SgRNA for detecting tuberculosis based on RPA-CRISPR Cas12b technology, kit, detection method and application

Abstract

The invention provides sgRNA for detecting tuberculosis based on an RPA-CRISPR Cas12b technology, a kit, a detection method and application, and belongs to the technical field of molecular detection. The invention provides sgRNA (single guide ribonucleic acid) for detecting mycobacteria. The sgRNA comprises sgRNA-6110 of which the nucleotide sequence is shown as SEQ ID NO: 1 and / or sgRNA-1081 of which the nucleotide sequence is shown as SEQ ID NO: 2. The sgRNA provided by the invention can specifically recognize and combine high-conservative-degree target sequences IS6110 and IS1081 of mycobacterium tuberculosis and / or mycobacterium bovis, and can be used for instant test of human and livestock tuberculosis pathogenic bacteria mycobacterium tuberculosis and / or mycobacterium bovis.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular detection, and particularly relates to an sgRNA, a kit, a detection method and an application for detecting tuberculosis based on the RPA-CRISPR Cas12b technology. Background Art

[0002] Tuberculosis is a chronic infectious disease caused by infection with the Mycobacterium tuberculosis complex. The Mycobacterium tuberculosis complex mainly includes Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium canettii, Mycobacterium africanum, Mycobacterium microti, Mycobacterium pinnipedii, Mycobacterium caprae, etc. It has been found that the Mycobacterium tuberculosis complex can infect more than 50 species of mammals and 25 species of birds in addition to humans. Human tuberculosis is mainly caused by Mycobacterium tuberculosis, and part is caused by Mycobacterium bovis. Bovine tuberculosis is mainly caused by Mycobacterium bovis, and part is caused by Mycobacterium tuberculosis. Bovine tuberculosis not only affects the food safety of dairy products such as milk and beef, but also poses a potential public health safety hazard, spreading to close contact groups such as herdsmen and slaughter workers and causing infection in the population. Establishing a rapid, sensitive and low-cost detection method for tuberculosis pathogens and improving the detection rate of tuberculosis infection are crucial for the prevention and control of tuberculosis.

[0003] At present, traditional tuberculosis diagnosis and detection methods mainly include bacterial culture, immunological diagnosis and molecular biology methods. However, the traditional culture method takes a long time, and the immunological diagnosis method has certain false positive and false negative results. The nucleic acid amplification and identification method based on polymerase chain reaction (PCR) has high requirements for instruments, detection environment and operators, so it is limited to medical laboratories, and the detection cost is high and the time consumption is long. Although new detection means have been developed in the prior art, such as CRISPR-based detection technology, there is a lack of detection targets with strong specificity for the detection of tuberculosis pathogens. Summary of the Invention

[0004] In view of this, the present invention provides an sgRNA for detecting tuberculosis pathogens based on the RPA-CRISPR Cas12b technology, and the sgRNA can specifically target the highly conserved sequences of Mycobacterium tuberculosis and / or Mycobacterium bovis, effectively improving the detection rate of tuberculosis pathogens in humans and animals.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides an sgRNA for detecting Mycobacterium, and the sgRNA includes sgRNA-6110 with a nucleotide sequence as shown in SEQ ID NO: 1 and / or sgRNA-1081 with a nucleotide sequence as shown in SEQ ID NO: 2.

[0007] The present invention provides a reagent for detecting Mycobacterium, which comprises the following components: the sgRNA, Cas12b protease, and a single-stranded nucleic acid reporter molecule.

[0008] Preferably, the single-stranded nucleic acid reporter molecule comprises a single-stranded nucleotide labeled with a fluorescent group at the 5'-end and a fluorescent quenching group at the 3'-end.

[0009] The present invention provides the application of the sgRNA or the reagent in preparing a kit for detecting tuberculosis.

[0010] The present invention provides a kit for detecting tuberculosis, which comprises an RPA primer pair and the sgRNA or the reagent;

[0011] The RPA primer pair comprises an RPA-6110 primer pair and / or an RPA-1081 primer pair;

[0012] The RPA-6110 primer pair comprises a primer pair with nucleotide sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4;

[0013] The RPA-1081 primer pair comprises a primer pair with nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 6.

[0014] The present invention provides a method for detecting Mycobacterium for non-diagnostic purposes, which comprises the following steps:

[0015] 1) Using the genomic DNA of the sample to be tested as a template, performing RPA amplification with the RPA primer pair in the kit to obtain an RPA amplification product;

[0016] 2) Mixing the RPA amplification product, the sgRNA, and the Cas12b protease and the single-stranded nucleic acid reporter molecule in the reagent, and incubating to obtain a reaction product;

[0017] 3) Measuring the fluorescence intensity of the reaction product, and judging whether the sample to be tested contains Mycobacterium according to the presence or absence of the fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the sample to be tested contains Mycobacterium tuberculosis and / or Mycobacterium bovis, otherwise it does not.

[0018] Preferably, the reaction program of the RPA amplification in step 1) is to react at 42 °C for 30 min.

[0019] Preferably, the reaction system of the RPA amplification in step 1) is as follows: 14.7 μL of A buffer, 1 μL each of 10 μM RPA upstream primer and downstream primer, 5 μL of template, 1.25 μL of B buffer, and made up to 25 μL with enzyme-free water.

[0020] Preferably, the reaction program of the incubation in step 2) is to react at 42 °C for 60 min.

[0021] Preferably, the mycobacteria include Mycobacterium tuberculosis and / or Mycobacterium bovis.

[0022] The present invention has the following advantages compared with the prior art:

[0023] The present invention provides an sgRNA for detecting mycobacteria, and the sgRNA includes sgRNA-6110 with a nucleotide sequence as shown in SEQ ID NO: 1 and / or sgRNA-1081 with a nucleotide sequence as shown in SEQ ID NO: 2. The present invention selects highly conserved target sequences IS6110 and / or IS1081 specific to Mycobacterium tuberculosis and Mycobacterium bovis, designs 3 specific sgRNAs respectively for IS6110 and IS1081, and through the CRISPR Cas12b fluorescence detection experiment, observes the fluorescence intensity of the reaction system to screen out sgRNAs (sgRNA-6110 and / or sgRNA-1081) with an early peak time, high fluorescence intensity and high sensitivity. The sgRNA can specifically recognize and bind to the highly conserved specific DNA target sequences of Mycobacterium tuberculosis and Mycobacterium bovis, so as to realize the instant detection of Mycobacterium tuberculosis and / or Mycobacterium bovis.

[0024] The present invention provides a reagent for detecting mycobacteria, which includes the following components: the sgRNA, Cas12b protease and single-stranded nucleic acid reporter molecule. In the reagent of the present invention, the sgRNA can specifically recognize and bind to the highly conserved specific DNA target sequences of Mycobacterium tuberculosis and Mycobacterium bovis. Once bound, it will activate the cleavage activity of Cas12b protease, cleave the single-stranded nucleic acid reporter molecule in the system, and generate a visually observable fluorescence signal, so as to realize the instant detection of Mycobacterium tuberculosis and Mycobacterium bovis.

[0025] The present invention provides a kit for detecting tuberculosis, comprising an RPA primer pair and the sgRNA or the reagent; the RPA primer pair includes an RPA-6110 primer pair and / or an RPA-1081 primer pair; the RPA-6110 primer pair includes a primer pair with nucleotide sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4; the RPA-1081 primer pair includes a primer pair with nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6. According to the sgRNA, the present invention respectively designs and synthesizes 3 pairs of RPA primer pairs, and through RPA amplification product nucleic acid electrophoresis and CRISPR Cas12b fluorescence detection experiments, the RPA-6110 primer pair and the RPA-1081 primer pair with the optimal amplification efficiency of specific fragments are screened out. The kit of the present invention combines the RPA amplification reaction with the CRISPR-Cas12b reaction, and through the optimized sgRNA and RPA primer pair, realizes the rapid and specific recognition of the target pathogen, and at the same time expands the pathogen spectrum and improves the sensitivity of the diagnostic system. The kit of the present invention focuses on the pasture animals in the high-incidence areas of tuberculosis and their close contacts, has a high detection rate of tuberculosis in the population and cattle, can be used for the monitoring of tuberculosis in pasture animals, reduce the spread of tuberculosis in the animal population, and reduce the threat of animal tuberculosis to humans.

[0026] The present invention provides a method for detecting mycobacterium for non-diagnostic purposes, comprising the following steps: 1) Using the genomic DNA of the sample to be tested as a template, performing isothermal amplification with the RPA primer pair to obtain an RPA amplification product; 2) Mixing the RPA amplification product, the sgRNA, the Cas12b protease and the single-stranded nucleic acid reporter molecule, and incubating to obtain a reaction product; 3) Measuring the fluorescence intensity of the reaction product, and judging whether the sample to be tested contains mycobacterium according to the presence or absence of the fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the sample to be tested contains Mycobacterium tuberculosis and / or Mycobacterium bovis, otherwise it does not. The method of the present invention uses the CRISPR Cas12b system to specifically recognize and cleave the target DNA, combines with the RPA recombinase polymerase isothermal amplification technology, improves the detection sensitivity, and realizes the rapid, accurate and portable tuberculosis diagnosis. The method of the present invention has a fast detection speed, and the whole detection process can be completed within 2-3 hours; it has high detection sensitivity and can detect Mycobacterium tuberculosis or Mycobacterium bovis DNA as low as 2 copies / μL; it is easy to operate, does not require complex instruments and professional technicians, and is suitable for implementation in areas with poor experimental conditions; it has high cost-effectiveness and can be used as an important tool for daily monitoring of pastures to realize large-scale screening. Description of the Drawings

[0027] Figure 1 Schematic diagram of the detection principle of the kit for detecting tuberculosis;

[0028] Figure 2 Verification diagram of IS6110 and IS1081 in the genomes of Mycobacterium tuberculosis standard strain H37Rv and attenuated Mycobacterium bovis BCG vaccine strain. 1: 2000bp DNA marker; 2: IS6110 PCR product (template is H37Rv genome); 3: IS1081 PCR product (template is H37Rv genome); 4: IS6110 PCR product (template is BCG genome); 5: IS1081 PCR product (template is BCG genome);

[0029] Figure 3 Diagram of the screening results of the optimal sgRNA for IS6110. 1 and 2: sgRNA1-6110, 3 and 4: sgRNA2-6110, 5 and 6: sgRNA3-6110, 7: NC;

[0030] Figure 4 Diagram of the screening results of the optimal sgRNA for IS1081. 1 and 2: sgRNA4-1081, 3 and 4: sgRNA5-1081, 5 and 6: sgRNA6-1081, 7: NC;

[0031] Figure 5 Diagram of the optimization results of the concentration ratio of Cas12b to sgRNA;

[0032] Figure 6 Diagram of the electrophoresis results of the screening of RPA primer pairs for IS6110 and IS1081. Among them, A is the electrophoresis results of the screening of RPA primer pairs for IS6110, and B is the electrophoresis results of the screening of RPA primer pairs for IS1081;

[0033] Figure 7 Diagram of the fluorescence results of the screening of RPA primer pairs for IS6110. 1 and 2: F1-R1, 3 and 4: F2-R2, 5 and 6: F3-R3, 7: NC;

[0034] Figure 8 Diagram of the fluorescence results of the screening of RPA primer pairs for IS1081. 1 and 2: F1-R1, 3 and 4: F2-R2, 5 and 6: F3-R3, 7: NC;

[0035] Figure 9 Diagram of the sensitivity experiment results of the RPA CRISPR Cas12b diagnostic system. Among them, A is the sensitivity experiment results of the RPA CRISPR Cas12b diagnostic system for IS6110, and B is the sensitivity experiment results of the RPA CRISPR Cas12b diagnostic system for IS1081. 1-7 indicate different DNA sample concentrations. 1: 10 5 copies / μL, 2: 10 4copies / μL, 3:10 3 copies / μL, 4:10 2 copies / μL, 5:10 copies / μL, 6:5 copies / μL, 7:2 copies / μL, 8: nuclease-free water;

[0036] Figure 10 Figure showing the specific experiment results of the RPACRISPR Cas12b diagnostic system. Among them, A is the figure of the specific experiment results of the IS6110 RPACRISPR Cas12b diagnostic system, and B is the figure of the specific experiment results of the IS1081 RPA CRISPR Cas12b diagnostic system. 1 - 5 represent genomic DNA of different strains. 1: Genomic DNA of Mycobacterium bovis strain BCG, 2: Genomic DNA of Staphylococcus aureus strain, 3: Genomic DNA of Candida albicans strain, 4: Genomic DNA of Escherichia coli strain, 5: nuclease-free water;

[0037] Figure 11 Figure showing the sensitivity experiment results of the RPACRISPR Cas12b diagnostic system for detecting simulated milk samples. Among them, A is the figure of the sensitivity experiment results of the IS6110 RPA CRISPR Cas12b diagnostic system, and B is the figure of the sensitivity experiment results of the IS1081 RPACRISPR Cas12b diagnostic system. 1 - 8 represent the following DNA sample concentrations: 1: 10 7 CFU / mL, 2: 10 6 CFU / mL, 3: 10 5 CFU / mL, 4: 10 4 CFU / mL, 5: 10 3 CFU / mL, 6: 10 2 CFU / mL, 7: 10 CFU / mL, 8: nuclease-free water;

[0038] Figure 12 Figure showing the RPACRISPR Cas12b detection results of sputum samples from tuberculosis patients. The fluorescent reaction templates for 1 - 14 are the products of RPA amplification after extracting DNA from sputum samples of tuberculosis patients, and the fluorescent reaction template for 15 is nuclease-free water;

[0039] Figure 13 Figure showing the RPA CRISPR Cas12b detection results of milk samples from a cattle herd in a certain ranch. The fluorescent reaction templates for 1 - 36 are the products of RPA amplification after extracting DNA from milk samples, and the fluorescent reaction template for 37 is nuclease-free water. Detailed implementation methods

[0040] The present invention provides an sgRNA for detecting mycobacteria, and the sgRNA includes sgRNA-6110 with a nucleotide sequence as shown in SEQ ID NO:1 and / or sgRNA-1081 with a nucleotide sequence as shown in SEQ ID NO:2.

[0041] In the present invention, Mycobacterium tuberculosis and Mycobacterium bovis both belong to the Mycobacterium tuberculosis complex (MTBC), and both can infect humans or animals such as cattle and cause tuberculosis. IS6110 is an insertion sequence that widely exists in the genomes of the Mycobacterium tuberculosis complex and is commonly used for the detection and molecular typing of Mycobacterium tuberculosis. The copy number of IS6110 varies among different mycobacterial strains. The copy number in Mycobacterium tuberculosis is relatively high, usually between 7 and 21, and it also exists in Mycobacterium bovis. The IS1081 fragment usually has 5 to 7 copies in Mycobacterium bovis and also exists in Mycobacterium tuberculosis.

[0042] In the present invention, the sgRNA-6110 is designed based on the conserved gene IS6110 of Mycobacterium tuberculosis and can specifically target the IS6110 of Mycobacterium tuberculosis and Mycobacterium bovis. The sgRNA-1081 is designed based on the conserved gene IS1081 of Mycobacterium bovis and can specifically target the IS1081 of Mycobacterium tuberculosis and Mycobacterium bovis. Selecting the conserved genes IS6110 and IS1081 of Mycobacterium tuberculosis and Mycobacterium bovis as target genes can ensure a high degree of homology of the target genes among different strains, effectively improve the detection rate of tuberculosis pathogens, enhance the sensitivity of the diagnostic system, and reduce the missed detection rate of animals in pastures and closely contacted personnel in high-incidence tuberculosis areas. In addition, the sgRNA of the present invention has high specificity and can only recognize Mycobacterium tuberculosis and / or Mycobacterium bovis, and cannot recognize other common pathogenic bacteria, such as Staphylococcus aureus, Candida albicans, and Escherichia coli. In the examples of the present invention, 3 specific sgRNAs were respectively designed for the target sequences IS1081 and IS6110, and the best sgRNA was screened through the CRISPR Cas12b diagnostic system. The results showed that sgRNA-6110 with a nucleotide sequence as shown in SEQ ID NO:1 and / or sgRNA-1081 with a nucleotide sequence as shown in SEQ ID NO:2 had an early starting time and high fluorescence intensity, and had high sensitivity when used for detection.

[0043] The present invention provides a reagent for detecting mycobacteria, which includes the following components: the sgRNA, Cas12b protease, and a single-stranded nucleic acid reporter molecule.

[0044] In the present invention, the design of the sgRNA is crucial for the detection efficiency of the diagnostic system. The sgRNA guides the Cas12b protease to precisely target the target DNA sequence in the CRISPR detection. It is complementary paired with the target gene through its specific 20-nucleotide sequence, thereby activating the trans-cleavage activity of the Cas12b protease, cleaving the free single-stranded nucleic acid reporter molecule (ssDNA) in the reaction system, separating the fluorescent group and the quenching group modified on the ssDNA, and further generating a visually observable fluorescent detection signal. The Cas12b protease has a signal amplification effect and can achieve the detection of low-abundance target DNA. The single-stranded nucleic acid reporter molecule preferably includes a single-stranded nucleotide labeled with a fluorescent group at the 5' end and a fluorescent quenching group at the 3' end. The fluorescent group is preferably at least one of FAM, TET, VIC, and HEX; the fluorescent quenching group is preferably TAMRA and / or BHQ.

[0045] The present invention provides the application of the sgRNA or the reagent in the preparation of a kit for detecting tuberculosis.

[0046] The present invention provides a kit for detecting tuberculosis, comprising an RPA primer pair and the sgRNA or the reagent; the RPA primer pair includes an RPA-6110 primer pair and / or an RPA-1081 primer pair; the RPA-6110 primer pair includes a primer pair with nucleotide sequences as shown in SEQ ID NO: 3 and SEQ ID NO: 4; the RPA-1081 primer pair includes a primer pair with nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 6.

[0047] The detection principle of the kit of the present invention is shown in Figure 1 . The kit of the present invention can simultaneously detect Mycobacterium tuberculosis and Mycobacterium bovis. When Mycobacterium tuberculosis and / or Mycobacterium bovis exist in the test sample, the RPA primer pair performs RPA amplification on the target gene to obtain an RPA amplification product; the RPA amplification product is mixed and incubated with the sgRNA, Cas12b protease, and single-stranded nucleic acid reporter molecule. The sgRNA specifically binds to the target sequence of the RPA amplification product, activates the Cas12b protease, and causes the Cas12b protease to cleave the single-stranded nucleic acid reporter molecule labeled with a fluorescent group and a quenching group, thereby releasing the fluorescent group and generating fluorescence. On the contrary, when Mycobacterium tuberculosis and / or Mycobacterium bovis do not exist in the test sample, no fluorescence is generated.

[0048] In the present invention, the RPA-6110 primer pair can specifically amplify IS6110, and the obtained amplification product contains a target sequence that is complementary to sgRNA-6110 in the sgRNA; the RPA-1081 primer pair can specifically amplify IS1081, and the obtained amplification product contains a target sequence that is complementary to sgRNA-1081 in the sgRNA. In the embodiments of the present invention, 3 pairs of RPA primer pairs are designed for sgRNA-6110 and sgRNA-1081 respectively. Through RPA amplification and RPACRISPRCas12b technology screening, RPA-6110 primer pairs and the RPA-1081 primer pairs with early peak starting time, high fluorescence intensity and high amplification efficiency of specific fragments are obtained. The objects of the tuberculosis preferably include humans or animals. The animals preferably include mammals, more preferably bovines. The samples detected by the kit include at least one of the following: blood, saliva, cow milk and sputum. The kit of the present invention simultaneously selects highly conserved specific targets IS6110 and IS1081 of Mycobacterium tuberculosis and Mycobacterium bovis, and uses optimized sgRNA and RPA amplification primers to carry out detection based on RPACRISPR Cas12b technology, expanding the spectrum of pathogenic bacteria detected for tuberculosis while improving the detection sensitivity, and achieving rapid and specific detection of target pathogens.

[0049] The present invention provides a method for detecting mycobacteria for non-diagnostic purposes, comprising the following steps:

[0050] 1) Using the genomic DNA of the sample to be tested as a template, performing RPA amplification with the RPA primer pair to obtain an RPA amplification product;

[0051] 2) Mixing the RPA amplification product, the sgRNA, the Cas12b protease and the single-stranded nucleic acid reporter molecule, and incubating to obtain a reaction product;

[0052] 3) Measuring the fluorescence intensity of the reaction product, and judging whether the sample to be tested contains mycobacteria according to the presence or absence of the fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the sample to be tested contains Mycobacterium tuberculosis and / or Mycobacterium bovis, otherwise it does not.

[0053] The present invention uses the genomic DNA of the sample to be tested as a template, and performs RPA amplification with the RPA primer pair respectively to obtain an RPA amplification product.

[0054] In the present invention, the sample to be tested preferably includes at least one of the following: dairy products, blood, saliva, sputum, and meat products. The sample to be tested is preferably heat-inactivated before genomic DNA extraction to ensure biosafety. The method for extracting genomic DNA preferably includes the kit method. The present invention does not specifically limit the method for extracting genomic DNA, and any conventional method for extracting genomic DNA in the art can be used. In the embodiments of the present invention, the genomic DNA is extracted using a TIANGEN DNA extraction kit. The isothermal amplification using the RPA primer pair is preferably carried out using the RPA-6110 primer pair and the RPA-1081 primer pair respectively to obtain the RPA-6110 amplification product and the RPA-1081 primer pair. The reaction system for isothermal amplification is preferably: 14.7 μL of A buffer, 1 μL each of the 10 μM upstream primer and downstream primer, 5 μL of template, 1.25 μL of B buffer, and made up to 25 μL with enzyme-free water. The reaction program for isothermal amplification is preferably 42 °C for 30 min. The present invention does not specifically limit the source of the reagents for RPA amplification, and any conventional RPA amplification kit in the art can be used. In the embodiments of the present invention, an RPA amplification kit is used for isothermal amplification. The RPA amplification kit is purchased from AmpFuture Biotechnology Co., Ltd., and the product name is DNA Isothermal Rapid Amplification Kit (Basic Type) kit.

[0055] After obtaining the RPA amplification product, the present invention mixes the RPA amplification product, the sgRNA, the Cas12b protease, and the single-stranded nucleic acid reporter molecule, and incubates them to obtain a reaction product. In the present invention, the reaction program for incubation is preferably 42 °C for 60 min. The incubation system is preferably: 1 μL of isothermal amplification product, 100 nM of sgRNA, 100 nM of Cas12b protease, 0.5 μL of the 10 μM ssDNA probe modified with a fluorophore, 2.5 μL of the detection buffer 10×ReactionBuffer, and made up to 25 μL with enzyme-free water to complete the reaction. Fluorescence is collected in real time during the incubation reaction (1 cycle per 1 min).

[0056] After obtaining the reaction product, the fluorescence intensity of the reaction product is measured, and whether Mycobacterium is contained in the sample to be tested is judged according to the presence or absence of the fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that Mycobacterium tuberculosis and / or Mycobacterium bovis is contained in the sample to be tested, and vice versa. The present invention does not specifically limit the method for measuring the fluorescence intensity, and any conventional fluorescence intensity detection method in the art can be used. In the embodiments of the present invention, a UV nucleic acid gel cutter is used for fluorescence intensity detection, and a Realtime PCR instrument is used to collect real-time fluorescence signals.

[0057] In the present invention, the detected fluorescence intensity signal is preferably the fluorescence intensity value of the reaction product > 2000. When the fluorescence intensity value > 2000, fluorescence can be observed with the naked eye. The mycobacterium preferably includes Mycobacterium tuberculosis and / or Mycobacterium bovis. The concentration of Mycobacterium tuberculosis and / or Mycobacterium bovis in the sample to be tested is not less than 2 copies / μL.

[0058] The method of the present invention can simultaneously detect Mycobacterium tuberculosis and Mycobacterium bovis. By simultaneously selecting the highly conserved specific targets IS6110 and IS1081 of Mycobacterium tuberculosis and Mycobacterium bovis, the pathogen spectrum is expanded and the diagnostic sensitivity is improved; through the optimized design and screening of sgRNA and RPA amplification primers, rapid and specific recognition of the target pathogen is achieved; at the same time, the reaction system is optimized to enable the amplification and detection of the target sequence to be carried out at the same temperature of 42°C; by determining that the detection efficiency is the highest when the concentration ratio of sgRNA and Cas12b protease in the RPA-CRISPR Cas12b reaction system is 1:1, and the detection efficiency increases with the increase of the concentration, the detection sensitivity is improved. The examples of the present invention verified the sensitivity of the method by detecting the diluted plasmid sample containing the target and the diluted bacterial liquid sample containing milk respectively. The results showed that the lowest detection limit of the method for the plasmid sample was 2 copies / μL, and the lowest detection limit for the bacterial liquid sample was 10 CFU / μL. Specificity verification was carried out by detecting common pathogenic bacteria (Staphylococcus aureus, Candida albicans, Escherichia coli). The results showed that the method had the ability to distinguish between the target strain and non-target strains. It can be seen that the method has high detection sensitivity and strong diagnostic system specificity. In addition, the method of the present invention can detect sputum samples of tuberculosis patients and milk simulation samples, has high sensitivity and specificity, and has strong practical value in the on-site diagnosis of high-incidence areas of tuberculosis in the future, providing a new and efficient tool for the diagnosis of tuberculosis and is expected to play an important role in the field of public health.

[0059] The method of the present invention has the following advantages:

[0060] 1) Rapidity: This diagnostic system is based on CRISPR technology and can achieve rapid detection of Mycobacterium tuberculosis and Mycobacterium bovis. Compared with traditional detection methods, the detection time is greatly shortened;

[0061] 2) High sensitivity: The RPA-CRISPR Cas12b diagnostic system has a sensitivity of 2 copies / μL, which means that even extremely low amounts of pathogens can be detected, improving the diagnostic accuracy;

[0062] 3) Simple operation: This diagnostic system has a constant temperature reaction, simplifies the usage requirements of the detection instrument, makes the detection process more simple and fast, and can be used on-site;

[0063] 4) High specificity: The selected target sequences of Mycobacterium tuberculosis and Mycobacterium bovis are highly conserved and have good specificity. Only when the reaction template is the DNA of the target pathogen, strong green fluorescence will be produced.

[0064] 5) Easy to integrate: The CRISPR system is easy to integrate into portable platforms, suitable for on-site use and point-of-care testing (POCT), increasing the convenience and accessibility of detection.

[0065] 6) Potential multiplex detection ability: The CRISPR technology can theoretically be extended to multiplex detection, which provides the possibility for the future development of diagnostic tools that can simultaneously detect multiple pathogens or drug-resistant genes.

[0066] To further illustrate the present invention, the sgRNA, kit, detection method and application for detecting tuberculosis based on the RPA-CRISPR Cas12b technology provided by the present invention will be described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0067] Example 1

[0068] Determination of target gene sequences

[0069] Select the specific conserved sequences IS6110 and IS1081 of Mycobacterium tuberculosis and Mycobacterium bovis as two detection targets, design PCR primers for the IS6110 and IS1081 targets. The copy number of the target sequences and the presence of bacterial species are shown in Table 1, and the primer sequences for PCR amplification are shown in Table 2.

[0070] Table 1 Targets and existing bacterial species

[0071] Insertion sequence Length Existing strains IS6110 1361 Mycobacterium tuberculosis and Mycobacterium bovis IS1081 1324 Mycobacterium bovis and Mycobacterium tuberculosis

[0072] Table 2 Primer sequences of IS6110 and IS1081

[0073]

[0074]

[0075] Using the whole genome DNA of Mycobacterium tuberculosis strain H37Rv and Mycobacterium bovis strain BCG as templates for PCR amplification to verify the presence of target genes IS6110 and IS1081 in Mycobacterium tuberculosis and Mycobacterium bovis. Mycobacterium tuberculosis strain H37Rv is the standard strain H37Rv of Mycobacterium tuberculosis, purchased from the American Type Culture Collection, with the preservation number: ATCC93009. Mycobacterium bovis strain BCG is the attenuated Mycobacterium bovis vaccine strain BCG (Bacillus Calmette-Guérin), that is, Bacillus Calmette-Guérin vaccine, purchased from Chengdu Institute of Biological Products Co., Ltd.

[0076] The system of PCR amplification: template DNA < 0.5 μg; 1 μL of 10 μM forward primer; 1 μL of 10 μM reverse primer; 12.5 μL of 2×TransTaq HiFi PCR SuperMix; supplemented with ddH2O to 25 μL. The amplification reagents were purchased from TransGen Biotech Co., Ltd. (Beijing).

[0077] The PCR program settings: lid temperature 105 °C, reaction system: 25 μL; pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 65 °C for 30 s, extension at 72 °C for 30 s, repeat this process 30 times; finally extension at 72 °C for 10 min; after the reaction, the IS6110 PCR product and IS1081 PCR product with the H37Rv genome as the template, and the IS6110 PCR product and IS1081 PCR product with the BCG genome as the template were obtained respectively.

[0078] The electrophoresis detection results of the PCR products are as Figure 2 shown (the nucleic acid electrophoresis loading amount is 5 μL). It can be Figure 2 seen that using the genomic DNA of Mycobacterium tuberculosis or Mycobacterium bovis reference strains as templates, the target bands can be amplified.

[0079] Example 2

[0080] sgRNA design and screening experiment

[0081] According to the specific conserved target sequences IS6110 and IS1081 of Mycobacterium tuberculosis and Mycobacterium bovis, 3 specific sgRNAs were designed for IS6110 and IS1081 respectively, and the optimal sgRNAs were screened through the CRISPR-Cas12b detection reaction. The sequence information of the sgRNAs is shown in Table 3, and the sgRNAs were synthesized by GenePharma Co., Ltd.

[0082] Table 3 sgRNA sequences of IS6110 and IS1081

[0083]

[0084]

[0085] Reaction system for screening sgRNA: 2.5 μL of 10× Reaction Buffer, 0.5 μL of 2 μM fluorophore-modified ssDNA probe (FAM-BHQ), the final concentration of sgRNA is 50 nM, the final concentration of Cas12b is 50 nM, using 1 μL of the IS6110 PCR product of the H37Rv genome or the IS1081 PCR product of the BCG genome in Example 1 as a template, and making up to 25 μL with enzyme-free water; the fluorophore-modified ssDNA probe, 2.5 μL of 10× Reaction Buffer, and Cas12b protease are all purchased from Megazyme.

[0086] Reaction procedure: Incubate at a constant temperature of 42 °C for 60 min, and collect fluorescence intensity signals in real time.

[0087] Another control NC is set, and the reaction template for NC is enzyme-free water.

[0088] The results of the fluorescence signal intensity are shown in Figure 3 and Figure 4 . According to Figure 3 and Figure 4 , it can be seen that the starting peak times of sgRNA2-6110 and sgRNA4-1081 are earlier and the fluorescence intensities are higher.

[0089] Another 1 μL of the IS6110 PCR product of the BCG genome or the IS1081 PCR product of the H37Rv genome in Example 1 is used as a template to screen sgRNA, and the results are also that the starting peak times of sgRNA2-6110 and sgRNA4-1081 are earlier and the fluorescence intensities are higher.

[0090] Therefore, the optimal sgRNA for IS6110 is sgRNA2-6110, and the optimal sgRNA for IS1081 is sgRNA4-1081. Subsequent experiments are carried out using sgRNA2-6110 and sgRNA4-1081.

[0091] Example 3

[0092] Optimization experiment of the reaction system of the CRISPR Cas12b diagnostic system

[0093] In order to improve the detection efficiency of the diagnostic system, the optimal reaction concentration ratio of sgRNA and Cas12b protease in the CRISPR-Cas12b detection reaction is determined through experiments.

[0094] In the reaction system of the optimized concentration ratio experiment, the reaction template was the IS6110 PCR product of the H37Rv genome in Example 1, and the sgRNA was sgRNA2-6110; the concentrations and well-loading orders of Cas12b and sgRNA2-6110 are shown in Table 4.

[0095] Table 4 Experimental well-loading concentrations and orders

[0096] Reagent Well 1 Well 2 Well 3 Well 4 Well 5 Well 6 Well 7 Cas12b (nM) 100 100 100 200 200 200 100 sgRNA2-6110 (nM) 100 150 200 100 150 200 100

[0097] Reaction system of the optimized concentration ratio experiment: 2.5 μL of 10×Reaction Buffer, 0.5 μL of 10 μM ssDNA probe modified with a fluorescent group, the final concentration of sgRNA was 100 nM, 150 nM or 200 nM, the final concentration of Cas12b was 100 nM or 200 nM, 1 μL of template, and made up to 25 μL with enzyme-free water; reaction program: 42 °C, constant temperature reaction for 60 min, and collect fluorescence signals in real time. The ssDNA probe modified with a fluorescent group (FAM-BHQ), 2.5 μL of 10×Reaction Buffer, and Cas12b protease were all purchased from Magen Biosciences. Another control NC was set, and the reaction template of NC was enzyme-free water.

[0098] The fluorescence detection results are shown in Figure 5 . According to Figure 5 the results, the fluorescence intensities of well 1 and well 6 were high, and the fluorescence intensity of well 6 was higher than that of well 1. Another optimization of the concentration ratio was carried out with the IS6110 PCR product reaction of the BCG genome in Example 1 as the template, and the same results were obtained.

[0099] Therefore, in the reaction system, when the concentration ratio of Cas12b and sgRNA was 1:1, the detection efficiency was relatively high, and the detection efficiency increased with the increase of concentration. When applying to actual samples in the future, it can be considered to appropriately increase the concentrations of both under the premise that the final reaction concentration of sgRNA:Cas12b is 1:1 to improve the detection efficiency of the diagnostic system.

[0100] Example 4

[0101] Recombinase polymerase isothermal amplification (RPA) primer design and screening experiment

[0102] The target fragment for RPA amplification needs to contain the target sequence complementary to the sgRNA. For the optimal sgRNAs (IS6110-sgRNA2 and IS1081-sgRNA4) screened in Example 2, 3 pairs of RPA primer pairs were designed respectively, and the primer pair sequences are shown in Table 5. The experiment was carried out according to the operation instructions of the AmpFuture RPA amplification kit to screen the best RPA primer pair.

[0103] Table 5 Sequences of RPA primer pairs for IS6110 and IS1081

[0104] RPA primer name RPA primer sequence IS6110-F1: CACATCAGCCGCGTCCACGCCGCCAACTACG (SEQ ID NO: 15) IS6110-R1: CTTTCAGGTCGAGTACGCCTTCTTGTTGGCG (SEQ ID NO: 16) IS6110-F2: CGCAAAGTGTGGCTAACCCTGAACCGTGAGG (SEQ ID NO: 3) IS6110-R2: CCGTATGGTGGATAACGTCTTTCAGGTCGAG (SEQ ID NO: 4) IS6110-F3: CGCTTCGGACCACCAGCACCTAACCGGCTGT (SEQ ID NO: 17) IS6110-R3: CGCTCGCTGAACCGGATCGATGTGTACTGAG (SEQ ID NO: 18) IS1081-F1: CGCGAACGCAGCGATGAGCGGTCCAATCAGC (SEQ ID NO: 19) IS1081-R1: CGGGCGGGTCCGAAACGCCTCTACGGCTTCG (SEQ ID NO: 20) IS1081-F2: CCGCAAGCGAGCTGAACGCGCACTGACCAGC (SEQ ID NO: 5) IS1081-R2: CGAGGAAGGTATACGGGCCGGCATCGAGCGG (SEQ ID NO: 6) IS1081-F3: CTGCTGGGAGTATCCACTCGCCGGATGGAGC (SEQ ID NO: 21) IS1081-R3: CGGCGAGGAAGGTATACGGGCCGGCATCGAG (SEQ ID NO: 22)

[0105] The template for the RPA amplification reaction was the whole genome of BCG. The RPA amplification reaction system: 14.7 μL of A buffer, 1 μL each of 10 μM upstream primer and downstream primer, 5 μL of template, 1.25 μL of B buffer, and made up to 25 μL with enzyme-free water. Incubate at a constant temperature of 42 °C for 30 min. After the isothermal amplification reaction, using the heat denaturation method, add 8 μL of 6× Loading buffer to the reaction product and mix well, incubate at 56 °C for 5 min, and take 5 μL of the mixture for agarose gel electrophoresis detection.

[0106] After RPA amplification, RPA amplification products were obtained. Using the RPA amplification products as the target for subsequent CRISPR fluorescence detection reactions, prepare the CRISPR fluorescence detection reaction system: Take 1 μL of the product after isothermal amplification, add sgRNA-6110 with a final concentration of 100 nM and sgRNA-1081 with a final concentration of 100 nM to the reaction system, add Cas12b protease with a final concentration of 100 nM, 0.5 μL of 10 μM ssDNA probe modified with a fluorescent group, and 2.5 μL of 10× ReactionBuffer of the detection buffer in the reaction system, and make up the reaction to 25 μL with enzyme-free water. The NC reaction template was enzyme-free water. Add the reaction system to an RNase-free PCR tube and mix well. React at 42 °C for 60 min, observe the fluorescence intensity, and observe and photograph under ultraviolet light after the reaction.

[0107] According to the results of agarose gel electrophoresis detection ( Figure 6 ) and the results of CRISPR Cas12b fluorescence detection ( Figure 7 and Figure 8 ), among the RPA primer pairs IS6110-F2 and IS6110-R2 for amplifying the target sequence IS6110, the peak starting time was the earliest and the fluorescence intensity was the strongest, which were the optimal RPA primer pairs for IS6110. For the RPA primer pairs IS1081-F2 and IS1081-R2 of IS1081, the peak starting time was the earliest and the fluorescence intensity was the strongest, which were the optimal RPA primer pairs for IS1081. Use the selected optimal primer pairs for subsequent experiments.

[0108] Example 5

[0109] Sensitivity experiment of the RPA-CRISPR Cas12b diagnostic system

[0110] Using the sgRNA with the optimal activity against IS6110 and IS1081 screened in Example 2 and the optimal RPA primer pair screened in Example 4, RPA amplification and CRISPR Cas12b fluorescence detection were carried out under the condition that the sgRNA:Cas12b concentration ratio was 1:1, and the reaction was carried out at a constant temperature of 42°C.

[0111] Copies of DNA template per microliter = (6.02×10 23 )×(concentration ng / μL×10 -9 ) / (DNA length×660) Formula I

[0112] The plasmid copy numbers containing IS6110 and IS1081 fragments were calculated according to Formula I and subjected to 10-fold serial dilution.

[0113] Using the serially diluted plasmids as DNA templates respectively, RPA amplification reactions were carried out. Reaction system: 14.7 μL of A buffer, 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, 5 μL of DNA template, 1.25 μL of B buffer, and made up to 25 μL with enzyme-free water. Reaction procedure: 42°C, 30 min.

[0114] After RPA amplification, RPA amplification products were obtained. Using the RPA amplification products as templates for CRISPR reactions, a CRISPR fluorescence detection reaction system was prepared: Take 1 μL of RPA amplification products, add Cas12b protease with a final concentration of 100 nM, sgRNA with a final concentration of 100 nM, 1 μL of RPA amplification reaction products as templates, 0.5 μL (2 μM) of fluorophore-modified ssDNA probe, and 2.5 μL of 10×Reaction Buffer of detection buffer into the reaction system, and make up the reaction to 25 μL with enzyme-free water. Add the reaction system into an RNase-free PCR strip tube and mix well. React at 42°C for 60 min, observe the fluorescence intensity, and test the lowest detection limit of the RPA-CRISPR Cas12b diagnostic system.

[0115] According to the CRISPR Cas12b fluorescence detection results ( Figure 9 ), it can be observed that the detection sensitivity of the diagnostic system can be as low as 2 copies / μL.

[0116] Example 6

[0117] Specificity of the RPA-CRISPR Cas12b Diagnostic System

[0118] System-specific evaluation using single bacterial DNA as a template. The steps are as follows. First, select common pathogenic bacteria in the laboratory, Staphylococcus aureus, Candida albicans, and Escherichia coli, and extract the genomes according to the operating instructions of the Tiangen Bacterial Genomic DNA Extraction Kit. The extracted genomes are stored at -20°C for subsequent use.

[0119] Using the genomic DNA of different extracted pathogenic bacteria strains and BCG strain with a final concentration of 50 nM as templates, perform RPA amplification reactions respectively. The reaction system and reaction procedure are the same as in Example 5.

[0120] After RPA amplification, obtain the RPA amplification products, and use the RPA amplification products as templates for CRISPR reaction to perform CRISPR-Cas12b fluorescence detection reactions. The system and procedure of the CRISPR fluorescence detection reaction are the same as in Example 5.

[0121] According to the CRISPR Cas12b fluorescence detection results ( Figure 10 ), it can be seen that only the reaction products of the test samples containing BCG produce fluorescence, while the test samples containing Staphylococcus aureus, Candida albicans, and Escherichia coli do not produce fluorescence. Therefore, the RPA-CRISPR Cas12b diagnostic system has the ability to distinguish target strains from non-target strains.

[0122] Example 7

[0123] Application experiment of the RPA-CRISPR Cas12b tuberculosis diagnostic system

[0124] 1. Detection limit of the RPA-CRISPR Cas12b tuberculosis diagnostic system for milk simulation samples

[0125] To evaluate the sensitivity and practical value of this detection system in actual samples, we simulated milk samples, purchased sterilized milk from a local supermarket, mixed it with counted BCG (Bacille Calmette-Guérin) bacterial solution, and performed 10-fold serial dilutions to simulate milk samples that might be collected on a ranch. Subsequently, these samples were pretreated and nucleic acids were extracted, followed by RPA amplification and CRISPR fluorescence detection.

[0126] Using the DNA of the simulated milk samples extracted by the TIANGEN DP304 kit as a template for the RPA amplification reaction, and using the AmpFuture DNA Isothermal Rapid Amplification Kit (basic type) kit, the reaction system and reaction procedure are the same as in Example 5.

[0127] After RPA amplification, the RPA amplification product was used as the template for the CRISPR reaction to perform the CRISPR-Cas12b fluorescence detection reaction. The system and procedure of the CRISPR fluorescence detection reaction were the same as those in Example 5.

[0128] According to the results of CRISPR Cas12b fluorescence detection ( Figure 11 ), it can be seen that the RPACRISPR Cas12b tuberculosis diagnosis system showed extremely high sensitivity when detecting milk samples and was able to detect concentrations as low as 10 CFU / mL. This system is expected to be applied in field trials in high-incidence areas of tuberculosis to detect pasture animals and their close contacts to achieve more extensive disease monitoring.

[0129] 2. Detection of sputum samples from clinical tuberculosis patients by the RPACRISPR Cas12b tuberculosis diagnosis system

[0130] Fourteen sputum samples from clinically diagnosed tuberculosis patients in a certain hospital were collected for RPA CRISPR Cas12b fluorescence detection. The results of the 14 tuberculosis patients examined by different methods are as follows: 3 cases were positive in the tubercle bacillus smear examination, 6 cases were positive in the IFN-γ release test examination, 11 cases were positive in the rapid tuberculosis rifampicin resistance X-pert test, and 1 case was positive in the tuberculosis antibody IgG test. The detailed information is shown in Table 6.

[0131] Method for detecting sputum samples from clinical tuberculosis patients by the RPACRISPR Cas12b tuberculosis diagnosis system:

[0132] Pretreatment of sputum samples: Boiling water was used for high-temperature sterilization for 30 min to ensure biosafety and at the same time lysed the bacterial cells. The Qiagen DNAMini Kit was used for sample nucleic acid extraction: 900 μL of the boiled sputum was aspirated and placed in a 1.5 ml centrifuge tube. 180 μL of Buffer ATL and 20 μL of Proteinase K were added, vortexed and incubated at 56 °C until complete lysis (1 - 3 h), vortexed during the incubation, and then nucleic acid extraction was carried out according to the kit instructions.

[0133] The DNA of the clinical sputum samples extracted by the kit was used as the template for the RPA amplification reaction. The AmpFuture DNA isothermal rapid amplification kit (basic type) was used, and the reaction system and reaction procedure were the same as those in Example 5.

[0134] After RPA amplification, the RPA amplification product was used as the template for the CRISPR reaction to perform the CRISPR-Cas12b fluorescence detection reaction. The system and procedure of the CRISPR fluorescence detection reaction were the same as those in Example 5.

[0135] According to the CRISPR Cas12b fluorescence detection results ( Figure 12 and Table 6), it can be seen that the RPACRISPR tuberculosis detection system detected positive in all 14 sputum samples from tuberculosis patients.

[0136] Table 6 Detection results of sputum samples from 14 tuberculosis patients

[0137]

[0138] Note: + indicates a positive detection.

[0139] 3. Detection of milk samples from dairy cattle herds in pastures by the RPA CRISPR Cas12b tuberculosis diagnosis system

[0140] Collect 36 milk samples from dairy cows with positive PPD intradermal hypersensitivity reactions in a dairy cattle herd. One sample was collected from each cow, for a total of 36 samples, and subjected to RPA CRISPR Cas12b fluorescence detection. At the same time, a commercial fluorescence PCR detection kit was used for detection. Blood was aseptically collected from these 36 cows and added to a heparin-containing anticoagulant vacuum tube and transported to the laboratory. A commercial IFN-γ release assay kit was used for retesting tuberculosis positivity. Information on dairy cattle tuberculosis detection is shown in Table 7.

[0141] Treatment of milk samples: Use the TIANGEN DP304 DNAKit kit to extract nucleic acids from samples in a biosafety cabinet: Pipette 200 μL of milk sample and place it in a 1.5 ml centrifuge tube. Add 200 μL of buffer GA, 20 μL of Proteinase K, and 200 μL of buffer GB, vortex and incubate at 70 °C until complete lysis (10 min). Invert the mixture up and down during incubation, and then perform nucleic acid extraction according to the kit instructions.

[0142] Use the DNA extracted from clinical sputum samples by the kit as the template for the RPA amplification reaction. Use the AmpFuture DNA isothermal rapid amplification kit (basic type) kit, and the reaction system and reaction program are the same as in Example 5.

[0143] After RPA amplification, the RPA amplification product is obtained. Use the RPA amplification product as the template for the CRISPR reaction to perform the CRISPR-Cas12b fluorescence detection reaction, and the system and program of the CRISPR fluorescence detection reaction are the same as in Example 5.

[0144] According to the CRISPR Cas12b fluorescence detection results ( Figure 13)It can be seen that the RPA CRISPR tuberculosis detection system detected 28 positive samples out of 36 milk samples, with a positive rate of 77.8%, and the detection rate was higher than that of the commercial fluorescent PCR kit. The commercially available fluorescent PCR method detected 20 positive samples, with a positive rate of 55.6%.

[0145] Table 7 Diagnosis of bovine tuberculosis and test results of milk samples

[0146]

[0147] Note: + indicates positive detection

[0148] Based on the above experimental results, it can be seen that the method of the present invention provides a technical basis for the detection of tuberculosis pathogens and disease monitoring of tuberculosis suspected patients or pasture animals, and has great potential and value in clinical applications, and is of great significance for the early diagnosis and prevention and control of tuberculosis.

[0149] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. Other embodiments can be obtained according to this embodiment without creative work, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An sgRNA for detecting mycobacterium, characterized in that, The sgRNA includes sgRNA-6110 with a nucleotide sequence as shown in SEQ ID NO:1 and / or sgRNA-1081 with a nucleotide sequence as shown in SEQ ID NO:

2.

2. A reagent for detecting mycobacterium, characterized in that, It includes the following components: the sgRNA described in claim 1, Cas12b protease, and a single-stranded nucleic acid reporter molecule.

3. The reagent according to claim 2, wherein The single-stranded nucleic acid reporter molecule includes single-stranded nucleotides labeled with a fluorophore at the 5' end and a fluorescence quencher at the 3' end.

4. Use of the sgRNA described in claim 1 or the reagent described in claim 2 or 3 in the preparation of a kit for detecting tuberculosis.

5. A kit for detecting tuberculosis, characterized in that, It includes an RPA primer pair and the sgRNA described in claim 1 or the reagent described in claim 2 or 3; The RPA primer pair includes an RPA-6110 primer pair and / or an RPA-1081 primer pair; The RPA-6110 primer pair includes a primer pair with nucleotide sequences as shown in SEQ ID NO:3 and SEQ ID NO:4; The RPA-1081 primer pair includes a primer pair with nucleotide sequences as shown in SEQ ID NO:5 and SEQ ID NO:

6.

6. A method for detecting mycobacterium for non-diagnostic purposes, characterized in that, It includes the following steps: 1) Using the genomic DNA of the sample to be tested as a template, performing RPA amplification with the RPA primer pair in the kit described in claim 5 to obtain an RPA amplification product; 2) Mixing the RPA amplification product, the sgRNA described in claim 1, and the Cas12b protease and the single-stranded nucleic acid reporter molecule in the reagent described in claim 2 or 3, and incubating to obtain a reaction product; 3) Measuring the fluorescence intensity of the reaction product, and judging whether the sample to be tested contains mycobacteria according to the presence or absence of fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the sample to be tested contains Mycobacterium tuberculosis and / or Mycobacterium bovis, otherwise it does not.

7. The method according to claim 6, characterized in that The reaction program of the RPA amplification in step 1) is to react at 42°C for 30 min.

8. The method according to claim 6, wherein The reaction system of the RPA amplification in step 1) is: 14.7 μL of A buffer, 1 μL each of 10 μM RPA upstream primer and downstream primer, 5 μL of template, 1.25 μL of B buffer, and made up to 25 μL with enzyme-free water.

9. The method according to claim 6, wherein The reaction program of the incubation in step 2) is to react at 42°C for 60 min.

10. The method according to any one of claims 6 to 9, characterized in that The mycobacteria include Mycobacterium tuberculosis and / or Mycobacterium bovis.

Images