Blood lipid level modulation biomarkers

Abstract

The invention relates to blood lipid level modulation biomarkers. Specifically, the invention provides application of a reagent for detecting the genome SNP marker rs80022746 in preparation of a reagent for predicting the blood fat level of mammals.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology, and particularly to SNP markers related to blood lipid levels and their applications. Background Art

[0002] Conventional total cholesterol, triglyceride, and low-density lipoprotein cholesterol levels in plasma are important inducing factors for the occurrence of early pathological changes in coronary atherosclerosis, and are usually related to multiple cardiovascular diseases, type 2 diabetes, accompanying metabolic disorders, and the therapeutic effect of antihyperlipidemia. Through large-scale epidemiological investigations and genetic studies in recent years, blood lipid levels have become important independent risk factors for a series of cardiovascular diseases and related metabolic diseases such as coronary heart disease, myocardial infarction, atherosclerosis, and dyslipidemia. Therefore, they can be used as important predictors for detecting clinical indicators and disease risks, and genetic factors are involved in the significant regulation of blood lipid levels.

[0003] Multiple important apolipoprotein genes related to cardiovascular diseases and blood lipid metabolism are concentrated in the region of the apolipoprotein APOA1 / C3 / A4 / A5 gene cluster on chromosome 11. In this gene cluster region, there are not only common genetic variations significantly associated with total cholesterol, triglyceride, high-density lipoprotein cholesterol, and low-density lipoprotein cholesterol levels, as well as the genetic susceptibility risk of coronary heart disease, but also pathogenic low-frequency genetic variations directly leading to severe dyslipidemia and the risk of myocardial infarction. Low-frequency and rare variations usually vary greatly among different populations, and there is relatively little understanding of low-frequency and rare variations in this important gene region in the Chinese population. Therefore, a more comprehensive and detailed analysis of genetic variations involved in blood lipid level regulation and cardiovascular disease risk in the population can promote the effective assessment of disease susceptibility risk and the identification of high-risk populations. Summary of the Invention

[0004] The purpose of the present invention is to discover SNP markers involved in blood lipid level regulation and cardiovascular disease risk, and through the detection of blood lipid levels, to promote the effective assessment of the susceptibility risk of blood lipid metabolism-related diseases and the identification of high-risk populations.

[0005] Specifically, in the first aspect of the present invention, a reagent for predicting the relative blood lipid level of a mammalian subject is provided. The reagent is a primer or probe for detecting the SNP marker rs80022746, and rs80022746 is G or A. Among them, the blood lipid level of a subject carrying the G allele (i.e., GG or AG) is lower than that of a carrier of the AA genotype, or the risk of the blood lipid level of the offspring of a subject carrying the G allele (i.e., GG or AG) being lower than that of a carrier of the AA genotype increases.

[0006] In one or more embodiments, rs80022746 is the 183rd nucleotide from the 5'-end of the amplification product obtained by PCR amplification using mammalian genomic DNA as a template and SEQ ID NOs: 2 and 3 as primers, and it is G or A.

[0007] Preferably, rs80022746 is the 183rd nucleotide of SEQ ID NO: 1, and it is G or A.

[0008] In one or more embodiments, the mammal is a human.

[0009] In one or more embodiments, the amplification product of the primer for detecting SNP marker rs80022746 includes at least the 183rd nucleotide of SEQ ID NO: 1. In one or more embodiments, the amplification product of the primer includes at least the nucleotides at positions 178 - 188 of SEQ ID NO: 1 or a variant having 90% sequence identity thereto and with the 183rd nucleotide being A or G. In one or more embodiments, the amplification product of the primer includes SEQ ID NO: 1 or a variant having 90% sequence identity thereto and with the 183rd nucleotide being A or G.

[0010] In one or more embodiments, the primers are selected from:

[0011] (1) The sequences shown in SEQ ID NOs: 2 and 3 or sequences having at least 90% identity thereto; and

[0012] (2) The complementary sequences of (1).

[0013] In one or more embodiments, the probe recognizes at least the 183rd nucleotide of SEQ ID NO: 1.

[0014] In one or more embodiments, the probe has: (1) a sequence that hybridizes to the amplification product obtained by PCR amplification using mammalian genomic DNA as a template and SEQ ID NOs: 2 and 3 as primers, and the hybridization region contains the 183rd nucleotide from the 5'-end of the amplification product, (2) a sequence that hybridizes to SEQ ID NO: 1, and the hybridization region contains the 183rd nucleotide of SEQ ID NO: 1, (3) the complementary sequence of (1) or (2). The 183rd nucleotide is A or G.

[0015] In one or more embodiments, the probe is selected from one or more of the following: (1) a probe that recognizes a fragment of SEQ ID NO:1, said fragment comprising the nucleotide at position 183 of SEQ ID NO:1, said base being T or G, (2) the complementary sequence of (1). In one or more embodiments, the probe recognizes at least the nucleotides at positions 178-188 of SEQ ID NO:1 or a variant having 90% sequence identity thereto and having an A or G at position 183.

[0016] In one or more embodiments, the blood lipid level is selected from one or more of total cholesterol (TC) level, triglyceride (TG) level, and low density lipoprotein cholesterol (LDLC) level.

[0017] The present invention also provides a kit for predicting the relative blood lipid level of a mammal, which contains the reagent and / or medium for predicting the relative blood lipid level of a mammal as described in any one of the embodiments herein. Among them, the blood lipid level of an individual carrying the G allele (i.e., GG or AG) is lower than that of a carrier of the AA genotype, or the risk that the blood lipid level of the offspring of an individual carrying the G allele (i.e., GG or AG) is lower than that of a carrier of the AA genotype increases.

[0018] In one or more embodiments, the kit further comprises one or more substances selected from the following: PCR buffer, polymerase, dNTP, restriction enzyme, digestion buffer, fluorescent dye, fluorescent quencher, fluorescent reporter, exonuclease, alkaline phosphatase, internal standard, and control.

[0019] In one or more embodiments, the blood lipid level is selected from one or more of total cholesterol (TC) level, triglyceride (TG) level, and low density lipoprotein cholesterol (LDLC) level.

[0020] The present invention also provides the use of a reagent for detecting the genomic SNP marker rs80022746 in the preparation of a kit for predicting the relative blood lipid level of a mammalian subject. Among them, the blood lipid level of an individual carrying the G allele (i.e., GG or AG) at rs80022746 is lower than that of a carrier of the AA genotype, or the risk that the blood lipid level of the offspring of an individual carrying the G allele (i.e., GG or AG) is lower than that of a carrier of the AA genotype increases. The reagent is the reagent as described in the first aspect herein.

[0021] In one or more embodiments, the reagent detects the SNP marker rs80022746 in the mammalian genome to predict the relative blood lipid level of the mammal or its offspring. Among them, the blood lipid level of an individual carrying the G allele at rs80022746 is lower than that of carriers of the AA genotype, or the risk of the offspring of an individual carrying the G allele (i.e., GG or AG) having a lower blood lipid level than that of carriers of the AA genotype is increased. The detection is achieved by detecting a sample of the mammal. The sample is derived from the peripheral blood of the mammal.

[0022] In one or more embodiments, the reagent detects the SNP marker rs80022746 in the mammalian fetal genome to evaluate the relative blood lipid level of the fetus. Among them, the blood lipid level of a fetus carrying the G allele at rs80022746 is lower than that of carriers of the AA genotype, or the risk of the offspring of an individual carrying the G allele (i.e., GG or AG) having a lower blood lipid level than that of carriers of the AA genotype is increased. In one or more embodiments, the detection is achieved by detecting a sample of a pregnant mammal. The sample is derived from the peripheral blood, umbilical cord blood, amniotic fluid, etc. of the pregnant mammal.

[0023] In one or more embodiments, rs80022746 is the 183rd nucleotide from the 5'-end of the amplification product obtained by PCR amplification using mammalian genomic DNA as a template and SEQ ID NO: 2 and 3 as primers, and it is G or A. Preferably, rs80022746 is the 183rd nucleotide of SEQ ID NO: 1, and it is G or A.

[0024] In one or more embodiments, the mammal is a human.

[0025] In one or more embodiments, the blood lipid level is selected from one or more of the total cholesterol (TC) level, triglyceride (TG) level, and low density lipoprotein cholesterol (LDLC) level.

[0026] In one or more embodiments, the peripheral blood includes blood or plasma.

[0027] The present invention also provides a medium recording the SNP marker rs80022746, wherein rs80022746 is G or A, and the medium is used for comparison with DNA sequencing data to determine the genotype of the SNP marker rs80022746.

[0028] In one or more embodiments, the medium is a card printed with the sequence, such as a paper, plastic, metal, or glass card.

[0029] In one or more embodiments, the medium is a computer-readable medium storing the SNP and a computer program, which, when executed by a processor, implements the following steps: comparing the sequencing data of a sample with the SNP recorded in the medium to obtain the genotype of SNP marker rs80022746 in the sample.

[0030] The present invention provides a device for predicting the relative blood lipid level of a mammal. The device includes a memory, a processor, and a computer program stored on the memory and executable on the processor. The device is characterized in that when the processor executes the program, the following steps are implemented: (1) obtaining the genotype of rs80022746 in a sample of a mammalian subject; (2) optionally comparing with a reference sample; (3) if the rs80022746 of the mammalian subject contains G (GG or AG), then the blood lipid level of the mammalian subject is lower than that of the AA population or the risk that the blood lipid level of the offspring of the mammalian subject is lower than that of the carriers of the AA genotype increases, or, if the rs80022746 of a mammalian fetal subject contains G, then the blood lipid level of the fetal subject is lower than that of the AA population.

[0031] In one or more embodiments, before step (1), the method further includes: extraction, quality inspection, and / or storage of genomic DNA in the sample.

[0032] In one or more embodiments, the sample is derived from peripheral blood, preferably blood or plasma.

[0033] In one or more embodiments, the sample is derived from the peripheral blood, umbilical cord blood, amniotic fluid, etc. of a pregnant mammal.

[0034] In one or more embodiments, the mammal is a human. Description of the Drawings

[0035] Figure 1 , the original measured values of the blood lipid phenotype are distributed in a logarithmically transformed distribution.

[0036] Figure 2 , differences in plasma total cholesterol, triglyceride, and low-density lipoprotein cholesterol levels among genotypes at the rs80022746 locus.

[0037] Figure 3 , the average value (mmol / l) of the actual test values of each blood lipid level, and the percentage reduction of each blood lipid level relative to the AG and GG genotypes of the AA genotype. Detailed Description of the Embodiments

[0038] Through screening, the inventors found that a specific allele of the SNP marker rs80022746 is associated with blood lipid levels and cardiovascular diseases. Therefore, by detecting rs80022746, the blood lipid levels of an individual and the risk of developing cardiovascular diseases can be detected.

[0039] Specifically, the present invention relates to the SNP marker rs80022746 related to the regulation of blood lipid levels, a kit containing the SNP marker rs80022746, a medium recording the SNP marker, and the use of a reagent or medium for detecting the SNP marker rs80022746 in the preparation of a kit for predicting relative blood lipid levels or predicting relative blood lipid levels.

[0040] SNP and detection reagent

[0041] In this article, SNP (single nucleotide polymorphism) is a type of molecular genetic marker, mainly referring to DNA sequence polymorphisms caused by variations of single nucleotides at the genomic level. The polymorphisms exhibited by SNPs usually only involve variations of single bases, such as transitions, transversions, insertions, and deletions, etc.

[0042] The RS nomenclature is the most commonly used SNP nomenclature at present. The naming method is rs + Arabic numerals, including the front and back sequences, position information, distribution frequency, etc. According to the rs number of a known SNP, relevant information and its position in the genome can be searched in the SNP database of GenBank.

[0043] The SNP marker rs80022746 provided by the present invention is located at position 116605862 on chromosome 11 of the human genome. In one or more embodiments, the rs80022746 locus contains any one of the following genotypes: (1) GG, (2) AG, (3) AA.

[0044] The inventors found that, compared with individuals with the AA genotype of rs80022746, individuals carrying the G allele of rs80022746 had significantly lower blood lipid levels. Specifically, the blood lipid levels include total cholesterol (TC) level, triglyceride (TG) level, and low density lipoprotein cholesterol (LDLC) level. Therefore, patients with any genotype of AG or GG at the rs80022746 locus had lower blood lipid levels than other individuals. For example, the plasma total cholesterol level of subjects carrying the G allele (GG or AG) was lower than that of carriers of the AA genotype (e.g., by about 11% units); the plasma triglyceride level of subjects carrying the G allele (GG or AG) was lower than that of carriers of the AA genotype (e.g., by about 7.6% units); the plasma low density lipoprotein level of subjects carrying the G allele (GG or AG) was lower than that of carriers of the AA genotype (e.g., by about 6% units).

[0045] Therefore, by detecting the above SNPs in an individual sample, the blood lipid level of the individual can be effectively detected, and the risk of suffering from cardiovascular diseases can be prevented.

[0046] In this article, when referring to carriers of the AA genotype, their blood lipid levels can represent the average blood lipid levels of carriers of the AA genotype in the population. The population can be the natural population. The population can include patients in the cardiovascular medicine department of a hospital. The population includes a non-case group without coronary artery stenosis. The population can also include a case group with a history of coronary artery stenosis or coronary heart disease and myocardial infarction. In some embodiments, the population does not have other chronic diseases or disorders other than coronary artery stenosis. In some embodiments, the age of the population is 5 - 75 years old. The coronary artery stenosis is that coronary angiography shows atherosclerotic stenosis of 50% or more in one or more major coronary arteries.

[0047] The present invention provides an isolated nucleic acid molecule, the nucleic acid molecule containing the SNP marker rs80022746, wherein rs80022746 is A or G. In one or more embodiments, rs80022746 is the 183rd nucleotide from the 5' end of the amplification product obtained by PCR amplification using mammalian (such as human) genomic DNA as a template and SEQ ID NOs: 2 and 3 as primers, and it is A or G. Preferably, rs80022746 is the 183rd nucleotide of SEQ ID NO: 1, and it is A or G. Generally, the nucleic acid molecule of the present invention has a length of 20 bp - 1000 bp. Preferably, the nucleotide sequence of the nucleic acid molecule includes at least the 178th - 188th nucleotides of SEQ ID NO: 1 or a variant having 90% sequence identity thereto and the 183rd nucleotide being A or G. In one or more embodiments, the nucleic acid molecule comprises SEQ ID NO: 1 or a variant having 90% sequence identity thereto and the 183rd nucleotide being A or G. In one or more embodiments, the nucleic acid molecule is used as a standard and / or control for detecting the genotype of the SNP site in a sample.

[0048] The term "isolated" refers to a material, such as a nucleic acid molecule and / or a protein, which is substantially free of components that are normally associated with or interact with the material in its natural environment or removed therefrom. Isolated polynucleotides can be purified from their naturally occurring host cells. Conventional nucleic acid purification methods known to those skilled in the art can be used to obtain isolated polynucleotides.

[0049] The term "amplification" product refers to a nucleic acid fragment generated during a primer-directed amplification reaction. General methods of primer-directed amplification include polymerase chain reaction (PCR), ligase chain reaction (LCR), or strand displacement amplification (SDA). If the PCR method is selected, the replication composition may contain components for nucleic acid replication, such as: nucleotide triphosphates, two (or more) primers having appropriate sequences, a thermostable polymerase, a buffer, solutes, and proteins. In one or more embodiments, the amplification product is at least 30 bp, at least 50 bp, at least 100 bp, 200 bp, at least 500 bp, at least 1 kb, at least 2 kb, at least 3 kb, at least 4 kb, at least 5 kb, at least 6 kb, at least 7 kb, at least 8 kb, at least 9 kb, at least 10 kb, or at least 12 kb.

[0050] The terms "nucleic acid", "nucleic acid molecule", "polynucleotide", "polynucleotide sequence", "nucleic acid sequence", and "nucleic acid fragment" are used interchangeably herein and refer to polymers of deoxyribonucleotides (DNA) or ribonucleotides (RNA) in single-stranded or double-stranded form, and their complements. Nucleic acids contain synthetic, non-natural, or altered nucleobases. Nucleotides can be ribonucleotides, deoxyribonucleotides, or modified forms thereof. Examples of polynucleotides contemplated herein include single-stranded and double-stranded DNA, single-stranded and double-stranded RNA, and hybrid molecules having mixtures of single-stranded and double-stranded DNA and RNA. DNA can be a coding strand or a non-coding strand. In one or more embodiments, the sample comprises fragmented genomic DNA. Methods for obtaining and fragmenting genomic DNA are well known in the art. In one or more embodiments, the sample comprises cfDNA. The nucleic acids of the present invention can comprise combinations of bases (including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, and isoguanine). The nucleic acids of the present invention can be synthesized to comprise non-natural amino acid modifications. The nucleic acids of the present invention can be obtained by chemical synthesis methods or by recombinant methods.

[0051] DNA forms include cDNA, genomic DNA, fragmented DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be of any length, such as 50 - 500 bp, 100 - 400 bp, 150 - 300 bp, or 200 - 250 bp.

[0052] The reagents for detecting SNPs are mainly "primers" or "probes". As used herein, a "primer" refers to a nucleic acid molecule with a specific nucleotide sequence that guides synthesis at the initiation of nucleotide polymerization. Primers are typically two synthetic oligonucleotide sequences. One primer is complementary to one DNA template strand at one end of the target region, and the other primer is complementary to the other DNA template strand at the other end of the target region. Its function is to serve as the starting point for nucleotide polymerization. Primers designed in vitro are widely used in polymerase chain reaction (PCR), qPCR, sequencing, probe synthesis, etc. Primers can be of any length, such as 5 - 200 bp, 10 - 100 bp, 20 - 800 bp, or 25 - 50 bp.

[0053] The "complementary", "recognizing", or "hybridizing" guides described herein hybridize to the template sequence under stringent or highly stringent conditions. The stringent conditions for nucleic acid hybridization described herein are known to those skilled in the art. Preferably, the conditions are such that the sequences are at least about 65%, 70%, 75%, 85%, 90%, 95%, 98% or 99% homologous to each other and generally remain hybridized to each other. Non-limiting examples of stringent hybridization conditions are hybridization at 65 °C in a high-salt buffer containing 6x SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 mg / ml denatured salmon sperm DNA, and optionally washing once or twice at 50 °C in 0.2x SSC, 0.01% BSA.

[0054] The primers of the present invention are used for detecting SNPs. Specifically, the primers are used for detecting the SNP marker rs80022746, wherein rs80022746 is A or G. Preferably, rs80022746 is the 183rd nucleotide from the 5'-end of the amplification product obtained by PCR amplification using mammalian genomic DNA as a template and SEQ ID NOs: 2 and 3 as primers, which is A or G. More preferably, rs80022746 is the 183rd nucleotide of SEQ ID NO: 1, which is A or G. The amplification product of the primers comprises at least the 178-188th nucleotides of SEQ ID NO: 1 or a variant having 90% sequence identity thereto and the 183rd nucleotide being A or G.

[0055] The SNPs of the present invention can also be detected using probes. The "probe" described herein is a nucleic acid sequence (DNA or RNA) that recognizes a target sequence (complementary to the target sequence). The probe binds to the target gene through molecular hybridization to generate a hybridization signal, thereby showing the target gene. The probe can include the entire target sequence or a fragment of the target sequence. The probe can be DNA or RNA transcribed therefrom. Generally, the probe is labeled with a detection label, such as a fluorescent label. The fluorescent labels include, but are not limited to, FAM, CY5, and VIC. Those skilled in the art know the fluorescent labels suitable for the probes herein and the methods for linking them to the probes.

[0056] As used herein, the terms "variant" or "mutant" refer to a polynucleotide that has been altered by the insertion, deletion, or substitution of one or more nucleotides as compared to a reference sequence, while retaining its ability to hybridize to other nucleic acids. The mutants described in any embodiment herein include nucleotide sequences having at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to the reference sequence and retaining the biological activity of the reference sequence. Sequence identity between two aligned sequences can be calculated using, for example, BLASTn of NCBI. Mutants also include nucleotide sequences having one or more mutations (insertions, deletions, or substitutions) in the reference sequence and the nucleotide sequence, while still retaining the biological activity of the reference sequence. The plurality of mutations generally refers to within 1-8, such as 1-5 or 1-3. Substitutions can be between purine nucleotides and pyrimidine nucleotides, or between purine nucleotides or between pyrimidine nucleotides. Substitutions are preferably conservative substitutions. For example, in the art, when conservative substitutions are made with nucleotides having similar or comparable properties, the stability and function of the polynucleotide are generally not altered. Conservative substitutions include, for example, the interchange of (A and G) between purine nucleotides, and the interchange of (T or U and C) between pyrimidine nucleotides. Therefore, replacing one or several sites with residues from the same residue in the polynucleotides of the present invention will not substantially affect its activity. When referring to mutants having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97% sequence identity to the primers (such as SEQ ID NO: 2-3) or probes described in the present invention, preferably, these mutants can hybridize to the corresponding DNA sequence containing SEQ ID NO: 1 under stringent conditions.

[0057] The present invention provides a medium recording the SNP marker rs80022746, wherein rs80022746 is G or A. The medium is used for aligning with DNA sequencing data to determine the genotype of the SNP marker rs80022746. Exemplary media record the sequences of the nucleic acid molecules described herein.

[0058] The medium described herein is any medium capable of providing the sequence information of the SNP marker, such as a card printed with the sequence, such as a paper, plastic, metal, or glass card; a computer-readable medium storing the sequence. The computer-readable medium also stores a computer program, which, when executed by a processor, implements the following steps: comparing the sequencing data of a sample with the sequence recorded in the medium to obtain the genotype of the SNP marker rs80022746 in the sample.

[0059] The present invention also provides a kit for predicting the relative blood lipid level of a mammal, which contains the reagent for detecting the SNP marker rs80022746 described herein and / or the medium recording the SNP marker rs80022746. The kit may also contain various reagents required for performing PCR, such as buffers, enzymes, dNTPs, etc. In a preferred embodiment, the kit of the present invention contains the primer sequences shown in SEQ ID NO:2 and 3.

[0060] Methods and uses

[0061] The present invention also provides a method for predicting the relative blood lipid level of a mammal, comprising: (1) obtaining the genotype of rs80022746 in a sample of a mammalian subject; (2) optionally comparing with a reference sample; (3) if the rs80022746 of the mammalian subject contains G (GG or AG), then the blood lipid level of the mammalian subject is lower than that of the AA population or the risk that the blood lipid level of the offspring of the mammalian subject is lower than that of the AA population increases, or, if the rs80022746 of a mammalian fetal subject contains G, then the blood lipid level of the fetal subject is lower than that of the AA population. For example, by detecting the genotype of rs80022746 of the parents, the genotype of the said marker of the offspring can be obtained, and then the relative blood lipid level of the offspring can be inferred. For example, if the parents are respectively rs80022746 GG homozygotes and rs80022746 AG heterozygotes, their offspring will have a 50% chance of carrying the allele genotype G, and the blood lipid level of this offspring will have a 50% chance of being lower than that of the AA population. For example, if the parents are respectively rs80022746 AG heterozygotes and rs80022746 AG heterozygotes, their offspring will have a 75% chance of carrying the allele genotype G, and the blood lipid level of this offspring will have a 75% chance of being lower than that of the AA population.

[0062] In one or more embodiments, before step (1), the method further includes: extraction, quality inspection, and / or storage of genomic DNA in a sample. Herein, the method for extracting DNA from a sample is not particularly limited, and DNA extraction methods well-known in the art are applicable herein. As used herein, the term "sample" refers to any tissue or fluid from an object that is suitable for nucleic acid enrichment. The object can be any living or non-living organism, including but not limited to humans and non-human animals. Any human or non-human animal can be selected, including but not limited to mammals, reptiles, birds, amphibians, fish, ungulates, ruminants, bovids (such as cows), equids (such as horses), caprines (such as sheep, goats), suids (such as pigs), camelids (such as camels, llamas, alpacas), monkeys, apes (such as gorillas, chimpanzees), ursids (such as bears), poultry, dogs, cats, mice, rats, fish, dolphins, whales, and sharks. The object can be male or female (e.g., women, pregnant women). The object can be of any age (such as embryos, fetuses, infants, children, adults).

[0063] Nucleic acids can be isolated from any type of suitable biological specimen or sample. The sample or test sample can be any specimen separated or obtained from an object or a part thereof. Non-limiting examples of specimens include fluids or tissues of the object, including but not limited to blood or blood products, cord blood, chorionic villi, amniotic fluid, cerebrospinal fluid, spinal fluid, lavage fluid, biopsy samples, interstitial fluid samples, cells or parts thereof, female genital tract washes, urine, feces, sputum, saliva, nasal mucosa, prostatic fluid, irrigation fluid, semen, lymph fluid, bile, tears, sweat, breast milk, breast body fluid, etc., or combinations thereof. In some embodiments, the biological sample can be blood, and sometimes plasma or serum. Other suitable biological samples are familiar to those of ordinary skill in the relevant art. Biological samples can be obtained using techniques that are entirely within the ordinary knowledge of a clinical practitioner.

[0064] In some embodiments, the nucleic acid is fragmented or cleaved before, during, or after the method of the present invention. As used herein, "fragmentation" or "cleavage" refers to a method or condition that enables a nucleic acid molecule (such as a nucleic acid template gene molecule or its amplification product) to be divided into two or more smaller nucleic acid molecules. The nucleic acid fragments can contain overlapping nucleotide sequences, and such overlapping sequences can facilitate the construction of the nucleotide sequence of the corresponding unfragmented nucleic acid or its segment. In certain embodiments, the nucleic acid can be partially fragmented (e.g., from an incomplete or aborted specific cleavage reaction) or completely fragmented. Such fragmentation or cleavage can be sequence-specific, base-specific, or non-specific, and can be accomplished by any of a variety of methods, reagents, or conditions (including, for example, chemical, enzymatic, physical fragmentation).

[0065] SNP marker detection methods applicable herein are well-known in the art, including but not limited to: sequencing, polymerase chain reaction single strand conformation polymorphism (PCR-SSCP), real-time fluorescence quantitative PCR and high-resolution melting curve analysis (HRM), fluorescence probe-based quantitative PCR, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), and time-of-flight mass spectrometry. Other reagents required in the SNP marker detection method are known in the art except for primers.

[0066] According to some specific examples of the present invention, a method for predicting relative blood lipid levels by detecting the SNP markers described herein in a test sample further includes: extracting DNA from the sample; performing fluorescence quantitative PCR on the DNA using the primers described herein (such as SEQ ID NO: 2-3) to obtain an amplification product; sequencing the amplification product to obtain the genotype of the SNP markers described herein in the DNA; and predicting the relative blood lipid levels based on the genotype of the SNP markers.

[0067] According to some specific examples of the present invention, a method for predicting relative blood lipid levels by detecting the SNP markers described herein in a test sample further includes: extracting DNA from the sample; using the primers described herein (such as SEQ ID NO: 2-3), identifying the probes for the amplification product, and the primers and probes for the reference gene to perform fluorescence quantitative PCR on the DNA to obtain an amplification product; analyzing the PCR results to obtain the genotype of the SNP markers described herein in the DNA; and predicting the relative blood lipid levels based on the genotype of the SNP markers.

[0068] According to some specific examples of the present invention, a method for predicting relative blood lipid levels by detecting the SNP markers described herein in a test sample further includes: extracting DNA from the sample; constructing a high-throughput sequencing library by multiplex PCR; performing genotyping to detect mutant genes; and performing disease association analysis based on the genotype of the SNP markers to predict the relative blood lipid levels.

[0069] The present invention also provides the use of a reagent or medium for detecting the SNP marker rs80022746 in the preparation of a kit for predicting relative blood lipid levels. In one or more embodiments, the reagent detects the SNP marker rs80022746 in the genome of a mammal, where rs80022746 is G or A, so as to predict the predicted relative blood lipid levels of the mammal. Among them, carriers of the rs80022746 allele containing G have lower blood lipid levels than other individuals. Among them, the other individuals are carriers with the rs80022746 allele being AA. Preferably, the mammal has any one of the AG or GG genotypes of rs80022746, and its blood lipid level is lower than that of individuals with the AA genotype of rs80022746. The detection is achieved by detecting a sample of the mammal. The sample includes peripheral blood, amniotic fluid, and cord blood of the mammal.

[0070] Device

[0071] The present invention provides a device for predicting relative blood lipid levels. The device includes a memory, a processor, and a computer program stored on the memory and executable on the processor. It is characterized in that when the processor executes the program, the following steps are implemented: (1) obtaining the genotype of rs80022746 in a sample of a mammalian subject; (2) optionally comparing with a reference sample; (3) if the rs80022746 of the mammalian subject contains G (GG or AG), then the blood lipid level of the mammalian subject is lower than that of the AA population or the risk that the blood lipid level of the offspring of the mammalian subject is lower than that of the AA population increases, or, if the rs80022746 of a mammalian fetal subject contains G, then the blood lipid level of the fetal subject is lower than that of the AA population or the risk increases. Specifically, before step (1), the method further includes: extraction, quality inspection, and / or storage of genomic DNA in the sample.

[0072] Unless otherwise clearly stated, all percentages and proportions / ratios are by weight.

[0073] Unless otherwise specified, all percentages and proportions are calculated based on the total amount of the composition.

[0074] Each maximum numerical limit given throughout this disclosure includes each lower numerical limit, as if these lower numerical limits were explicitly written herein. Each minimum numerical limit given throughout this disclosure includes each higher numerical limit, as if these higher numerical limits were clearly written here. Each numerical range given throughout this disclosure includes each narrower numerical range falling within the broader numerical range, as if these narrower numerical ranges were explicitly written herein.

[0075] The values described herein should not be construed as being strictly limited to the exact numerical values recited. Instead, unless otherwise specifically stated, each such value is intended to refer to the recited value and the range of functionally equivalent values therearound. For example, a value disclosed as "20 μl" is intended to mean "about 20 μl".

[0076] Unless expressly excluded or otherwise limited, each document cited herein, including any cross-references and related patents or applications, is incorporated herein by reference. The citation of any document is not an admission that it is prior art with respect to any invention disclosed herein or claimed, or that it alone or in any combination with any other reference, teaches, suggests, or discloses any such invention. Further, when any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to the term in this document shall govern.

[0077] The present invention will be described below by way of specific embodiments. It should be understood that these embodiments are merely illustrative and are not intended to limit the scope of the present invention. Various other changes and modifications can be made without departing from the spirit and scope of the present disclosure. The scope of the appended claims includes all such changes and modifications within the scope of the present disclosure. Materials, reagents, and methods not specifically described in the embodiments are conventional materials, reagents, and methods in the art.

[0078] Examples

[0079] Peripheral venous blood samples were collected from patients in the Department of Cardiovascular Medicine of a hospital. On the basis of informed consent, a total of 2518 samples of the Chinese Han population and corresponding blood lipid biochemical test indexes were obtained. Individuals with more than 50% atherosclerotic stenosis in one or more major coronary arteries shown by coronary angiography, or individuals with a history of coronary heart disease and myocardial infarction were classified into the case group. Individuals without coronary artery stenosis were used as normal controls. There were no other serious chronic disease symptoms in the case and control samples. The overall sample was unrelated individuals aged 5 - 75 years with a matched male-female ratio and case-control ratio.

[0080] Example 1

[0081] 1.1 DNA Extraction

[0082] Genomic DNA was extracted from human peripheral blood samples by the conventional phenol-chloroform method (DNA can also be extracted using a commercial kit). After measuring the concentration with a spectrophotometer and adjusting it to 20 ng / μl, it was used for the construction of amplicon sequencing libraries.

[0083] 1.2 Construction of High-throughput Sequencing Libraries by Multiplex PCR

[0084] The method of constructing an amplicon sequencing library for the target gene region by multiplex PCR amplification using the KAPA2G Robust HotStart ReadyMix kit (Sigma-Aldrich) involves two rounds of PCR reactions for library construction:

[0085] In the first round of multiplex PCR amplification, specific primers are used to obtain the target fragments of the sequencing target regions. The specific primers for the rs80022746 locus are as follows:

[0086] SEQ ID NO:2, 5’-CATAGGAACTCCCAACGCACAA-3’

[0087] SEQ ID NO:3, 5’-AAAAAGTTGTTGGCAAAGACAAAACT-3’

[0088] The PCR product sequence is as follows:

[0089] SEQ ID NO:1:

[0090] CATAGGAACTCCCAACGCACAA AATAGTATGATAAATGCTGTCCTCAAAGTGCCATGAAAACTCAGAAAATGGCTGAATTGGTAAGCAGATCCTGTCCTGGGAGCAGTAGCAAGAGTTCAAATTCTCAGTTCCTAAGTATAACTGGGCAGACAGGGCCCTTCTAGCCCCTGCCACAAAGCCC[G / A]GGGGTCTCCTAGCACCTCAGATGAGTGCTTGAATAGT AGTTTTGTCTTTGCCAACAACTTTTT

[0091] The region of the amplicon in the genome: chr11:116,605,680-116,605,92(GRCh37 / hg19)

[0092] At position 183 in the sequence, G→A (rs80022746), where the underlined part is the PCR primer design sequence.

[0093] In the second round of PCR reaction, the corresponding Illumina sequencing adapters and indexes are added to the target fragments. The reaction systems and conditions for the two rounds of PCR are listed below. The PCR reaction conditions follow the recommended conditions of the kit. Beckman Agencourt AMPureXP magnetic beads are used for the purification and recovery of the products after PCR. The amplicon products with dual-indexed ends are sequenced on the Illumina platform at an average depth of 200-fold.

[0094] The reaction system for the first-round target fragment PCR amplification:

[0095] Target fragment specific primer 8ul Genomic DNA template 100 - 200 ng 2× Multiplex PCR reaction kit premix 12.5ul Pure water Make up according to the total reaction system Total reaction system 25ul

[0096] The reaction program for the first-round PCR amplification:

[0097]

[0098] In this experiment, 16 cycles are the reference cycle number, and specific adjustments are made according to the number of amplified fragments designed in the multiplex PCR reaction.

[0099] The reaction system for the second-round PCR amplification of adding index to the target fragment:

[0100] 2× Multiplex PCR reaction kit premix 15ul Purified and recovered product of the first round of PCR reaction 14ul PCR forward primer (50 uM) 0.5ul PCR reverse primer (50 uM) 0.5ul Total reaction system 30ul

[0101] The PCR primers are primers with corresponding indexes selected according to different samples.

[0102] The reaction program for the second-round PCR amplification:

[0103]

[0104] 1.3 Detection of gene mutations

[0105] The original read data obtained by sequencing was aligned to the reference sequence of the human genome hg19 version using the open-source BWA-MEM algorithm. The AmpliconClipper software (https: / / github.com / SoapZA / AmpliconClipper) was used to remove the PCR primer sequences in the amplicon sequencing reads to ensure the accuracy of subsequent genotyping. The HaplotypeCaller algorithm in the Genome Analysis Toolkit was used for genotyping of variant sites and calculation of genotyping quality control data. The genotyping process followed the Best Practices workflow recommended by the toolkit (https: / / gatk.broadinstitute.org / hc / en-us / sections / 360007226651-Best-Practices-Workflows), and the quality control data also followed the recommended parameters (QD < 2.0, FS > 60.0, MQ < 40.0, MQRankSum < -12.5, ReadPosRankSum < -8.0). Allelic polymorphism of G > A at the rs80022746 locus was detected at the position chr11:116605862 on the reference sequence of the human genome hg19 version in the sequencing data analysis.

[0106] Examples of the lipid biochemical detection and sequencing results of the samples are shown in Table 1.

[0107] Table 1 Plasma total cholesterol, triglyceride, and low-density lipoprotein cholesterol levels of some samples and genotype examples

[0108]

[0109] 1.4 Data statistics and association analysis

[0110] According to the genotyping results, three genotypes, GG, GA, and AA, of the rs80022746 locus within the APOA1 / C3 / A4 / A5 gene cluster region were detected in the population samples. Allele A was the minor allele, and the allele frequency was 0.02164, which was consistent with the results of the currently available 1000 Genomes Project data that it was present at low frequency in East Asian populations and absent in other populations of the world.

[0111] The blood lipids of the collected samples were biochemically detected using conventional medical biochemical methods. The indicators were logarithmically transformed to make the data distribution more in line with the normal distribution ( Figure 1 as shown), and linear regression statistical analysis was performed with the three genotypes according to the additive genetic model, and factors such as age, gender, and the incidence of coronary heart disease, hypertension, and type 2 diabetes were included as covariates to correct their statistical effects (the linear regression equation is as follows).

[0112] Y = b0 + b1.ADD + b2.AGE + b3.SEX + b4.BP + b5.CAD + b6.T2D + e

[0113] Where Y is the blood lipid phenotype, ADD is the genotype assignment according to the additive model (the three genotypes GG, GA, and AA are assigned 0, 1, and 2 respectively), and SEX, BP, CAD, and T2D are the binary variable assignments for gender, hypertension, coronary heart disease, and type 2 diabetes status. By adding gender, hypertension, coronary heart disease, and type 2 diabetes status into the regression equation, factors that may affect blood lipid levels were corrected, and the association between the corrected genotype and blood lipid levels could be obtained from the analysis results.

[0114] Including the corrected variable factors can exclude some possible confounding factors, and whether they are statistically significant or not does not affect using different genotypes to indicate blood lipid levels.

[0115] Statistical analysis results showed that the minor allele A at the rs80022746 locus was associated with the reduction of multiple blood lipid levels, including plasma total cholesterol, triglyceride, and low-density lipoprotein cholesterol, with significant statistical significance. The linear regression results for the total cholesterol (TC) level were Beta = -0.11 (95% confidence interval -0.16--0.06), P = 2.02E-5. The results for the triglyceride (TG) level were Beta = -0.076 (95% confidence interval -0.12--0.033), P = 5.5E-4. The results for the low-density lipoprotein cholesterol (LDLC) level were Beta = -0.059 (95% confidence interval -0.11--0.006), P = 0.028 (Table 2 and Figure 2 as shown). It can be seen that the G at the rs80022746 locus is a marker of protective factors for regulating blood lipid levels.

[0116] The plasma total cholesterol level of subjects carrying the G allele (GG or AG) was reduced by about 11% compared to carriers of the AA genotype; the plasma triglyceride level of subjects carrying the G allele (GG or AG) was reduced by about 7.6% compared to carriers of the AA genotype; the plasma low-density lipoprotein level of subjects carrying the G allele (GG or AG) was reduced by about 6% compared to carriers of the AA genotype.

[0117] Figure 2 and Figure 3 respectively show the distribution of each blood lipid level for each specific genotype in the population, the average value (mmol / l) of the actual test values of each blood lipid level, and the percentage reduction of each blood lipid level for the AG and GG genotypes relative to the AA genotype. It can be seen that the plasma total cholesterol, triglyceride, and low-density lipoprotein cholesterol levels of carriers of the heterozygous genotype and homozygous genotype of the G allele were significantly lower than those of carriers of the AA genotype.

[0118] The above results indicate that the plasma total cholesterol, triglyceride, and low-density lipoprotein cholesterol levels of carriers of the minor allele A at the rs80022746 locus were all lower than those of other individuals.

[0119] Table 2 Linear regression statistical results of plasma total cholesterol, triglyceride, and low-density lipoprotein cholesterol levels and the rs80022746 locus

[0120]

Claims

1. A reagent for predicting the relative blood lipid level of a mammal, the reagent being a primer or probe for detecting the SNP marker rs80022746, where rs80022746 is G or A, wherein, The blood lipid level of an individual carrying the G allele is lower than that of carriers of the AA genotype, or the risk that the blood lipid level of the offspring of an individual carrying the G allele is lower than that of carriers of the AA genotype increases.

2. The reagent according to claim 1, wherein rs80022746 is the 183rd nucleotide from the 5'-end of the amplification product obtained by PCR amplification using mammalian genomic DNA as a template and primers SEQ ID NO:2 and 3, and it is G or A. Preferably, the primers are selected from: (1) the sequences shown in SEQ ID NO:2 and 3 or sequences having at least 90% identity thereto; or (2) the complementary sequences of (1). Preferably, the probe recognizes the 183rd nucleotide of SEQ ID NO:

1. Preferably, the mammal is a human. Preferably, rs80022746 is the 183rd nucleotide of SEQ ID NO:1, and it is G or A.

3. A kit for predicting the relative blood lipid level of a mammal, which contains the reagent according to claim 1 or 2. Preferably, the blood lipid level is selected from one or more of total cholesterol level, triglyceride level, and low-density lipoprotein cholesterol level.

4. The kit according to claim 3, characterized in that, The kit further comprises one or more substances selected from the following: PCR buffer, polymerase, dNTP, restriction endonuclease, digestion buffer, fluorescent dye, fluorescence quencher, fluorescence reporter, exonuclease, alkaline phosphatase, internal standard, and control.

5. Use of a reagent for detecting the genomic SNP marker rs80022746 in the preparation of a kit for predicting the relative blood lipid level of a mammal, wherein the blood lipid level of an individual carrying the G allele at rs80022746 is lower than that of carriers of the AA genotype, or the risk that the blood lipid level of the offspring of an individual carrying the G allele is lower than that of carriers of the AA genotype increases.

6. The use according to claim 5, wherein The reagent is as described in claim 1 or 2.

7. The use according to claim 6, characterized in that, rs80022746 is the 183rd nucleotide from the 5'-end of the amplification product obtained by PCR amplification using mammalian genomic DNA as a template and SEQ ID NO:2 and 3 as primers, and it is G or A. Preferably, rs80022746 is the 183rd nucleotide of SEQ ID NO:1, and it is G or A.

8. The use according to claim 7, characterized in that, The blood lipid level is selected from one or more of total cholesterol level, triglyceride level, and low-density lipoprotein cholesterol level.

9. A medium recording the SNP marker rs80022746, wherein, rs80022746 is G or A, and the medium is used for aligning with DNA sequencing data to determine the genotype of the SNP marker rs80022746. Preferably, the medium is a card printed with the sequence, including paper, plastic, metal, and glass cards. Preferably, the medium is a computer-readable medium storing the SNP and a computer program, and when the computer program is executed by a processor, the following steps are implemented: comparing the sequencing data of a sample with the SNP recorded in the medium, so as to obtain the genotype of the SNP marker rs80022746 in the sample.

10. A device for predicting the relative blood lipid level of a mammal, the device comprising a memory, a processor, and a computer program stored on the memory and executable on the processor, characterized in that, When the processor executes the program, the following steps are implemented: (1) obtaining the genotype of rs80022746 in a sample of a mammalian object; (2) optionally comparing with a reference sample; (3) if the rs80022746 of the mammalian object contains G, then the blood lipid level of the mammalian object is lower than that of the AA population or the risk that the blood lipid level of the offspring of the mammalian object is lower than that of the carriers of the AA genotype increases, Preferably, before step (1), the method further includes: extraction, quality inspection and / or storage of genomic DNA in the sample, Preferably, the sample includes peripheral blood, amniotic fluid or cord blood of a mammal, Preferably, the mammal is a human.

Images