An indel molecular marker related to soybean seed isoflavone content and application thereof

Abstract

The application discloses an InDel molecular marker related to soybean seed isoflavone content and application thereof. The marker is located at a 57221341-57221412 site of chromosome 18 of a soybean genome version Glycine_max_Wm82.a2.v1, and contains a 72 bp insertion / deletion mutation. A high isoflavone content material carries a type A allele containing a 72 bp insertion fragment, and a low isoflavone content material carries a type B allele in which the fragment is deleted. The application first identifies a 72 bp InDel molecular marker significantly related to isoflavone content at the 57221341-57221412 site of chromosome 18 of the soybean genome version Glycine_max_Wm82.a2.v1. According to the InDel molecular marker, an InDel primer sequence is designed, PCR amplification is carried out, a detection result is observed, and an isoflavone content phenotype is identified. The primer of the application can be used for identifying and screening the isoflavone content phenotype of soybean, and can quickly, accurately and effectively breed a soybean variety with high isoflavone content, accelerates a crop breeding process, and improves breeding efficiency and success rate.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and particularly relates to an InDel molecular marker related to soybean seed isoflavone content and application thereof. BACKGROUND

[0002] Soybean isoflavone is an important plant protectant. As a secondary metabolite of the phenylalanine pathway during soybean growth, soybean isoflavone has been shown to have a significant effect on preventing cardiovascular diseases, osteoporosis, hypertension, diabetes, breast cancer, prostate cancer and other diseases, and thus has attracted widespread attention from researchers in the fields of medicine and food science. In many fields, soybean isoflavone has also been widely developed and utilized, and has become a highly sought-after health product.

[0003] In addition to its value in human health, soybean isoflavone also participates in the plant disease resistance process. Some studies have shown that by increasing the isoflavone content in soybean plants, the disease resistance of soybean can be enhanced, and the demand for pesticides can be reduced, thereby improving economic benefits. However, in the field of agriculture, the research on soybean isoflavone is relatively lagging behind. This is mainly reflected in the scarcity of high isoflavone soybean varieties, the limited availability of excellent germplasm resources, and the lack of research on the genetic mechanism of soybean isoflavone. In order to meet the increasing demand for soybean isoflavone in the market, it is urgent to improve the yield of high isoflavone soybean and breed soybean varieties rich in high isoflavone. Therefore, identifying the sites related to each component of soybean isoflavone, mining candidate genes related to isoflavone, developing molecular markers related to each component of soybean isoflavone, and mining high isoflavone soybean resources are of great significance for accelerating the molecular breeding of high isoflavone soybean. SUMMARY

[0004] The technical problem to be solved by the present application is to provide an InDel molecular marker related to soybean seed isoflavone content and application thereof.

[0005] To solve the above technical problems, the technical solutions adopted by the present application are as follows.

[0006] An InDel molecular marker related to soybean seed isoflavone content, the marker is located at the 57221341-57221412 site of chromosome 18 of the Glycine_max_Wm82.a2.v1 version of soybean genome, and contains a 72 bp insertion / deletion mutation, wherein the high isoflavone content material carries a type A allele containing a 72 bp insertion fragment, and the low isoflavone content material carries a type B allele lacking the fragment.

[0007] Further preferably, the nucleotide sequence of the type A allele is shown in SEQ ID NO: 1, and the nucleotide sequence of the type B allele is shown in SEQ ID NO: 2.

[0008] A specific primer pair for detecting the InDel molecular marker, the upstream primer sequence is shown as SEQ ID NO: 3; the downstream primer sequence is shown as SEQ ID NO: 4.

[0009] A kit for detecting the content of soybean isoflavones, comprising the specific primer pair.

[0010] A detection method for identifying the content of soybean isoflavones, comprising the following steps:

[0011] (1) Taking the DNA of the soybean material to be tested as a template, performing PCR amplification with the InDel molecular marker primer to obtain a PCR amplification product;

[0012] (2) Performing agarose gel electrophoresis detection on the amplification product, and observing the electrophoresis detection result.

[0013] Further preferably, when the length of the amplification product is 544 bp, the gene marker band type of the soybean to be tested is type A; when the length of the amplification product is 472 bp, the gene marker band type of the soybean to be tested is type B; the high and low content of isoflavones is: the soybean with the gene marker band type A is greater than or candidate for the soybean with the gene marker band type B.

[0014] Further preferably, the reaction program of the PCR amplification is 95℃ pre-denaturation for 3 min; 95℃ for 30 s, 52℃ for 30 s, 72℃ for 30 s, 33 cycles; 72℃ extension for 5 min.

[0015] The application of the InDel molecular marker or the specific primer pair in soybean molecular marker-assisted breeding, which screens the soybean breeding material with high isoflavone content by detecting the genotype of the molecular marker.

[0016] A breeding method of a soybean variety with high isoflavone content, comprising:

[0017] 1) Detecting the InDel-57221341 marker genotype of the parent or hybrid offspring by using the specific primer pair;

[0018] 2) Preferentially selecting the material carrying the A-type allele as a breeding parent or a single plant selected in the middle;

[0019] 3) Obtaining a soybean variety with high isoflavone content by combining field trait evaluation.

[0020] A molecular identification method of a soybean variety, which distinguishes soybean varieties with different isoflavone content characteristics by detecting the genotype of the InDel molecular marker.

[0021] The beneficial effects produced by the above technical solutions are that the 72 bp InDel molecular marker significantly related to isoflavone content is first identified at the 57221341-57221412 locus of chromosome 18 of the soybean genome version Glycine_max_Wm82.a2.v1, the InDel primer sequence is designed according to the InDel molecular marker, PCR amplification is carried out, the detection result is observed, and the isoflavone content phenotype is identified. The primer of the application can be used for identifying and screening the isoflavone content phenotype of soybean, and can quickly, accurately and effectively breed soybean varieties with high isoflavone content, accelerate the crop breeding process, and improve the efficiency and success rate of breeding. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 is the population structure of 290 natural populations;

[0023] Figure 2 is the schematic diagram of electrophoresis results of materials 1 to 48;

[0024] Figure 3 is the schematic diagram of electrophoresis results of materials 49 to 96;

[0025] Figure 4 is the schematic diagram of electrophoresis results of materials 97 to 144;

[0026] Figure 5 is the schematic diagram of electrophoresis results of materials 145 to 193;

[0027] Figure 6 is the schematic diagram of electrophoresis results of materials 194 to 239;

[0028] Figure 7 is the schematic diagram of electrophoresis results of materials 240 to 286;

[0029] Figure 8 is the schematic diagram of electrophoresis results of materials 287 to 300;

[0030] Figure 9 is the Manhattan plot and QQ plot of the soybean isoflavone whole genome association analysis result,

[0031] Note: Daidzin: Daidzin; Genistin: Genistin; Glycitin: Glycitin; Malonyldaidzin: Malonyldaidzin; Malonylgenistin: Malonylgenistin; Malonylglycitin: Malonylglycitin; TIF: Total Isoflavone;

[0032] Figure 10 is the gene linkage disequilibrium and haplotype block diagram in the main site interval of the isoflavone 18th chromosome of soybean;

[0033] Figure 11 Figure 2 is the PCR amplification result of the primer in part of soybean;

[0034] Figure 12 Figure 3 is the analysis of isoflavone content difference of two haplotype materials by Indel marker;

[0035] Figure 13 Figure 4 is the field planting photo of GWAS material. DETAILED DESCRIPTION

[0036] The following examples illustrate the present application. The various raw materials and equipment used in the present application are all conventional commercially available products, which can be directly obtained by market purchase. The experimental methods used in the following examples are all conventional methods unless otherwise specified.

[0037] It should be understood that the term "comprising" as used in the specification and the appended claims indicates the presence of the recited features, integers, steps, operations, elements, and / or components, but does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0038] It should also be understood that the term "and / or" as used in the specification and the appended claims indicates any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0039] The reference in the specification to "one embodiment" or "some embodiments" or the like means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the application. The appearances of the phrases "in one embodiment", "in some embodiments", "in other embodiments", "in additional embodiments", and the like in various places in the specification are not necessarily all referring to the same embodiment, unless otherwise specifically noted. Rather, the term "in one embodiment" or "in some embodiments" or the like, means "in at least one embodiment" or "in one or more embodiments", but not necessarily all embodiments unless otherwise specifically noted. The terms "including", "containing", "having" and variations thereof mean "including but not limited to", unless otherwise specifically noted.

[0040] In addition, in the description of the specification and the appended claims, the terms "first", "second", "third", and the like are only used for differentiation of description, and cannot be understood as indicating or implying relative importance.

[0041] The technical solutions of the present application will be described clearly and completely below in combination with specific embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work fall within the scope of the present application.

[0042] Example 1, Materials and Methods

[0043] 1.1 Test materials

[0044] The natural population used in this study includes 290 soybean materials collected by the research team in the early stage, including 108 improved varieties, 60 micro-core germplasm, and 40 Huanghuaihai germplasm materials from domestic materials; 82 materials from foreign countries mainly from the United States, Japan, and South Korea. In 2021, 2022, and 2023, three growing seasons were planted in Shijiazhuang City, Hebei Province (114.48°E, 38.03°N). Each material was sown in 3 rows, with a row length of 3 m, a row spacing of 0.5 m, and a plant spacing of 0.2 m. A completely randomized block design was used with 3 replicates and normal field management (such as shown in the figure). After the materials naturally matured, the seeds of 5 plants in the middle row were collected for soybean isoflavone content determination. Figure 13

[0045] 1.2 Test instruments and equipment

[0046] Tianjin Teng Organic Phase Nylon Filter Membrane with a diameter of 13 mm and a pore size of 0.45 µm, chromatographic grade methanol, chromatographic grade acetonitrile, liquid phase automatic sampling vial and bottle cap purchased from Thermo Fisher Scientific Company; analytical grade acetic acid purchased from Merck Company; main instruments include microanalysis balance, multifunctional pulverizer, Thermo Scientific™ basic type vortex oscillator, centrifuge, ultrasonic water bath constant temperature oscillator, and Agilent high performance liquid chromatograph.

[0047] 1.3 Test methods

[0048] The extraction and determination method of soybean isoflavone content is as follows:

[0049] a. Select 30 soybean seeds, crush them through an 80-mesh sieve using a high-speed universal pulverizer, and mix well. Weigh 0.02 g of soybean powder and place it in a 2 mL capacity centrifuge tube.

[0050] b. Add 1 mL of 0.1% acetic acid in 70% ethanol to the powder and place it in a shaker (INNOVA 42, Eppendorf, Shanghai agency, Germany) at 28°C, 200 rpm for 12 h. ​

[0051] c. Centrifuge at 12,000 r / min for 10 min at 4℃, take the supernatant, pass through a 0.45 μm organic phase needle filter, and inject into a liquid phase sample vial, and store at 4℃ or -20℃ for long-term preservation, and then detect by high performance liquid chromatography.

[0052] d. Agilent 1260 liquid chromatography instrument was used for determination, the chromatographic column was YMC-Pack ODS-AM-303 (250 mm × 4.6 mm I.D., S-5 μm, 120Å, YMC Co. Kyoto, Japan), the column temperature was 35℃, the mobile phases A and B were 0.1% acetic acid-distilled water and acetonitrile respectively. The injection volume was 20 μL, the flow rate of mobile phase was 1.0 mL·min-1, the column temperature was 35℃, the linear gradient used 13-35% acetonitrile (V / V) for 70 min and kept at 35℃. The isoflavones were detected by UV absorption at 260 nm wavelength.

[0053] e. Considering that soybean seeds mainly contain six isoflavone components, namely daidzin, glycitin, genistin, malonyldaidzin, malonylglycitin and malonylgenistin, this study mainly detected the above six isoflavone components, and the total content of isoflavones was defined as the sum of the contents of the above six single isoflavones.

[0054] 1.4 Analysis of isoflavone phenotype data

[0055] In the high performance liquid chromatography (HPLC) system, the isoflavone concentrations of the standard and sample were determined according to the corresponding retention time and peak area, and the peak area and concentration of the standard were linearly regressed to establish a linear equation. In this study, SPSS 26.0 software was used for descriptive statistics and correlation analysis of the phenotype data, Excel was used for sorting and analyzing the phenotype data of soybean isoflavones, and Graphpadprism7.0 was used to draw the frequency distribution histogram of the phenotype data of soybean isoflavones to observe whether the data conformed to the normal distribution.

[0056] 1.5 Extraction and detection of soybean genomic DNA

[0057] In this experiment, fresh leaves of natural population (15 days after emergence) were used, and DNA extraction kit (Nuclean Plant Genomic DNA Kit) of Kangwei Reagent Biotechnology Co., Ltd. was used for extraction. The specific operation is as follows:

[0058] a. Put about 100 mg fresh leaf into a 2 mL centrifuge tube, add liquid nitrogen, then break the leaf and grind thoroughly using a high-throughput tissue grinder.

[0059] b. Add 400 μΐ Buffer LP1 and 6 μΐ RNase A to the ground powder and mix well, after vortexing for 2 min, stand at room temperature for 10-15 min to ensure complete lysis.

[0060] c. Then add 130 μΐ Buffer LP2 to the lysis solution, mix well and vortex for 2 min; centrifuge at 12,000 rpm for 5 min, then transfer the supernatant to a new centrifuge tube.

[0061] e. Add 1.5 times the volume of Buffer LP3 and mix well immediately.

[0062] f. Pour all the solution and precipitate into the adsorption column with a collection tube, centrifuge at 12,000 rpm for 1 min, then discard the waste liquid in the tube, and further place the adsorption column in a 2 mL centrifuge tube.

[0063] g. Add 500 μΐ Buffer GW2, centrifuge at 12,000 rpm for 1 min, then discard the waste liquid in the tube, and re-place it in a 2 mL centrifuge tube.

[0064] h. Repeat step 6

[0065] i. After centrifuging at 12,000 rpm for 2 min, discard the waste liquid in the tube, then place the adsorption column at room temperature for 10 min until it is completely dried.

[0066] j. Transfer the adsorption column to a new 1.5 mL centrifuge tube, add 50-100 μΐ Buffer GE or sterile water to the inside of the adsorption column, then stand at room temperature for 5 min, centrifuge at 12,000 rpm for 1 min, and collect the DNA solution.

[0067] k. After measuring the concentration of the DNA solution using the Thermo Scientific Nano Drop 2000c (Thermo, USA) instrument, store the DNA at -20°C.

[0068] 1.6 Whole genome re-sequencing data processing

[0069] The genotypes of the GWAS population in this study were sequenced by the MGI-2000 / MGI-T7 sequencing platform of Huada, using whole genome resequencing technology to sequence the soybean genome of 290 natural population materials. The sequencing mode is PE150 mode. A total of 15,049,485 SNP site data were included. Using vcftools

[100] software for quality control, removing sites with minor allele frequency (MAF) less than 0.05, removing sites with heterozygous proportion greater than 30% and deletion rate greater than 30%, finally there are 5,136,169 high-quality SNP sites after quality control, using software BWA to align the clean reads after quality control with the reference genome sequence. The VCF file obtained is analyzed by Structure2.0 for population structure.

[0070] 1.7 Genetic structure analysis of natural population

[0071] The population structure analysis of 290 materials by structure 2.3.4, when the subpopulation number K is 6, the cross-validation error rate (CV error) is at the minimum value. Therefore, the population is divided into 6 subpopulations, and 6 subpopulations respectively contain 55, 61, 19, 67, 70 and 18 materials (such as Figure 1 ).

[0072] 1.8 Genome-wide association analysis

[0073] By using the built-in mixed linear model (MLM) in TASSEL software for GWAS analysis, if the SNP-Log10(p) value reaches or exceeds 4.0, it is considered that the SNP marker is significantly associated with the trait. The Kinship value is estimated by TASSEL software. The Manhattan plot and QQplot plot are drawn by using R software pheatmap package and CMplot package.

[0074] 1.9 Identification of candidate genes

[0075] On the basis of association analysis, in the candidate interval where the significantly associated site is located, based on the gene function annotation in Phytozome database (https: / / phytozome.org) and Soybase database (https: / / www.Soybase.Org), the candidate genes related to soybean isoflavone content are predicted.

[0076] 1.10 InDel marker development and screening

[0077] InDel in the target interval was screened by using natural population whole genome resequencing data, and the base sequence of the region near InDel was downloaded from Phytozome database (https: / / phytozome.org) for primer design. BioXM 2.7.1 software was used to design primers, and the parameters were set as follows: the length of primer was 20-25 bp, the annealing temperature was 55-65℃, the product size was 80-160 bp, the GC content was 40%-60%, the hairpin structure was less than 6, and the primer dimer was less than 8. The designed primers were subjected to BLAST comparison using Phytozome website to ensure that the primers were in the conserved region of DNA sequence and had specificity.

[0078] Primer sequence: FP: TTAAGGCAAATTCTACCGTAAGGC (SEQ ID NO: 3); RP: TTCTAACCAAAAGTGCTGCCAACT (SEQ ID NO: 4).

[0079] 1.11 InDel marker effectiveness verification

[0080] The developed InDel marker primers were used for PCR amplification and agarose gel electrophoresis detection of genomic DNA of 300 soybean materials. The results were read as follows: the same band type of high isoflavone material was recorded as "A", the same band type of low isoflavone material was recorded as "B", and the fuzzy or missing band type was recorded as "-", thereby verifying the effectiveness of InDel marker.

[0081] The total volume of 2×Taq MasterMix (Kangwei) reaction system was 20 µL, and the specific contents were shown in Table 1:

[0082] Table 1 PCR reaction system

[0083] The PCR reaction program was performed by Eppendorf PCR instrument, and the amplification reaction program was shown in Table 2:

[0084] Table 2 PCR amplification reaction program

[0085]

[0086] Agarose gel electrophoresis preparation and detection:

[0087] Gel preparation: Put 6 g of agar powder into a triangular flask, add 1 x TAE 100 mL, mix well, and then heat in a microwave oven for 3-4 min until all the agar powder is dissolved. When the temperature of the agar solution drops, add 1-2 μL of nucleic acid dye, shake well, and then slowly pour into the gel preparation tank to avoid air bubbles. After cooling for 15 min, the gel can be used when it is solidified.

[0088] Loading: Slowly place the solidified gel into the electrophoresis tank, add the corresponding Marker, and then load the samples in order. Connect the power supply and the electrophoresis tank, set the program, and start running the gel.

[0089] Result reading: After the electrophoresis is completed, put on a pair of disposable gloves and place the gel on the gel imaging instrument for development. Take a photo and save the gel image (such as Figures 2-8 ).

[0090] Example 2, Results and Analysis

[0091] 2.1 Statistical analysis of different environmental isoflavone components

[0092] The determination of 6 major soybean isoflavone components and statistical analysis of total isoflavone content in 290 soybean germplasm are shown in Table 3. The average total isoflavone content of the soybean germplasm in three years was 1832.30 μg / g, 1943.83 μg / g, and 1547.14 μg / g. Among the contents of each single component, the average content of malonyl genistin was the highest, with an average content of 726.58 μg / g, 956.05 μg / g, and 678.52 μg / g in three years, and the average content of glycitein was the lowest, with an average content of 95.09 μg / g, 76.73 μg / g, and 104.05 μg / g in three years. The coefficients of variation of the contents of the 6 soybean isoflavone components and the total isoflavone content were 35%-76%, indicating that the population had rich phenotypic variation. The broad-sense heritability of each trait under three environmental conditions was between 49%-71%.

[0093] Table 3 Statistical analysis of soybean isoflavone phenotypes under different environments

[0094]

[0095] 2.2 Whole-genome association analysis of soybean isoflavone components

[0096] GWAS analysis was used to mine associated loci for the total content of soybean isoflavones and each component, and Manhattan Plot and QQ-Plot graphs were drawn accordingly. When LOD≥4, it was considered that the SNP / InDels were significantly associated with the total content of soybean isoflavones and each component (such as Figure 9). A total of 404 SNPs were significantly associated with the total content of isoflavones and the content of 6 components (Table 4). There were 23 significant SNPs for daidzin, mainly distributed on chromosomes 8, 9, 10, 13, 14, and 20, with 6, 2, 5, and 4 significant SNPs on chromosomes 8, 10, 13, and 14, respectively, and 3 significant SNPs on chromosomes 9 and 20. The maximum value of -Log10(P) among these SNPs was 5.2. There were 59 SNPs for genistin located in two years and more than two years, with 34 SNPs located in two years, distributed on chromosomes 3, 10, 12, 13, 14, and 18, and the maximum value of -Log10(P) was 6.2. There were 25 significant SNPs for genistin located in three years, distributed on chromosomes 1, 2, 7, 15, and 20, and the maximum value of -Log10(P) was 6.2. For glycitin, the most significant SNPs were associated, with a total of 133 significant SNPs, distributed on all chromosomes except chromosomes 6, 9, 15, 17, and 19, with 55 significant SNPs on chromosome 18, and the maximum value of -Log10(P) was 7.2. There were 61 SNPs associated in three years, mainly distributed on chromosomes 1, 2, 3, 5, 10, 11, 13, 14, 16, and 20. There were 29 SNPs for malonyl daidzin, mainly distributed on chromosomes 1, 4, 5, 10, 13, 18, and 19, with 7 SNPs associated in three years, all distributed on chromosome 5. There were 6 SNPs for malonyl genistin associated in two years, which was the least significant SNPs among the components, distributed on chromosomes 6 and 17. For malonyl glycitin, the SNPs were distributed on all chromosomes except chromosomes 3, 11, and 20. There were 127 SNPs, with 91 SNPs located in three years, mainly distributed on chromosomes 2, 4, 6, 8, 10, 13, 14, 16, 17, and 18, with the maximum value of -Log10(P) being 8.1. There were 27 SNPs for the total content of isoflavones, mainly distributed on chromosomes 3, 6, 8, 17, 18, and 19, with the 56,734,042-57,223,667 sites on chromosome 18 overlapping with the sites of malonyl daidzin, and repeatedly detected in three years (Table 4). This indicates that it not only exists stably in different environments, but also is an important site for controlling the content of isoflavones in soybeans. Figure 9

[0097] Table 4. Results of association analysis of isoflavone content in natural population

[0098]

[0099] ​Note: * only show the loci that can be detected in all 3 environments

[0100] 2.3 Screening and analysis of soybean isoflavone component-related candidate genes

[0101] In this study, the locus located between the markers Chr18-56,734,042 to Gm18-57,223,667 on chromosome 18 was detected in total soybean isoflavone content and in multiple environments. According to the soybean genome information in the Soybase database (https: / / www.soybase.org / ), it was found that the segment within the locus contained 74 genes. Based on LD distance, we selected the interval of 200 kb upstream and downstream of the marker with the highest P value Chr18-57223667, and used Haploview 4.2 software to perform LD Block on all SNPs in the region and narrow the interval. The interval was narrowed to 107 Kb, and the region contained 29 genes (as shown in Table 4). Figure 10 ).

[0102] 2.4 Prediction of candidate genes

[0103] The prediction results of Phytozome and Soybase databases showed that a total of 5 candidate genes possibly related to soybean isoflavone content were obtained in the locus interval of soybean isoflavone content (Table 5), mainly involving phospholipase 3, class I glutamine transferase superfamily protein, Core-2 / I-branching beta-1,6-N-acetylglucosaminyltransferase family protein, related protein kinase, and peptidyl tRNA hydrolase family protein, etc. Among them, Glyma.18G294500 encodes a related protein kinase, and combined with resequencing data analysis, there is an insertion / deletion mutation containing 72 bases in the gene, which causes great changes in structure and function. Further InDel marker effectiveness identification was performed.

[0104] Table 5 Prediction and functional annotation of soybean isoflavone content candidate genes

[0105]

[0106] 2.5 InDel marker effectiveness detection

[0107] An insertion / deletion mutation (Chr18_57221341: ATCAATTATCCCTTCCCTTCCCAAACCCTTATCTTCCTTGACCGTATCCGCTACAGCAAAAACAACACCAAC (SEQ ID NO: 5) / -) containing 72 bases was found in the Glyma.18G294500 gene by sequencing data analysis, which caused a large change in structure and function. The homologous gene of this gene in Arabidopsis thaliana is AT1G66940.1, and the gene function annotation information shows that the gene protein is related to kinase. The 200 bp base sequences upstream and downstream of InDel-57221341 were used for primer design. The primer sequences are shown in Table 6. PCR amplification and agarose gel electrophoresis detection were performed with 300 soybean DNA as a template. According to the reading and statistical band type, a total of 2 allelic variations were detected Figure 11 ). The predicted amplified band size in Willams82 is 544 bp, and the subsequent PCR electrophoresis results of this type are marked as "A", and the sequence is shown in SEQ ID NO: 1 of the sequence listing; the amplified band size of the variant material is 472 bp, and the subsequent PCR electrophoresis results of this type are marked as "B", and the sequence is shown in SEQ ID NO: 2 of the sequence listing. Among them, 145 soybean resources have 544 bp allelic variation, and 126 soybean resources have 472 bp allelic variation. The occurrence rate of 544 bp allelic variation is 48.33%, the frequency of 472 bp allelic variation is 42%, and there are 29 ambiguous or missing bands.

[0108] Table 6 Primer sequences of InDel markers

[0109]

[0110] The marker was used for typing in a natural population, and the population was divided into two subpopulations. As shown in Table 7, the isoflavone content of the 145 "A" band type corresponding materials was 550.38 µg / g-4668.57 µg / g, and the average was 1923.46 µg / g; the isoflavone content of the 126 "B" type corresponding materials was 456.06 µg / g-4484.02 µg / g, and the average was 1674.24 µg / g. Statistical analysis showed that in the continuous three years and the average of three years, the isoflavone content of the materials containing A band type was significantly higher than that of B band type materials (such as Figure 12 ). It is shown that the marker can be used to assist in screening high isoflavone soybean offspring materials.

[0111] Table 7 Isoflavone content and average phenotype data of natural population in 2021-2023

[0112] Sample No. Label Band Pattern 2021 2022 2023 Three Year Average 1 A 1918.79 1740.74 1070.07 1576.54 2 B 1209.34 726.76 971.88 969.32 3 B 1098.56 862.90 587.05 849.50 4 B 1634.65 771.81 854.21 1086.89 5 B 1710.12 646.68 938.47 1098.43 7 B 1209.31 854.17 1526.81 1196.76 8 B 1205.63 960.87 933.67 1033.39 9 B 1149.06 520.23 628.61 765.97 10 B 1533.98 947.88 561.19 1014.35 11 B 1200.11 1236.76 879.87 1105.58 12 B 2226.02 1549.76 1171.13 1648.97 15 A 1201.21 1167.78 NA 1184.49 16 B 920.58 456.07 696.67 691.11 17 A 575.91 858.72 1957.24 1130.62 18 B 1260.88 943.58 911.66 1038.71 19 B 2071.36 1776.25 1832.38 1893.33 20 A 1857.54 1678.77 1713.86 1750.06 22 A 1491.24 1697.85 1850.78 1679.95 23 B 1544.13 873.93 692.04 1036.70 24 B 1046.81 1553.74 852.11 1150.89 25 B 1214.22 844.06 955.45 1004.58 26 B 1597.99 1794.96 1616.85 1669.94 27 A 1408.83 1427.98 1188.67 1341.82 28 A 1358.89 2197.27 1307.68 1621.28 29 A 2095.73 3030.96 1888.76 2338.48 30 A 1663.28 2005.60 1464.71 1711.19 32 B 1574.65 1923.37 1613.56 1703.86 33 B 1474.83 1941.58 1240.74 1552.39 34 A 858.37 1076.61 493.87 809.62 36 B 1279.96 1943.16 1477.40 1566.84 37 B 860.47 1045.84 756.79 887.70 39 A 1346.00 2015.99 1091.82 1484.60 40 A 905.70 992.96 1184.14 1027.60 41 B 951.49 1564.70 1062.23 1192.80 42 B NA 803.46 686.84 745.15 44 B 1294.80 1736.53 1520.85 1517.39 45 A 860.71 1291.64 736.19 962.85 46 B 1033.64 1520.56 533.69 1029.30 47 B 2142.82 2645.21 2386.51 2391.51 48 A 1334.66 2192.37 1594.94 1707.32 49 A 1638.51 2703.63 971.18 1771.11 50 A 1140.67 1545.89 1319.33 1335.30 51 B 1298.30 1050.25 1046.66 1131.74 52 A 2639.95 2336.99 1720.43 2232.46 53 A 2575.21 4668.57 2761.08 3334.95 54 A 1897.46 3147.01 2140.26 2394.91 55 A 995.56 1773.18 909.96 1226.24 56 A 2396.86 2619.74 2292.09 2436.23 57 A 2449.20 2824.14 1632.41 2301.92 58 A 3372.17 2069.44 2098.77 2513.46 59 A 1828.40 2744.15 1822.12 2131.56 60 A 1559.96 2977.84 1462.68 2000.16 61 B 1076.83 1583.78 859.89 1173.50 62 A 1171.15 2141.96 1526.81 1613.30 63 A 3237.47 2630.42 896.42 2254.77 65 A 1939.02 1583.76 1558.58 1693.79 66 B 993.74 1182.56 1674.30 1283.53 67 A 1489.33 2448.96 1545.23 1827.84 68 A 1812.95 2876.17 1485.10 2058.07 69 A 1377.76 2339.00 1420.24 1712.33 70 B 3147.05 2679.83 1897.55 2574.81 71 A 1459.66 1546.00 1199.22 1401.63 72 B 2194.25 1426.71 1364.41 1661.79 73 A 1361.82 1441.51 1172.64 1325.32 74 A 1271.37 1824.95 1174.85 1423.72 75 B 2643.21 2424.90 2928.47 2665.53 76 A 1525.32 2258.17 1516.10 1766.53 77 B NA NA NA NA 78 A 2563.23 2046.07 1764.00 2124.43 79 B 2047.07 2365.62 2189.37 2200.69 80 B 1420.80 1840.21 3087.45 2116.15 81 A 2222.79 2350.62 1760.98 2111.46 83 B 1332.90 1581.57 1307.50 1407.32 84 B 906.55 1552.92 869.71 1109.73 85 B 1287.99 1815.92 1653.92 1585.94 86 B 1899.94 2561.58 1139.55 1867.02 87 B 933.05 940.46 768.41 880.64 88 B 3993.40 4484.02 3360.49 3945.97 89 A 2688.86 1897.19 2263.96 2283.34 90 A 2610.35 1885.74 1222.22 1906.10 91 B 1693.74 1294.07 2477.18 1821.66 92 B 1794.09 2319.52 1499.18 1870.93 93 A 761.79 1453.92 876.82 1030.85 94 A 2305.16 1973.49 1477.71 1918.79 95 A 1836.44 1874.65 NA 1855.55 96 A 1801.62 1896.66 1839.72 1846.00 97 B 1620.29 1874.08 1591.17 1695.18 98 A 736.69 1176.08 844.98 919.25 99 A 2884.71 2015.16 1848.18 2249.35 100 B 2665.68 2418.27 NA 2541.97 102 B 1070.77 1105.50 450.11 875.46 103 A 1439.03 1653.10 1001.62 1364.58 104 B 1636.31 2213.02 945.50 1598.28 105 B 1483.85 1475.59 NA 1479.72 106 B 1745.17 3091.48 2676.86 2504.50 107 A 1592.76 2021.86 1580.75 1731.79 108 B 1428.37 1422.39 1175.09 1341.95 109 B 1348.83 1219.05 567.71 1045.20 111 A 1451.94 1707.86 1583.77 1581.19 112 A 1134.67 1563.94 1538.56 1412.39 113 A 1303.10 1183.91 1294.62 1260.54 114 B 2744.63 2028.11 2346.77 2373.17 115 A 1332.63 2028.11 NA 1680.37 116 B 1101.29 1304.21 2310.01 1571.84 117 A 1787.32 1996.26 1802.87 1862.15 118 B 2274.72 2024.46 2424.81 2241.33 119 B 1717.69 1651.61 1871.89 1747.06 120 A 1616.79 2463.60 2080.13 2053.51 121 A 909.26 2268.18 1513.21 1563.55 122 B 1451.94 1607.49 1232.83 1430.76 123 A 1440.18 2133.71 1588.48 1720.79 124 A 2083.02 2373.27 1643.46 2033.25 125 B 924.30 1438.35 767.97 1043.54 127 B 1573.57 NA NA 1573.57 128 A 1428.17 1776.52 2182.11 1795.60 129 A 1926.15 3122.51 2341.73 2463.46 130 A 2224.52 2067.27 2048.70 2113.50 131 A 1412.75 1510.50 1684.84 1536.03 132 A 1260.71 1897.55 1095.52 1417.93 133 A 4137.60 2442.27 1891.23 2823.70 134 B 1162.39 1485.10 1211.46 1286.32 135 A 1885.89 2249.69 1561.33 1898.97 136 A 3687.39 1490.67 2306.33 2494.80 137 B 947.34 1458.32 1180.00 1195.22 138 A 1508.35 2028.37 1537.18 1691.30 139 B 2273.89 2805.63 NA 2539.76 140 A 2465.65 2099.43 1838.25 2134.44 142 A 1473.45 1654.52 1706.70 1611.55 144 A 1553.95 1663.28 1684.66 1633.96 145 B 2629.49 3003.29 2388.46 2673.75 146 B 1771.79 2215.70 2739.71 2242.40 147 A 1468.42 1918.87 1360.01 1582.43 148 A 1803.65 1254.42 1048.94 1369.00 149 B 1402.56 1952.24 1275.67 1543.49 150 A 1019.55 2058.17 788.76 1288.82 151 A 1714.09 2290.75 1740.54 1915.13 153 B NA 1967.08 NA 1967.08 154 A 1683.87 1889.93 919.69 1497.83 155 B 1842.59 2334.15 1774.56 1983.77 156 A 1277.39 1842.10 1348.51 1489.33 157 A NA 1912.71 2124.69 2018.70 158 A 1311.88 2931.72 2343.26 2195.62 159 A 1619.67 3213.59 1777.75 2203.67 160 A 1756.34 1859.79 2039.34 1885.16 161 A 2456.21 2477.16 2506.62 2480.00 162 A 1739.67 1890.89 1848.64 1826.40 163 B 3552.55 3358.14 1429.05 2779.91 164 B 1315.48 2395.74 1664.90 1792.04 165 A 1260.52 956.67 1319.43 1178.87 166 A 1642.32 2291.82 1458.03 1797.39 167 A 1672.43 2230.25 1736.89 1879.85 168 A 1636.29 1933.69 2036.54 1868.84 169 A 1442.62 1739.72 1449.74 1544.03 170 A 2295.18 2300.59 1472.39 2022.72 172 A 2788.45 2738.36 2540.83 2689.21 173 A 2136.82 2275.71 1613.03 2008.52 174 A 2036.53 2184.96 1962.13 2061.21 176 A 1833.51 2483.79 1654.75 1990.69 177 A 1741.83 1661.63 1769.72 1724.39 178 B NA NA NA NA 179 B 957.25 934.71 1132.75 1008.24 182 B 2359.30 2478.28 2591.43 2476.34 183 B 1661.78 1113.74 2254.20 1676.58 184 A 2447.91 2073.72 2017.00 2179.55 185 A 1853.36 2040.19 1343.60 1745.71 186 A 1698.44 1416.83 NA 1557.63 187 A 1401.34 1934.45 3143.35 2159.71 188 B 3229.47 3601.23 2837.29 3222.66 189 A 1805.54 1923.06 747.93 1492.17 190 B 1405.30 1620.56 1962.94 1662.93 191 B 774.84 1180.49 577.79 844.37 192 A 3034.41 1252.77 2544.36 2277.18 193 A NA 2061.59 1295.82 1678.71 194 B 1967.37 2282.69 1430.12 1893.39 195 B 1487.56 1461.77 1342.74 1430.69 196 A 1958.42 2700.86 1990.91 2216.73 197 B 1878.12 2709.04 2652.04 2413.06 198 A 2017.74 2687.59 1466.94 2057.42 199 B 1442.79 1727.53 1428.40 1532.91 200 B 1779.25 1808.04 1111.97 1566.42 201 B 1831.02 2023.79 900.44 1585.08 202 B 1357.09 1499.09 642.41 1166.19 203 A NA 1387.34 1565.70 1476.52 204 B 2548.22 2344.31 2447.18 2446.57 205 A 2102.35 2098.87 1858.26 2019.82 206 B 2172.67 1197.05 1655.97 1675.23 207 A 2374.64 1684.77 1865.43 1974.95 208 B 1700.40 1711.35 1224.09 1545.28 209 B 1508.69 1325.23 1475.72 1436.54 210 B 1113.15 956.04 898.26 989.15 211 B 3385.35 3709.61 3383.61 3492.86 212 A 1963.87 1582.61 2580.18 2042.22 213 B 1642.88 1922.13 NA 1782.50 214 A 2703.91 2299.33 2775.14 2592.79 215 A 1895.67 1575.79 1476.80 1649.42 216 A 1714.44 1689.63 2382.11 1928.73 217 B 1493.27 1772.94 668.95 1311.72 218 A 2735.61 2052.83 2061.22 2283.22 219 A 1713.58 1753.79 2034.16 1833.84 220 A 2019.68 2204.74 3172.54 2465.65 221 B NA NA NA NA 222 B 2203.07 1435.69 1019.85 1552.87 223 A 2256.20 1031.27 1182.98 1490.15 224 B 2030.90 913.83 844.40 1263.04 225 B 2311.51 1351.39 1575.76 1746.22 226 A 3652.62 1657.15 2021.72 2443.83 228 A NA 1876.48 2209.57 2043.02 229 B 2102.19 NA NA 2102.19 230 B 3136.15 1536.33 2696.05 2456.18 231 A 3768.20 1604.43 1720.62 2364.41 232 A 3027.36 3050.50 1503.44 2527.10 233 B 1914.42 2237.43 NA 2075.93 234 A 2115.72 1417.94 3183.21 2238.96 235 A 2410.15 2116.72 NA 2263.43 236 A 2302.80 1916.15 1806.14 2008.36 237 B 1896.73 1963.15 1765.18 1875.02 238 B 2608.68 1267.87 530.89 1469.15 239 B 3235.12 1110.89 1112.40 1819.47 240 B 4191.16 2275.83 2735.71 3067.57 241 A 1926.20 1781.38 1557.84 1755.14 242 A NA 1393.67 1375.14 1384.41 243 A 2177.79 1012.41 1259.52 1483.24 244 A 1873.99 2513.66 1985.27 2124.30 245 A 3372.90 1423.09 1545.98 2113.99 246 B 1724.25 1680.71 1202.44 1535.80 248 B 3490.49 1733.25 1856.48 2360.07 249 A 3052.53 2183.45 NA 2617.99 250 A 1421.43 1143.81 719.01 1094.75 251 B 3019.16 1863.74 2185.37 2356.09 252 B 2352.07 2165.92 2018.27 2178.75 253 B 2101.04 NA NA 2101.04 254 A 2465.18 1358.45 2008.45 1944.03 255 B 2428.43 1890.49 1390.26 1903.06 256 A 1881.56 NA NA 1881.56 257 A 2550.35 1783.63 2107.58 2147.19 258 A 1758.92 1676.10 710.66 1381.89 259 A 2378.78 762.30 1289.82 1476.97 260 B NA 1074.97 746.81 910.89 261 B 3301.58 2541.64 1509.02 2450.75 262 A 1471.90 1102.59 NA 1287.24 263 A 1340.71 550.38 764.70 885.26 264 A 1511.99 637.02 NA 1074.50 265 B NA 1136.82 1101.92 1119.37 266 A 2996.83 2197.75 1989.55 2394.71 267 A 2099.83 871.58 983.35 1318.25 268 A 2077.01 872.45 NA 1474.73 269 A 1540.75 781.48 959.49 1093.91 270 B 3012.72 2566.72 2721.79 2767.08 273 A 3185.45 3057.15 801.75 2348.12 274 B 1776.06 976.29 931.18 1227.84 275 A 3296.10 2666.44 2853.34 2938.63 276 B 1632.12 813.20 Figure 12 1222.66 277 B 1672.53 985.69 1840.33 1499.52 278 B 1960.98 1365.97 766.45 1364.47 279 B 2252.06 1383.45 776.25 1470.59 280 B 2052.43 1544.71 876.85 1491.33 281 B 1771.17 1194.57 669.33 1211.69 282 B 1177.75 1060.63 ​ 1119.19 283 A 3342.14 2197.13 1963.40 2500.89 285 B 2781.39 2042.55 2546.83 2456.92 286 A 1283.63 712.19 369.81 788.54 287 A 2323.15 946.56 1236.75 1502.15 288 B 2020.73 1358.79 474.45 1284.66 289 B 1933.25 828.34 820.82 1194.13 290 B 2275.50 1459.76 1683.91 1806.39 291 B 1692.05 1235.73 1231.09 1386.29 293 B 1822.20 1110.26 1317.09 1416.52 294 A 1835.71 1212.81 1554.45 1534.32 298 A 2432.44 2307.63 1345.21 2028.42 299 B 1458.18 1069.04 889.54 1138.92 300 A 2523.54 1995.33 1264.48 1927.79

[0113] As ​ As shown in Table 7 and Table 8, combined with the results of the phenotype data, it is shown that the average isoflavone content of the material with the band type A in 2021 is 1935.11; the average isoflavone content of the material with the band type B is 1830.48; the average isoflavone content of the material in group A is greater than that of the material in group B, but does not reach a very significant level. The average isoflavone content of the material with the band type A in 2022 is 1919.53; the average isoflavone content of the material with the band type B is 1666.27; there is a very significant difference between group A and group B, and the P value is 0.002. The average isoflavone content of the material with the band type A in 2023 is 1637.24; the average isoflavone content of the material with the band type B is 1450.82; there is a significant difference between group A and group B, and the P value is 0.0208.

[0114] Table 8: Results of correlation analysis of isoflavone content of natural population in 2021-2023

[0115]

[0116] The marker can effectively distinguish the two genetic marker band types, has the feature of codominance; the marker can be used to assist in screening soybean offspring materials with high isoflavone content.

[0117] Although the embodiments of the present application have been shown and described, it can be understood by those skilled in the art that various changes, modifications, replacements and variations can be made to these examples without departing from the principles and spirits of the present application, and the scope of the present application is defined by the appended claims and their equivalents.

[0118] In the above embodiments, the description of each embodiment has its own focus, and the parts not described or recorded in a certain embodiment can be referred to the related description of other embodiments.

[0119] The above-described embodiments are only used to illustrate the technical solutions of the present application, rather than limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacements to some technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirits and scopes of the technical solutions of the embodiments of the present application, and should be included in the protection scope of the present application.

Claims

1. A specific primer pair for detecting an InDel molecular marker, characterized in that, The InDel molecular marker is located at the site of 57221341-57221412 of chromosome 18 of soybean genome version Glycine_max_Wm82.a2.v1, and contains a 72 bp insertion / deletion mutation, wherein the high isoflavone content material carries a type A allele containing a 72 bp insertion fragment, and the low isoflavone content material carries a type B allele lacking the fragment; the nucleotide sequence of the type A allele is shown as SEQ ID NO: 1, and the nucleotide sequence of the type B allele is shown as SEQ ID NO: 2; the upstream primer sequence is shown as SEQ ID NO: 3; and the downstream primer sequence is shown as SEQ ID NO:

4.

2. A kit for detecting the content of soy isoflavones, characterized in that, The specific primer pair of claim 1.

3. A method for detecting the content of soybean isoflavones, characterized by, The method comprises the following steps: (1) using the DNA of the soybean material to be tested as a template, performing PCR amplification on the InDel molecular marker primers to obtain a PCR amplification product; the primers comprise an upstream primer and a downstream primer, wherein the sequence of the upstream primer is shown as SEQ ID NO: 3; and the sequence of the downstream primer is shown as SEQ ID NO: 4; (2) performing agarose gel electrophoresis detection on the amplification product, and observing the electrophoresis detection result; when the length of the amplification product is 544 bp, the gene marker band type of the soybean to be tested is type A; when the length of the amplification product is 472 bp, the gene marker band type of the soybean to be tested is type B; and the high and low isoflavone content is: the soybean with the gene marker band type of type A is greater than or candidate for the soybean with the gene marker band type of type B.

4. The method of claim 3, wherein, The reaction procedure of the PCR amplification is pre-denaturation at 95℃ for 3 min; 95℃ for 30 s, 52℃ for 30 s, 72℃ for 30 s, 33 cycles; and extension at 72℃ for 5 min.

5. A method for breeding soybean varieties with high isoflavone content, characterized in that, The method comprises the following steps: 1) detecting the InDel-57221341 marker genotype of the parent or hybrid offspring by using the specific primer pair of claim 1; 2) preferentially selecting the material carrying the type A allele as a breeding parent or a single plant selected in the middle; 3) obtaining a soybean variety with high isoflavone content by combining field trait evaluation.

Images