Reagent for detecting lung squamous cell carcinoma, kit and application

Abstract

The invention belongs to the field of biological medicine, and particularly relates to a reagent and a kit for detecting lung squamous cell carcinoma and application. According to the kit for detecting lung squamous cell carcinoma, lung squamous cell carcinoma subjects and healthy subjects can be effectively distinguished by detecting the methylation level of the target region of the DLX2-AS1 gene in a sample, a biomarker capable of being used for lung squamous cell carcinoma detection is provided, and the sensitivity and specificity of lung squamous cell carcinoma detection are improved while non-invasive detection is achieved.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and more specifically, relates to a reagent, a kit and an application for detecting lung squamous cell carcinoma. Background Art

[0002] Lung cancer is one of the tumors with the highest incidence and mortality in China and globally. According to WHO statistics, in 2020, lung cancer accounted for 11.4% of all newly diagnosed tumor cases and 18% of all tumor death cases. False positives are a common hazard in lung cancer screening. Researchers in the United States randomly screened more than 53,000 high-risk lung cancer patients with LDCT and chest X-rays. Among them, the false positive rate in LDCT screening was as high as 96.4%, and most positive results disappeared during imaging reexamination.

[0003] Lung cancer has the characteristics of "two highs and one low", namely high incidence, high mortality and low five-year survival rate. Therefore, early screening and early diagnosis of lung cancer have become the key to prolonging the survival period of patients and saving their lives.

[0004] Lung squamous cell carcinoma, also known as squamous cell carcinoma of the lung, is a type of non-small cell lung cancer, accounting for 25% - 30% of the total number of lung cancers and being the second most common type of lung cancer. Screening for new biomarkers for non-invasive diagnosis of lung squamous cell carcinoma and accurately identifying lung squamous cell carcinoma are extremely crucial for the early screening, early diagnosis and early treatment of lung cancer. Summary of the Invention

[0005] Aiming at the defects of the existing technology, the purpose of the present invention is to provide a reagent, a kit and an application for detecting lung squamous cell carcinoma, so as to improve the technical problems such as poor detection sensitivity and specificity and low detection accuracy of the existing technology for detecting lung squamous cell carcinoma.

[0006] To achieve the above purpose, the present invention provides a reagent for detecting lung squamous cell carcinoma, which is a reagent for detecting the methylation level of a lung squamous cell carcinoma biomarker in a sample, and the lung squamous cell carcinoma biomarker is selected from the target region on the CpG island of the DLX2-AS1 gene.

[0007] Preferably, with GRCh38.p14 as the reference genome, the target region on the CpG island of the above DLX2-AS1 gene is selected from the full length or a partial region of the negative strand of Chr2:172107863 - 172108263.

[0008] Preferably, the above reagent includes a methylation primer pair for detecting the methylation level of the full length or a partial region of the negative strand of Chr2:172107863 - 172108263.

[0009] Preferably, the above reagent further comprises a non-methylated primer pair for detecting the methylation level of the full length or a partial region of the negative strand of Chr2: 172107863-172108263.

[0010] Preferably, the above reagent comprises the first methylated primer pair shown in SEQ ID NO.4-5 and the first non-methylated primer pair shown in SEQ ID NO.6-7; and / or, the second methylated primer pair shown in SEQ ID NO.8-9 and the second non-methylated primer pair shown in SEQ ID NO.10-11.

[0011] Preferably, the above reagent further comprises a probe;

[0012] The above reagent comprises the first methylated primer pair shown in SEQ ID NO.4-5 and the first probe shown in SEQ ID NO.14; and / or, the second methylated primer pair shown in SEQ ID NO.8-9 and the second probe shown in SEQ ID NO.15.

[0013] Preferably, the 5' end of the above first probe and the above second probe comprises a fluorescent reporter group, and the 3' end of the above first probe and the above second probe comprises a fluorescent quenching group.

[0014] The present invention also provides a kit for detecting lung squamous cell carcinoma, which comprises the above reagent.

[0015] Preferably, the above kit further comprises one or more of a detection primer pair and a probe for an internal reference gene, a nucleic acid extraction reagent, a nucleic acid purification reagent, a methylation conversion reagent, an amplification reagent, a positive control product, and a negative control product.

[0016] The present invention also provides the application of the above reagent or the above kit in the preparation of a lung squamous cell carcinoma diagnostic product.

[0017] Generally speaking, compared with the prior art by the above technical solution conceived by the present invention, the following beneficial effects are obtained:

[0018] The reagent and kit for detecting squamous cell lung cancer provided by the present invention can effectively distinguish subjects with squamous cell lung cancer from healthy subjects by detecting the methylation level of the target region of the DLX2-AS1 gene in a sample, providing a biomarker that can be used for the detection of squamous cell lung cancer. While achieving non-invasive detection, the sensitivity and specificity of squamous cell lung cancer detection are improved. The sensitivity of the above-mentioned kit for detecting plasma samples of squamous cell lung cancer can reach 86.4%, the sensitivity for detecting early squamous cell lung cancer (including stage I squamous cell lung cancer and stage II squamous cell lung cancer) can reach 81.0%, and the sensitivity for detecting advanced squamous cell lung cancer (including stage III squamous cell lung cancer and stage IV squamous cell lung cancer) can reach 89.5%. It is suitable for the early screening and diagnosis of squamous cell lung cancer. The specificity of the above-mentioned kit for detecting plasma samples of healthy subjects can reach 92.1%, and the detection accuracy is high. Detailed implementation manners

[0019] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the description of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0021] The term "and / or" includes any and all combinations of one or more of the related listed items.

[0022] The term "diagnosis" refers to determining the health status of a subject, covering aspects such as detecting the presence or absence of a disease, response to treatment means, recurrence risk assessment, canceration risk and canceration degree assessment, and prognosis judgment. In some cases, the term "diagnosis" refers to a single factor used to determine, verify or confirm the clinical status of a patient. In some embodiments, "detecting" squamous cell lung cancer refers to detecting the presence or absence of the disease, that is, determining whether the subject has squamous cell lung cancer.

[0023] The term "subject" refers to an object that is observed, detected or experimented on. In some embodiments, the subject can be a mammal. Mammals include but are not limited to primates (including humans and non-human primates) and rodents (e.g., mice and rats). In some embodiments, the mammal can be a human.

[0024] The term "biomarker" or "marker" refers to biochemical indicators that can mark changes or potential changes in the structure or function of systems, organs, tissues, cells, and subcellular structures, such as proteins, DNA, or RNA, etc., and have very wide applications. Biomarkers can be used for disease diagnosis, determining the disease stage, or evaluating the safety and effectiveness of new drugs or new therapies in the target population. Screening biomarkers that can be used for disease screening and early diagnosis can greatly improve the clinical treatment effect of patients.

[0025] The term "methylation" is a form of DNA chemical modification that can change genetic expression without changing the DNA sequence. DNA methylation refers to the covalent binding of a methyl group to the 5th carbon position of cytosine in genomic CpG dinucleotides under the action of DNA methyltransferase. DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way of DNA-protein interaction, thereby controlling gene expression.

[0026] The term "methylation level" refers to whether cytosine in one or more CpG dinucleotides in a DNA sequence is methylated, or the frequency / ratio / percentage of methylation, which represents both qualitative and quantitative concepts. In practical applications, different detection indicators can be used to compare DNA methylation levels according to the actual situation. For example, in some cases, comparison can be made based on the Ct value of sample detection; in some cases, the proportion of gene methylation in the sample can be calculated, that is, the number of methylated molecules / (the number of methylated molecules + the number of unmethylated molecules) × 100%, and then comparison can be made; in some cases, statistical analysis and integration of each indicator are also required to obtain the final determination indicator.

[0027] The term "primer" refers to an oligonucleotide that can be used in an amplification method (such as polymerase chain reaction PCR) to amplify a target sequence based on a polynucleotide sequence corresponding to a target gene or a part of its region. Usually, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence-specific for that polynucleotide sequence. The exact length of the primer depends on many factors, including temperature, primer source, and the method used, etc. For example, for diagnostic and prognostic applications, depending on the complexity of the target sequence, oligonucleotide primers usually contain at least 10, 15, 20, 25 or more nucleotides, but can also contain fewer nucleotides. In the disclosure of the present invention, the term "primer" refers to a pair of primers that can hybridize with the double strand of a target DNA molecule or can hybridize with regions flanking the nucleotide sequence to be amplified in the target DNA molecule. "Primer pair" refers to a group composed of an upstream primer and a downstream primer.

[0028] The term "Bisulfite Sequencing PCR (BSP)" refers to a method where genomic DNA is treated with bisulfite. Unmethylated cytosines are deaminated and converted into uracils, which are then converted into thymines during subsequent PCR reactions. Methylated cytosines, however, cannot be deaminated and are retained at the end of the reaction. Primers are then designed in the unmethylated regions for PCR amplification. The amplified PCR products are cloned and sequenced, and the obtained sequences are compared with the original sequences to count the methylation sites and their numbers, and to analyze the methylation degree.

[0029] The term "methylation-specific PCR" is one of the most sensitive experimental techniques for studying methylation currently, capable of detecting methylation in as little as approximately 50 pg of DNA. After single-stranded DNA is converted by bisulfite, all unmethylated cytosines are deaminated and converted into uracils, while methylated cytosines in CpG sites remain unchanged. Therefore, two pairs of primers targeting methylated and unmethylated sequences are designed respectively, and methylation and unmethylated DNA sequences can be distinguished through PCR amplification.

[0030] The term "quantitative methylation-specific PCR (qMSP)" is an experimental technique that combines fluorescence quantitative PCR technology and methylation-specific PCR technology. This technique also designs appropriate primer pairs based on the sequence differences of DNA with different methylation states after bisulfite conversion to distinguish methylated and unmethylated sequences. However, the final detection index of qMSP is the fluorescence signal. Therefore, in the qMSP reaction system, in addition to adding methylation detection primers, a fluorescence probe or a fluorescent dye also needs to be added. Compared with the traditional methylation-specific PCR technology, qMSP has higher sensitivity and specificity in detecting DNA methylation levels, is more suitable for detecting trace abnormally methylated DNA fragments mixed in the DNA of early-stage cancer patients, and this technology does not require gel electrophoresis detection, making the operation more convenient. In the disclosed content of this application, when performing real-time quantitative methylation-specific PCR, methylation primer pairs are added. If the Ct value meets the requirements (for example, Ct ≤ 45 in plasma samples), it indicates that the target sequence is methylated.

[0031] The term "TaqMan probe" refers to an oligonucleotide sequence containing a 5'-fluorescent group and a 3'-quenching group. When the probe binds to the corresponding site on the DNA, since the quenching group is near the fluorescent group, the probe does not emit fluorescence. During the amplification process, if the probe binds to the amplified strand, the 5'-3' exonuclease activity of DNA polymerase (such as Taq enzyme) will digest the probe, and the fluorescent group will be far from the quenching group, and its energy will not be absorbed, that is, a fluorescent signal is generated. With each PCR cycle, the fluorescent signal, like the target fragment, has a synchronous exponential growth process.

[0032] The term "lung squamous cell carcinoma" includes lung squamous cell carcinomas at different pathological stages. According to the TNM staging system, lung squamous cell carcinoma mainly includes four pathological stages: stage I, stage II, stage III, and stage IV lung squamous cell carcinoma. In the specific embodiments of the present invention, early-stage lung squamous cell carcinoma includes at least one of stage I lung squamous cell carcinoma and stage II lung squamous cell carcinoma, and advanced-stage lung squamous cell carcinoma includes at least one of stage III lung squamous cell carcinoma and stage IV lung squamous cell carcinoma.

[0033] The present invention provides a reagent for detecting lung squamous cell carcinoma, which is a reagent for detecting the methylation level of a lung squamous cell carcinoma biomarker in a sample, and the above-mentioned lung squamous cell carcinoma biomarker is selected from the target region on the CpG island of the DLX2-AS1 gene.

[0034] In some embodiments, with GRCh38.p14 as the reference genome, the target region on the CpG island of the DLX2-AS1 gene is selected from the full-length or partial region of the negative strand of Chr2:172107863-172108263.

[0035] It can be understood that when detecting the methylation level of the negative strand of Chr2:172107863-172108263, it can be detected for its full-length region or for its partial region.

[0036] In some embodiments, the partial region of the negative strand of Chr2:172107863-172108263 includes at least one of the negative strand of Chr2:172107982-172108063 and the negative strand of Chr2:172108079-172108242.

[0037] In some embodiments, the above-mentioned reagent includes a methylation primer pair for detecting the methylation level of the full-length or partial region of the negative strand of Chr2:172107863-172108263.

[0038] In a preferred embodiment, the above-mentioned methylation primer pair includes the first methylation primer pair shown in SEQ ID NO.4-5; and / or, the second methylation primer pair shown in SEQ ID NO.8-9.

[0039] In some embodiments, the above-mentioned reagent further includes a non-methylation primer pair for detecting the methylation level of the full-length or partial region of the negative strand of Chr2:172107863-172108263.

[0040] In a preferred embodiment, the above-mentioned non-methylation primer pair includes the first non-methylation primer pair shown in SEQ ID NO.6-7; and / or, the second non-methylation primer pair shown in SEQ ID NO.10-11.

[0041] In a preferred embodiment, the above-mentioned reagent includes a first methylation primer pair shown in SEQ ID NOs. 4-5 and a first unmethylated primer pair shown in SEQ ID NOs. 6-7; and / or, a second methylation primer pair shown in SEQ ID NOs. 8-9 and a second unmethylated primer pair shown in SEQ ID NOs. 10-11.

[0042] It should be noted that if a primer pair has at least 85% (such as 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, etc.) or more sequence identity with the nucleotide sequence shown in the above-mentioned primer pairs (the first methylation primer pair, the first unmethylated primer pair, the second methylation primer pair, the second unmethylated primer pair), and this primer pair also has a certain function for diagnosing lung squamous cell carcinoma (compared with the primer pairs of the present application, the specificity or sensitivity is equivalent, slightly decreased, slightly increased or greatly increased, etc.), it is also within the protection scope of the present invention.

[0043] In some embodiments, the above-mentioned reagent further includes a probe. The above-mentioned probe includes a first probe shown in SEQ ID NO. 14; and / or, a second probe shown in SEQ ID NO. 15.

[0044] In a preferred embodiment, the above-mentioned reagent includes a first methylation primer pair shown in SEQ ID NOs. 4-5 and a first probe shown in SEQ ID NO. 14; and / or, a second methylation primer pair shown in SEQ ID NOs. 8-9 and a second probe shown in SEQ ID NO. 15.

[0045] The present invention also provides a kit for detecting lung squamous cell carcinoma, which includes the above-mentioned reagent.

[0046] In some embodiments, the above-mentioned kit further includes one or more of a detection primer pair and a probe for an internal reference gene, a nucleic acid extraction reagent, a nucleic acid purification reagent, a methylation conversion reagent, an amplification reagent, a positive control product and a negative control product.

[0047] In some embodiments, the above-mentioned internal reference gene can be but is not limited to ACTB. In an optional specific example, the nucleotide sequence of the detection primer pair for the above-mentioned internal reference gene ACTB is as shown in SEQ ID NOs. 12-13, and the nucleotide sequence of the probe for the above-mentioned internal reference gene ACTB is as shown in SEQ ID NO. 16. It can be understood that in other embodiments, other internal reference genes can also be selected. At this time, the detection primer pair and probe for the internal reference gene can be designed correspondingly.

[0048] In a preferred embodiment, the 5' ends of the above-mentioned first probe, the second probe, and the probe of the internal reference gene ACTB all contain a fluorescent reporter group, and the 3' ends of the above-mentioned first probe, the second probe, and the probe of the internal reference gene ACTB all contain a fluorescent quenching group. The fluorescent reporter groups of the above-mentioned probes are independently selected from any one of FAM, VIC, HEX, NED, ROX, TET, JOE, CY3, and CY5; the fluorescent quenching groups of the above-mentioned probes are independently selected from any one of TAMRA, MGB, BHQ, BHQ1, BHQ2, and BHQ3. The examples of the fluorescent reporter groups and fluorescent quenching groups of each probe independently include but are not limited to those listed above.

[0049] In some embodiments, the above-mentioned methylation conversion reagent is used to deaminate cytosine that is not methylated in DNA to uracil, while the methylated cytosine remains unchanged. The present invention places no particular limitation on the methylation conversion reagent, and any reagent reported in the prior art that can achieve the conversion of cytosine to uracil can be used, such as hydrazine salts, bisulfates (such as sodium bisulfate, potassium bisulfate, ammonium bisulfate), and bisulfites (such as sodium metabisulfite, potassium bisulfite, calcium bisulfite, cesium bisulfite, ammonium bisulfite, etc.), one or more of which.

[0050] In some embodiments, the above-mentioned amplification reagent includes but is not limited to amplification buffer, dNTPs, DNA polymerase, and Mg 2+ and one or more of them. In some embodiments, the above-mentioned positive control refers to one that contains a methylated lung squamous cell carcinoma marker and is used to monitor the detection performance of the reagents in the kit; the above-mentioned negative control refers to one that does not contain a methylated lung squamous cell carcinoma marker and is used to monitor whether the experiment is contaminated.

[0051] In some embodiments, the detection samples of the above-mentioned kit include but are not limited to compositions isolated from the organs, tissues, cells, and / or body fluids of a subject. In some embodiments, the above-mentioned sample can be a tissue or body fluid sample. Further, the above-mentioned tissue includes lung tissue; the above-mentioned body fluid includes blood, plasma, serum, extracellular fluid, tissue fluid, lymph fluid, etc., and also includes sputum, urine, saliva, feces, etc. Further still, in a specific embodiment of the present invention, the sample to be tested is a plasma sample.

[0052] The method for detecting the methylation level of the lung squamous cell carcinoma biomarker in the sample by the above-mentioned kit of the present application is not particularly limited, and the methods used may include but are not limited to methylation-sensitive arbitrarily primed polymerase chain reaction (MSAP-PCR), methylation-sensitive single nucleotide primer extension (Ms-SNuPE), methylation-specific PCR (qMSP), methylation-sensitive DNA restriction enzyme analysis, restriction enzyme-based sequencing, restriction enzyme-based microarray analysis, combined bisulfite restriction analysis (COBRA), methylation CpG island amplification (MCA), methylation CpG island amplification and microarray (MCAM), HpaII tiny fragment enrichment by ligation-mediated PCR (HELP), bisulfite sequencing (BSP), bisulfite microarray analysis, methylation-specific pyrosequencing, HELP sequencing (HELP-seq), TET-assisted pyridine borane sequencing (TAPS), Gal hydrolysis and ligation adaptor-dependent PCR (GLAD-PCR), methylated DNA immunoprecipitation sequencing (MeDIP-Seq) or methylated DNA immunoprecipitation-microarray analysis (MeDIP-chip), Southern blotting using methylation-sensitive restriction enzymes, and microarray analysis based on methylation-specific giant magnetoresistive sensors.

[0053] Based on the content disclosed in the present invention, those skilled in the art can use any technique well-known in the art to detect the methylation level of the above-mentioned lung squamous cell carcinoma biomarker and diagnose lung squamous cell carcinoma. No matter which technique is used, it falls within the protection scope of the present invention.

[0054] The present invention also provides a method for detecting lung squamous cell carcinoma by detecting the methylation level of the target region of the NRN1 gene in a sample. In some embodiments, the present invention uses the following method for detection, and the method includes the following steps: extracting the DNA of the tissue sample of the subject, transforming it with a nucleic acid conversion reagent, then purifying the transformed DNA, and performing PCR amplification and Sanger sequencing using the kit of the present invention, and then determining whether the tissue sample to be tested is negative or positive for lung squamous cell carcinoma.

[0055] In other embodiments, the present invention uses the following method for detection, and the method includes the following steps: extracting the DNA of the blood sample of the subject, transforming it with a nucleic acid conversion reagent, then purifying the transformed DNA, and performing qPCR amplification using the kit of the present invention, detecting the methylation level of the target region of the NRN1 gene by the qMSP method, and then determining whether the blood sample to be tested is negative or positive for lung squamous cell carcinoma.

[0056] The present invention also provides the use of the above-mentioned reagent or the above-mentioned kit in the preparation of a lung squamous cell carcinoma diagnostic product.

[0057] In some embodiments, the above-mentioned lung squamous cell carcinoma diagnostic products include one or more of reagents, reagent kits, chips, and sequencing libraries. Optionally, the above-mentioned reagents may be in the form of freeze-dried powder, solution, suspension, emulsion, etc. It should be noted that the lung squamous cell carcinoma diagnostic products provided by the present invention are not limited to the above-listed reagents for detecting lung squamous cell carcinoma, and any products that can meet the needs of diagnosing or assisting in the diagnosis of lung squamous cell carcinoma are within the protection scope of the present invention.

[0058] The present invention also provides the use of the above-mentioned reagent kit in monitoring whether a subject has lung squamous cell carcinoma or monitoring whether a lung squamous cell carcinoma patient has a recurrence of lung squamous cell carcinoma. In some embodiments, the above-mentioned subject can be monitored over a period of time by the following method: collecting blood samples repeatedly at regular intervals and analyzing the above-mentioned blood samples to determine whether the above-mentioned lung squamous cell carcinoma subject is progressing. Any stage of lung squamous cell carcinoma can be monitored, including early-stage lung squamous cell carcinoma, advanced-stage lung squamous cell carcinoma, or recurrence of lung squamous cell carcinoma.

[0059] The above technical solutions will be described in detail below in conjunction with specific embodiments.

[0060] In the embodiments of the present invention, unless otherwise specified, the reagents used are all commercially available products.

[0061] The following are the embodiments:

[0062] Example 1 Collection and processing of lung squamous cell carcinoma samples

[0063] Collection of paraffin tissues: A total of 58 cases of cancer tissue samples and 58 cases of adjacent tissue samples clinically diagnosed with lung squamous cell carcinoma were collected as training set samples.

[0064] Collection of blood samples: 1) A total of 30 cases of lung squamous cell carcinoma subjects and 30 cases of healthy subjects' blood samples were collected and used as test set samples. 2) A total of 59 cases of lung squamous cell carcinoma subjects and 177 cases of healthy subjects' blood samples were collected and used as validation set samples after being coded and blinded. This study was reviewed and met the development criteria by the Ethics Committee of our hospital, and all patients signed informed consent documents.

[0065] The extraction, transformation, and purification processes of the above samples are as follows:

[0066] 1) Extract DNA samples

[0067] When the DNA samples are lung tissue samples and blood leukocyte samples, the genomic DNA of each sample is extracted using the Blood / Cells / Tissues Genomic DNA Extraction Kit (Catalog No.: DP304) of Tiangen Biochemical Technology (Beijing) Co., Ltd., and the specific operation refers to the kit instructions.

[0068] When the DNA sample is a blood sample, centrifuge the collected blood sample to separate the plasma layer and blood cells for standby. For the plasma layer, use the magnetic bead method serum / plasma free DNA extraction kit (Catalog No.: DP709) of Tiangen Biochemical Technology (Beijing) Co., Ltd. to extract plasma cfDNA. The volume of plasma used is 1.5 mL. For the specific operation, refer to the kit instruction manual. After extraction, elute with 50 μL of purified water. For blood leukocytes, use the blood / cell / tissue genomic DNA extraction kit (Catalog No.: DP304) of Tiangen Biochemical Technology (Beijing) Co., Ltd. to extract the cellular genomic DNA of each sample. For the specific operation, refer to the kit instruction manual.

[0069] 2) Bisulfite conversion and purification treatment

[0070] Bisulfite convert the genomic DNA of each extracted sample respectively. The nucleic acid conversion kit used is the nucleic acid purification reagent of Wuhan Aimisen Life Science and Technology Co., Ltd. (Hubei Medical Equipment Preparation 20200843). For the specific experimental operation, refer to the kit instruction manual. After conversion, elute with 30 μL of purified water and store at -20 °C for standby.

[0071] Example 2 Determination of differentially methylated regions in lung squamous cell carcinoma

[0072] Using GRCh38.p14 as the reference genome, the present invention provides an isolated polynucleotide, which is SEQ ID NO.1, a base fragment located at positions 172107863 - 172108263 on the negative strand of chromosome 2 of the DLX2-AS1 gene. There are multiple methylation sites in the nucleotide sequence, which occur at the C-5 position of cytosine, and the product is called 5-methylcytosine (5-mC). Screen out differentially methylated regions that can distinguish lung squamous cell carcinoma according to the polynucleotide SEQ ID NO.1, select multiple methylated regions to form a marker combination, and design primers for a multiplex fluorescence PCR system. Initially screen out target regions with specificity and sensitivity both greater than or equal to 85% on tissue samples.

[0073] The physical location of SEQ ID NO.1 is on the minus strand of Chr2:172107863-172108263, and the DNA sequence is: 5’-CCTCCTCTCCCAGGGGAACCCCCCTTCCAGGACTCTCTTTGGGGA GAGAGGGGCGCGGTCGCCCTCAGGACGGCCAATGCCCCTTCCAATCTGTTCCGCGGAGCTGGCAGCACCAGGCCCGGGAGAAGTAAGTGTGGTGCCGCCTTCTCTCGCGTCCCCTGGCCGGAAACAGCCCAGAGCGACAGCGGCCTTGCCTCCATGGCCCAGATCTGAGTTCGAGGTCGGACTCTGCTGCGCGTCGGTAACCATGTGATTGGCTCTAGGCCTTGGTTTCCTCAATGTGGGTGATATTGTACCCACCCTACAGGGCGATTCCCAGGAGTCAGTGAGATGTCTGAGGTAAAGGGCTTGGCAGAACGCTGGGCGCTCAGTAAATACACGCGGGCAATCGTTCTCTGCAC-3’。

[0074] The sequences of SEQ ID NO.1 after bisulfite treatment are SEQ ID NO.2 (methylated sequence) and SEQ ID NO.3 (unmethylated sequence), respectively. Specific methylation primer pairs and non-methylation primer pairs were designed, and the primers were artificially synthesized and diluted to appropriate working concentrations for standby. The specific sequences after conversion and the primer sequences are shown in Table 1 and Table 2.

[0075] Table 1 DNA sequence information of the target region

[0076]

[0077] Table 2 Nucleotide sequences of methylation primer pairs and non-methylation primer pairs

[0078]

[0079] Using the DNA of the tissue sample after bisulfite conversion as a template, SYBR Green PCR Mix, methylation primer pairs and non-methylation primer pairs for the target region of DLX2-AS1, and upstream and downstream primers of the internal reference gene ACTB were added for PCR amplification. The upstream primer sequence of the internal reference gene ACTB is SEQ ID NO.12: AAGGTGGTTGGGTGGTTGTTTTG, and the downstream primer sequence is SEQ ID NO.13: AATAACA CCCCCACCCTGC. The PCR reaction system is shown in Table 3, and the PCR reaction conditions are shown in Table 4. The PCR amplification products were sent to a sequencing company for Sanger sequencing, and the sequencing peak map was analyzed. The methylation status of a single CpG site within the target region of DLX2-AS1 measured by Sanger was used as the standard.

[0080] Table 3 SYBR Green PCR reaction system

[0081] Component Dosage (μL) SYBR Green PCR Mix 17.5 Methylated primer pair upstream primer (10 μM) 0.5 Methylated primer pair downstream primer (10 μM) 0.5 Unmethylated primer pair upstream primer (10 μM) 0.5 Unmethylated primer pair downstream primer (10 μM) 0.5 ACTB upstream primer (10 μM) 0.5 ACTB downstream primer (10 μM) 0.5 Template DNA 2 Ultra-pure water Make up to 25

[0082] Table 4 SYBR Green PCR reaction procedure

[0083]

[0084] Result analysis: Samples with failed sequencing were excluded, and samples with successful sequencing were retained for result analysis. According to the methylation status of CpG sites in the sequencing peak maps of different amplicons, the methylation values of all CpG sites were calculated. If the sequencing result of cytosine in the CpG dinucleotide is thymine, it is unmethylated; if the sequencing result of cytosine in the CpG dinucleotide is cytosine, it is fully methylated; if the sequencing result of cytosine in the CpG dinucleotide has both cytosine and thymine (double peaks), it is partially methylated. In this example, if more than 95% of the cytosines in the CpG dinucleotides of a polynucleotide are methylated, this region in this sample is considered methylated.

[0085] After the PCR reaction, the results of sequencing the amplification products were compared with the pathological results, and the methylation status of the CpG sites of the amplification products was calculated to calculate the sensitivity and specificity of this target region. Sensitivity (positive coincidence rate) = the proportion of samples with positive pathological results that were detected as methylated positive; Specificity (negative coincidence rate) = the proportion of samples with negative pathological results that were detected as methylated negative. The methylation levels of the detected target regions are shown in Table 5 and Table 6. Target regions with a sensitivity ≥ 85% and a specificity ≥ 85% were selected for the next verification.

[0086] Table 5 Detection sensitivity and specificity of Region 1 on tissue samples

[0087] Region 1 Positive pathological result Negative pathological result Total Positive Sanger sequencing 51 4 55 Negative Sanger sequencing 7 54 61 Total number 58 58 116

[0088] Table 6 Detection Sensitivity and Specificity of Region 2 on Tissue Samples

[0089] Region 1 Positive pathological result Negative pathological result Total Positive Sanger sequencing 50 5 55 Negative Sanger sequencing 8 53 61 Total number 58 58 116

[0090] As can be seen from Table 5 and Table 6, the detection sensitivity (positive coincidence rate) of Region 1 on tissue samples is 51 / 58×100% = 88.0%, and the detection specificity (negative coincidence rate) is 54 / 58×100% = 93.1%; the detection sensitivity (positive coincidence rate) of Region 2 on tissue samples is 50 / 58×100% = 86.2%, and the detection specificity (negative coincidence rate) is 53 / 58×100% = 91.4%. It can be seen that both Region 1 and Region 2 meet the screening conditions of sensitivity ≥ 85% and specificity ≥ 85%, and the next verification can be carried out.

[0091] Probes are designed in Region 1 (Chr2: 172107982 - 172108063) and Region 2 (Chr2: 172108079 - 172108242) according to the above results. The specific sequences are shown in Table 7. All the probes used in Table 7 are TaqMan probes. The 5'-end of the probe is a fluorescent reporter group, such as FAM, VIC, HEX, NED, ROX, TET, JOE, CY3, CY5, etc., and its 3'-end is a fluorescent quenching group, such as TAMRA, MGB, BHQ, BHQ1, BHQ2, BHQ3, etc. In this example, the 5'-end fluorescent reporter group of the probe in Region 1 is ROX, and the 3'-end fluorescent quenching group is BHQ; the 5'-end fluorescent reporter group of the probe in Region 2 is VIC, and the 3'-end fluorescent quenching group is BHQ or BHQ1; the 5'-end fluorescent reporter group of the probe for the internal reference gene ACTB is FAM, and the 3'-end fluorescent quenching group is MGB.

[0092] Table 7 Methylation Primer Pairs and Probes for Target Regions

[0093] Region Methylation detection primer pair (5’-3’) Probe (5’-3’) Region 1 SEQ ID NO.4~5 SEQ ID NO.14: CTCTAAACTATTTCCGACCAAA Region 2 SEQ ID NO.8~9 SEQ ID NO.15: CCAATCACATAATTACCGACGC

[0094] The detection sensitivities and specificities of Region 1 and Region 2 were tested on the test set samples (including 30 plasma samples of lung squamous cell carcinoma, 30 plasma samples of healthy individuals, and 30 blood leukocyte samples of healthy individuals). The methylation detection primer pairs and probes in Table 7 were artificially synthesized and diluted to appropriate concentrations for standby. Using the bisulfite-converted and purified tissue sample DNA as a template, the specific methylation primer pairs and probes in Table 7 were added respectively, and at the same time, the detection primer pair and probe of the internal reference gene ACTB (SEQ ID NO.16: GGAGTGGTTTTTGGGTTTG) were added to monitor the sample quality. If the Ct value of the amplified target sequence of the detection primer pair and probe of ACTB is less than or equal to 34, it indicates that the sample quality is qualified. Configure the TaqMan PCR amplification system according to Table 8, and at the same time, negative and positive controls need to be set. The template of the negative control is TE buffer, and the template of the positive control is a plasmid containing the target region sequence (fully methylated and bisulfite-converted sequence) at 10 3 copies / μL and a plasmid containing the fully methylated and bisulfite-converted ACTB sequence at 10 3 copies / μL, mixed in equal volumes.

[0095] Table 8 TaqMan PCR reaction system

[0096]

[0097]

[0098] Table 9 TaqMan PCR program

[0099]

[0100] Then, qMSP was performed according to the program set in Table 9. After the PCR reaction, the baseline needs to be manually adjusted and an appropriate threshold needs to be set. The baseline is usually the fluorescence signal of 3 to 15 cycles. Samples with unsuccessful detections were excluded according to the requirements of quality control, and the Ct values of qualified samples were read. The criteria for the quality control are as follows: 1) No amplification in the negative control; 2) The amplification curve of the positive control tube is S-shaped, and the Ct values of all genes are between 26 and 30; 3) The Ct value of the internal reference gene in the experimental tube is less than or equal to 34. If the above quality control requirements are not met, this sample needs to be retested. If all samples meet the above requirements, the results of the samples to be tested can be analyzed: For blood leukocyte samples and plasma samples, the positive judgment value is 45. If the Ct value of the amplification using a certain pair of methylation primer pairs and probes is ≤45, the sample is considered methylated positive in this amplification region; if the Ct value of the amplification using a certain pair of methylation primer pairs and probes is >45, the sample is considered methylated negative in this amplification region. The specific detection results are shown in Table 10.

[0101] Table 10 Detection Sensitivity and Specificity of Region 1 and Region 2 in Test Set Samples

[0102]

[0103] In the target regions with hypermethylation in lung squamous cell carcinoma, interference in blood leukocytes needs to be excluded. The specificity of detecting blood leukocyte samples in the target regions should be ≥95% to meet the screening criteria. In Table 10, the specificities of detecting healthy human blood leukocytes in Region 1 and Region 2 are 96.7% and 100% respectively, indicating that the methylation detection primers and probes in Region 1 and Region 2 have good specificity in blood leukocyte samples. At the same time, when amplifying the same target region, the sensitivity and specificity of detecting lung squamous cell carcinoma in plasma samples in Region 1 are 86.7% and 90.0% respectively, and the sensitivity and specificity of detecting lung squamous cell carcinoma in plasma samples in Region 2 are 83.3% and 93.3% respectively. Further verify the detection performance of Region 1 and Region 2 in clinical samples.

[0104] Example 3 Verification of Detection Performance of Target Regions in Validation Set Samples Based on qMSP Method

[0105] In order to achieve an accurate and non-invasive diagnostic method for identifying lung squamous cell carcinoma patients, a total of 177 plasma samples from clinical healthy subjects and 59 plasma samples from clinical lung squamous cell carcinoma subjects were collected in this example. Among them, there were 21 cases of early lung squamous cell carcinoma (including stage I and stage II lung squamous cell carcinoma), and 38 cases of advanced lung squamous cell carcinoma (including stage III and stage IV lung squamous cell carcinoma). After blinding the above clinical samples, they were used as validation set samples, and then the test operator conducted the test and made judgments according to the judgment criteria, and compared the test results with the pathological results (gold standard). The specific test results are shown in Table 11.

[0106] Table 11 Sensitivity and Specificity of Detecting Diagnostic Validation Set Samples in Regions 1 and 2 by qMSP Method

[0107]

[0108] As can be seen from Table 11, the total sensitivities of diagnosing plasma samples of lung squamous cell carcinoma subjects by detecting the methylation levels of Regions 1 and 2 by qMSP method are 86.4% and 84.7% respectively. Among them, by detecting the methylation levels of Regions 1 and 2 by qMSP method, the sensitivities of diagnosing plasma samples of early lung squamous cell carcinoma can reach 81.0% and 76.5% respectively, and the sensitivities of diagnosing plasma samples of advanced lung squamous cell carcinoma can both reach 89.5%. It can be seen that Regions 1 and 2 have good detection effects on plasma samples of early and advanced lung squamous cell carcinoma.

[0109] The methylation levels of regions 1 and 2 were detected by qMSP method, and the specificities for detecting plasma samples of healthy subjects were up to 91.0% and 92.1% respectively, which could effectively avoid the detection of false negative results and improve the accuracy of the detection results.

[0110] In summary, the lung squamous cell carcinoma detection kit prepared from the polynucleotide (SEQ ID NO.1) isolated from the target region of the DLX2-AS1 gene can effectively distinguish healthy subjects from lung squamous cell carcinoma subjects and can be used for the early diagnosis and screening of lung squamous cell carcinoma.

[0111] It is easy for those skilled in the art to understand that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention should be included within the protection scope of the present invention.

Claims

1. A reagent for detecting squamous cell carcinoma of the lung, characterized in that, It is a reagent for detecting the methylation level of lung squamous cell carcinoma biomarkers in a sample, and the lung squamous cell carcinoma biomarkers are selected from the target regions on the CpG island of the DLX2-AS1 gene.

2. The reagent according to claim 1, wherein Using GRCh38.p14 as the reference genome, the target region on the CpG island of the DLX2-AS1 gene is selected from the full length or partial region of the negative strand of Chr2:172107863-172108263.

3. The reagent according to claim 1 or 2, characterized in that, It includes a methylation primer pair for detecting the methylation level of the full length or partial region of the negative strand of Chr2:172107863-172108263.

4. The reagent according to claim 3, characterized in that, It also includes a non-methylation primer pair for detecting the methylation level of the full length or partial region of the negative strand of Chr2:172107863-172108263.

5. The reagent according to claim 4, characterized in that, The reagent includes the first methylation primer pair shown in SEQ ID NO.4-5 and the first non-methylation primer pair shown in SEQ ID NO.6-7; and / or, the second methylation primer pair shown in SEQ ID NO.8-9 and the second non-methylation primer pair shown in SEQ ID NO.10-11.

6. The reagent according to claim 3, wherein The reagent also includes a probe; The reagent includes the first methylation primer pair shown in SEQ ID NO.4-5 and the first probe shown in SEQ ID NO.14; and / or, the second methylation primer pair shown in SEQ ID NO.8-9 and the second probe shown in SEQ ID NO.

15.

7. The reagent according to claim 6, wherein The 5' end of the first probe and the second probe contains a fluorescent reporter group, and the 3' end of the first probe and the second probe contains a fluorescent quenching group.

8. A kit for detecting squamous cell lung cancer, characterized in that, It includes the reagent according to any one of claims 1-7.

9. The kit according to claim 8, wherein It also includes one or more of a detection primer pair and a probe for an internal reference gene, a nucleic acid extraction reagent, a nucleic acid purification reagent, a methylation conversion reagent, an amplification reagent, a positive control product, and a negative control product.

10. Use of the reagent according to any one of claims 1 to 7 or the kit according to claim 8 or 9 in the preparation of a lung squamous cell carcinoma diagnostic product.

Images