] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer design method for short indel sequences on a genome, characterized in that, It includes the following steps: Using a first genome and a second genome with indel mutations, designing a first primer near the short indel sequence on the first genome with an insertion sequence, and the last base at the 3' end of the first primer falling on the insertion sequence; Designing a second primer at the same position on the second genome with a deletion sequence, the second primer spanning the deletion sequence, and the 5' end of the second primer not forming a double strand with the insertion sequence; The length of the short indel sequence is not more than 10 bp.

2. The primer design method according to claim 1, wherein Both the first primer and the second primer are upstream primers.

3. The primer design method according to claim 2, wherein After designing the upstream primers, it further includes designing a universal downstream primer.

4. Application of the primer set designed by the primer design method according to any one of claims 1 to 3 in the development of indel molecular markers.

5. The application according to claim 4, wherein It includes configuring a PCR amplification system with the primer set and then performing PCR amplification, and performing genotyping on the amplification product using agarose gel electrophoresis.

6. An indel molecular marker kit developed for the cell density of quinoa epidermal vesicles, characterized in that, It includes insertion-F with a nucleotide sequence as shown in SEQ ID No.1, Deletion-F with a nucleotide sequence as shown in SEQ ID No.2, and a universal primer R with a nucleotide sequence as shown in SEQ ID No.

3.

7. A method for differentiating quinoa by using the cell density of epidermal vesicles, characterized in that, It includes using the genomic DNA of the test sample as a template, performing PCR amplification using the indel molecular marker kit according to claim 6, and performing genotyping on the amplification product using agarose gel electrophoresis; When only one band can be amplified using the primer insertion-F and the universal primer R, it is a variety with a high epidermal vesicle cell density; When only one band can be amplified using the primer Deletion-F and the universal primer R, it is a variety with a low epidermal vesicle cell density; When one band can be amplified using both the primer pair consisting of insertion-F and the universal primer R and the primer pair consisting of Deletion-F and the universal primer R, it is a hybrid of a variety with a high epidermal vesicle cell density and a variety with a low epidermal vesicle cell density.

8. An indel molecular marker kit developed for resistance to the brown planthopper in rice, characterized in that, It includes insertion-F with a nucleotide sequence as shown in SEQ ID No.4, Deletion-F with a nucleotide sequence as shown in SEQ ID No.5, and a universal primer R with a nucleotide sequence as shown in SEQ ID No.

6.

9. A method for differentiating rice by using brown planthopper resistance, characterized in that, It includes using the genomic DNA of the test sample as a template, performing PCR amplification using the indel molecular marker kit according to claim 8, and performing genotyping on the amplification product using agarose gel electrophoresis; When only one band can be amplified using the primer insertion-F and the universal primer R, it is a variety highly resistant to brown planthopper; When only one band can be amplified using the primer Deletion-F and the universal primer R, it is a variety with low resistance to brown planthopper; When one band can be amplified using both the primer pair consisting of insertion-F and the universal primer R and the primer pair consisting of Deletion-F and the universal primer R, it is a hybrid of a variety highly resistant to brown planthopper and a variety with low resistance to brown planthopper.

10. An indel molecular marker kit for developing the resistance to rice sheath blight, characterized in that, OsERF65 insertion-F including the nucleotide sequence shown in SEQ ID No.7, OsERF65 deletion-F including the nucleotide sequence shown in SEQ ID No.8, and universal primer R including the nucleotide sequence shown in SEQ ID No.9.

Images