Kit set for household nucleic acid self-inspection of HPV16 and application

Through a one-tube CRISPR/Cas12a system combined with RPA amplification primer pairs and fluorescently labeled reporter DNA, the complex and false positive problems of existing HPV detection methods are solved, and high sensitivity and high specificity of home HPV detection is achieved.

CN120384153APending Publication Date: 2025-07-29FIRST HOSPITAL AFFILIATED TO GENERAL HOSPITAL OF PLA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510297975.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-13
Publication Date
2025-07-29

AI Technical Summary

Technical Problem

The existing HPV detection methods require complex instruments and a long time, making it difficult to conduct quick and easy detection by the bedside, and there are false positive problems caused by aerosol contamination, which affects the detection accuracy.

Method used

A one-tube CRISPR/Cas12a system was used to combine RPA amplification primer pairs and sgRNA to prepare a complete kit for detecting HPV, including RPA amplification primer pairs, Cas12a proteins and fluorescently labeled reporter DNA, and the presence of HPV was judged by fluorescent signals.

Benefits of technology

It realizes high sensitivity and specificity detection of HPV nucleic acids, with a single copy of 1.2copies/μL, which is suitable for home testing and has good application prospects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005310631260000031
    Figure BDA0005310631260000031
  • Figure BDA0005310631260000041
    Figure BDA0005310631260000041
  • Figure BDA0005310631260000051
    Figure BDA0005310631260000051
Patent Text Reader

Abstract

The invention discloses a complete set of reagents and a kit for rapidly detecting HPV16 through a one-tube method, and belongs to the technical field of molecular biology, the complete set of reagents comprises an RPA primer pair, sgRNA and Cas12a protein, the RPA primer pair is composed of two single-stranded DNA, and a target sequence of the sgRNA is composed of a part of fragments of an HPV16 genome. According to the invention, high-sensitivity and high-specificity detection of HPV nucleic acid can be realized, the sensitivity reaches 1.2 copies / [mu] L, and the method has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a detection kit, specifically a nucleic acid rapid detection kit for HPV 16. Background Art

[0002] Human papillomavirus (HPV) is a group of sexually transmitted circular double-stranded DNA (dsDNA) viruses. They can be roughly divided into low-risk (LR) and high-risk (HR) subtypes. Most LR HPVs do not cause diseases, while HR HPVs can cause various cancers, such as genital cancer, anal cancer or oral cancer. HPV 16 and HPV 18 are two of the most lethal and common HR HPV subtypes, which cause approximately 70% of cervical cancers globally. HPV (16 / 18) helps in the early detection of precancerous cell changes, which can then be appropriately treated to prevent the development of cancer. To date, various HPV detection methods have been developed in the medical field. Among them, quantitative polymerase chain reaction (qPCR) is the most commonly used method for HPV infection detection. However, qPCR relies on complex instruments and a long assay time, which seriously affects the popularization and application of this method.

[0003] In recent years, CRISPR-based diagnostics (CRISPR-Dx) technology has attracted extensive attention in the biomedical field. Under the guidance of CRISPR-associated RNA (crRNA), the CRISPR-Cas system can be activated by relevant targets, resulting in specific cleavage of the target sequence (cis cleavage). At the same time, some Cas proteins (Cas12, Cas13, Cas14) have the additional ability to cleave surrounding non-specific DNA or RNA. For example, Cas12a (also known as Cpf1) has been widely used in the testing of various pathogens, relying on its trans-cleavage property to cleave fluorescently labeled single-stranded DNA (ssDNA) or higher-order DNA structures to achieve signal amplification and result reading. Although the CRISPR-Dx platform is superior to the qPCR method in terms of detection specificity, sensitivity and convenience, the traditional CRISPR / Cas system needs to be combined with LAMP / RPA / RT-RPA technology for post-amplification detection. Although this method does not rely on large instruments, it is prone to aerosol contamination, resulting in false positive results, reducing the detection accuracy, and is also difficult to popularize and apply.

[0004] Therefore, there is still a need for a rapid nucleic acid detection solution for HPV 16 that can be performed at the bedside. Summary of the Invention

[0005] In order to solve the deficiencies of the prior art, the present invention proposes a complete kit solution for home nucleic acid self-testing of HPV 16, which can rapidly and simply perform nucleic acid detection of HPV at home.

[0006] The technical problem to be solved by the present invention is achieved through the following technical solutions:

[0007] A set of reagents includes an RPA amplification primer pair, a single-tube CRISPR / Cas12a sgRNA sequence, and a single-tube detection reaction system. The RPA amplification primer pair consists of two single-stranded DNAs of Sequence 2 and Sequence 3. The target sequences of the sgRNA are positions 1-20 of Sequence 4 and positions 42-61 of Sequence 5 in the HPV 16 genome. Among them, Sequence 2 is AGGAACATCCAGACTACTTGCAGTTGGACA, Sequence 3 is CTAATGGCTGACCACGACCTACCTCAACAC, Sequence 4 is TAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATAAAAACCTAACAATAACAAA, and Sequence 5 is TTTGTTATTGTTAGGTTTTTATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA.

[0008] In the present invention, the sequence of the sgRNA is an RNA molecule obtained by annealing or PCR amplification of Sequences 4 and 5 followed by transcription and purification.

[0009] In the present invention, the set of reagents further includes Cas12a protein.

[0010] In the present invention, the set of reagents is used for preparing a product for detecting or assisting in detecting HPV, and the product is a kit or a test strip.

[0011] A kit includes the above set of reagents, as well as other reagents for specifically amplifying the HPV target sequence and / or other reagents for detecting the amplification product of the RPA primer.

[0012] In the present invention, the other reagents for specifically amplifying the HPV target sequence are reagents required for RPA. The other reagents for detecting the amplification product of the RPA primer include Lba Cas12a protein, NTP Mix, T7 RNA polymerase, RNase inhibitor, MgCl2 solution, HEPES buffer, and reporter DNA. The reporter DNA consists of FAM-TTATTATT-BHQ1 / Biotin, with a fluorescent gene labeled at its 5' end and a quenching group labeled at its 3' end.

[0013] In the present invention, the kit is used for detecting or assisting in detecting whether the sample to be tested contains HPV.

[0014] Among them, the sample to be tested is one or more of cervical exfoliated cells, vaginal secretions, and cervical tissues.

[0015] A method for detecting HPV includes the step of using the above-mentioned kit of reagents to detect the sample to be tested, specifically including: amplifying the target nucleic acid with RPA primers, then detecting with the sgRNA, and judging whether HPV is contained by detecting the fluorescence signal. The detection is carried out at 37°C.

[0016] Compared with the prior art, the product prepared by the present invention realizes highly sensitive and highly specific detection of human papillomavirus nucleic acid, with a sensitivity reaching 1.2 copies / μL of single copy, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is the schematic diagram of the one-tube method for detecting HPV 16 in this application;

[0018] Figure 2 It is the screening electrophoresis diagram of the RPA primer pair in this application;

[0019] Figure 3 It is the screening of the one-tube method sgRNA in this application;

[0020] Figure 4 It is the comparison of the optimized conditions of the one-tube method system in this application;

[0021] Figure 5 It is the sensitivity test result of the one-tube method detection system in this application;

[0022] Figure 6 It is the specificity test result of the one-tube method detection system in this application;

[0023] Figure 7 It is the clinical trial result of the one-tube method detection system in this application. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0024] In order to more clearly elaborate the technical solutions and implementation effects of the present invention, the present invention will be further described in detail below with reference to specific embodiments. However, the protection scope of the present invention is not limited to these embodiments.

[0025] In the experimental methods of the following examples, unless otherwise specified, they are all conventional methods, carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. In the quantitative tests in the following examples, three repeated experiments are set, and the results are averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence list is the 5'-terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3'-terminal nucleotide of the corresponding DNA / RNA.

[0026] Example 1

[0027] Preparation and screening of sgRNA and RPA primers for detecting HPV 16

[0028] 1. Preparation of HPV plasmid standard

[0029] The name of the constructed plasmid standard is Plasmid-HPV 16. Plasmid-HPV 16 is a recombinant plasmid obtained by inserting the following nucleic acid sequence from the human papillomavirus genome (sequence 1 in Table 1) into the multiple cloning site of the pSMART-LC vector. Plasmid-HPV 16 was dissolved with deionized water to obtain a standard plasmid solution, and the plasmid concentration in this solution was 1.2×10 10 copies / μL. The pSMART-LC vector was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0030] Table 1 Artificially synthesized HPV 16 plasmid sequence

[0031]

[0032] 2. Preparation of RT-RAA amplification primers

[0033] Specific primers for RPA were designed for subsequent one-tube method (RPA-CRISPR / Cas12a) detection. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the specific sequences are shown in Table 2.

[0034] Table 2 RPA primers for detecting HPV 16

[0035] Name 5’-3’ RPA F1 CTGTCCCAGTATCTAAGGTTGTAAGCACGG RPA F2 GGTTGTAAGCACGGATGAATATGTTGCACG RPA F3 AGGAACATCCAGACTACTTGCAGTTGGACA (Sequence 2) RPA R1 CTAATGGCTGACCACGACCTACCTCAACAC (Sequence 3) RPA R2 CCACACCTGCATTTGCTGCATAAGCACTAG

[0036] The sequence locus count in the table refers to the gene locus information of the reference strain (GenBank ID: MG848266.1)

[0037] 3. Preparation of sgRNA

[0038] In this example, four sgRNAs for detecting HPV 16 were prepared, namely Sub-sgRNA1, Sub-sgRNA2, Sub-sgRNA3, and Sub-sgRNA4. They were obtained by transcribing the annealing products of DNA fragments of Sub-sgRNA F1, Sub-sgRNA F2, Sub-sgRNA F3, Sub-sgRNA F4, Sub-sgRNA R1, Sub-sgRNA R2, Sub-sgRNA R3, and Sub-sgRNA R4 (F, forward; R, reverse). The sequences of each DNA fragment are shown in Table 3.

[0039] Table 3 Partial sgRNA Sequences for CRISPR / Cas12a Gene Editing

[0040]

[0041] Example 2

[0042] Establishment of a One-Tube Method (RPA-CRISPR / Cas12a) for Detecting HPV

[0043] 1. Scheme Design

[0044] In this example, the target nucleic acid was amplified using RPA primers, and the four sgRNAs (Sub-sgRNA1, Sub-sgRNA2, Sub-sgRNA3, and Sub-sgRNA4) obtained in Example 1 were used for detection. The fluorescence signal intensities of different sgRNAs were compared, and the sgRNA with the strongest fluorescence signal was selected as the subsequent detection sgRNA. Detection was carried out according to the steps and principles in Figure 1 , the reaction was carried out at 37°C, and the fluorescence value was read once per minute by a fluorescence quantitative PCR instrument. The specific steps were as follows:

[0045] 1.1 Screening of RPA Primers

[0046] Using the plasmid standard as a template, amplification was carried out using the RPA primers of Example 1 to obtain RPA amplification products. The RPA system is shown in Table 4, where A Buffer and B Buffer are both reagents in the RPA amplification kit. The RPA kit is a product of AmpFuture Biotechnology Co., Ltd., catalog number: WLB8201. The sequences of HPV-F1 / 2 / 3 (forward primers) and HPV-R1 / 2 (reverse primers) are shown in Table 2. The forward and reverse primers were combined in pairs to form 6 primer pairs, and one primer pair was used in each system.

[0047] Table 4 RPA Reaction System

[0048] Name Dosage / Volume / μL Standard plasmid solution of Example 1 4 HPV-F (10 μM) 2 HPV-R (10 μM) 2 A Buffer 29.4 Enzyme-free water 10.1 B Buffer 2.5 Total 50

[0049] Add a mixed solution of 47.5 μL of the first five components to the basic reaction unit containing the lyophilized powder to fully redissolve and homogenize the lyophilized powder. Add 2.5 μL of B Buffer to the cap of each reaction tube, invert and mix the reaction tubes 8 - 10 times, and then place them at 37 °C for reaction for 30 min to obtain the RPA product. Prepare a 1.5% agarose gel for electrophoresis detection with a voltage U = 180 V, current I = 160 mA, and time T = 45 min. The results are as Figure 2 shown. Observe the electrophoresis bands. The primer pair with the best amplification efficiency for RT - RAA is the primer pair of F3R1, that is, the primer pair composed of HPV - F3 and HPV - R1.

[0050] 1.2 Screening of sgRNA in the one - tube detection system

[0051] Use the selected F3R1 primer pair to prepare the RPA system. Take 18 μL of the mixed solution containing the FER1 primer pair, and prepare the products of New England Biolabs (NEB) of the United States, Lba Cas12a, 10×NEBuffer 2.1 biological buffer, RNase inhibitor, Sub - sgRNA1, Sub - sgRNA2, Sub - sgRNA3, Sub - sgRNA4 prepared in Example 1, and the reporter DNA molecule FAM - TTATTATT - BHQ1 / Biotin to construct the CRISPR / Cas12a system detection system. Each system uses one sgRNA, and use ultrapure water to replace crRNA to set up the negative control group system (NC), as shown in Table 5.

[0052] Table 5 CRISPR / Cas12a system detection system

[0053]

[0054]

[0055] Put the prepared one - tube detection system into the fluorescence quantitative PCR instrument, detect the change of fluorescence signal in the FAM channel, set the reaction at 37 °C for 40 min, and collect the fluorescence value once every 1 min. The results are as Figure 3 shown. Use 1×10 5 copies / μL of the HPV template for RPA amplification, and use the amplification product for fluorescence - based CRISPR detection and screen sgRNA. The results are as Figure 6 shown. At 30 min of CRISPR detection, Sub - sgRNA 1 - 4 can all produce fluorescence signals, and the fluorescence signal intensity of sub - sgRNA1 is the highest. In this screening experiment, Sub - sgRNA1 with the highest fluorescence value is selected as the pre - selected target sgRNA for the HPV one - tube method.

[0056] 1.3 Optimization of Key Components in the One-Tube Detection System

[0057] The reaction volume of the one-tube detection system is 40 μL, which contains 25 - 100 nM Lba Cas12a, 400 - 1000 nM FAM-TTATTATT-BHQ1 / Biotin, 25 - 200 nM sgRNA, 10×NEBuffer 2.1 diluted 5 - 25 times, and 18 μL RPA mixture. Set up several sets of parallel gradient concentration reaction systems for detection experiments. Add 2.5 μL B Buffer and 5 μL amplification template to each single-tube reaction system. Through the fluorescence quantitative PCR instrument, detect the change of fluorescence signal in the FAM channel, set the reaction at 37 °C for 40 min, and collect the fluorescence value every 1 min. The results are as Figure 4 shown. The final working concentrations of Cas12a, sgRNA, ssDNA probe and NEBuffer in the optimization of this one-tube detection system are 50 nM Cas12a, 100 nM sgRNA, 1 μM ssDNA probe and 10×NEBuffer 2.1 diluted 25 times, respectively.

[0058] Example 3

[0059] Verification of the One-Tube (RPA-CRISPR / Cas12a) Method for Detecting HPV

[0060] 1. Sensitivity Test

[0061] Gradually dilute the standard plasmid solution (plasmid concentration is 1.2×10 10 copies / μL) obtained in Example 1 to obtain standard plasmid solutions with plasmid concentrations of 1.2×10 5 , 1.2×10 4 , 1.2×10 3 , 1.2×10 2 , 1.2×10 1 , 1.2×10 0 , 1.2×10 -1 (copies / μL). Take each plasmid solution as a template and detect it according to the optimized one-tube detection system of Example 2, with the HPV qPCR detection system as a comparison. The reaction volume of HPV qPCR is 40 μL, which contains 36 μL qPCR mixture and 4 μL amplification template. The reaction denatures at 94 °C for 2 min, and then undergoes 40 cycles as follows: heat up to 93 °C and hold for 10 s, cool down to 62 °C and hold for 31 s. The results are as Figure 5As shown, the fluorescence values detected by the one-tube method and the test strip (the test strip is from Tolo Harbour Biotechnology Co., Ltd., product number: 31203-01) show that the sensitivity of detecting HPV 16 is consistent with the qPCR test result, both being 1.2×10 0 copies / μL. When the template concentration is lower than 1.2×10 0 copies / μL, no positive results were detected by all three methods.

[0062] 2. Specificity test

[0063] Using the pathogen nucleic acids of human papillomavirus type 16 (HPV 16), human immunodeficiency virus (HIV), hepatitis B virus (HBV), Ebola virus (EBOV), respiratory syncytial virus (RSV), and tick-borne encephalitis virus (TBEV) as templates, and nuclease-free water as the negative control template, different virus nucleic acids were detected according to the method for detecting HPV by the one-tube method in Example 2 to determine the specificity of this method. Among them, the pathogen nucleic acid of human papillomavirus type 16 (HPV 16) is the HPV 16 genome (GenBank ID: MG848266.1); the pathogen nucleic acid of human immunodeficiency virus (HIV) is the HIV-1 genome (GenBank ID: K03455.1); the pathogen nucleic acid of hepatitis B virus (HBV) is the HBV genome (GenBank ID: NZ-003977), recorded in the literature DOI number: 10.13350 / j.cjpb.210201; the pathogen nucleic acid of Ebola virus (EBOV) (GenBank ID: AF086833.2), recorded in the literature DOI number: 10.13350 / j.cjpb.210201; the pathogen nucleic acid of respiratory syncytial virus (RSV) (GenBank ID: PP781401.1), recorded in the literature DOI number: 10.3390 / v16010111; the pathogen nucleic acid of tick-borne encephalitis virus (TBEV) (GenBank ID: NC-001672.1), recorded in the literature DOI number: 10.13350 / j.cjpb.210201.

[0064] Using the pathogen nucleic acids of human papillomavirus type 16 (HPV 16), human immunodeficiency virus (HIV), hepatitis B virus (HBV), Ebola virus (EBOV), respiratory syncytial virus (RSV), and tick-borne encephalitis virus (TBEV) as templates, and nuclease-free water as the negative control template, the one-tube method detection was carried out according to Example 2. The test results are as Figure 6As shown, this method can specifically detect HPV 16 without obvious cross-reaction with other test groups. Then, a one-tube detection system test strip was used for detection. After 15 minutes of reaction, the test strip could specifically detect the positive band of HPV 16 without obvious cross-reaction with other test groups, and the result was consistent with that of the fluorescence method.

[0065] 3. Clinical application evaluation

[0066] The reaction volume of the one-tube detection system was 40 μL, which contained 50 nM Lba Cas12a, 1 μM (FAM-TTATTATT-BHQ1 / Biotin) test strip ssDNA reporter molecule, 100 nM sgRNA, 25-fold diluted 10×NEBuffer2.1, and 18 μL RPA mixture. A reaction system with several parallel different samples was set up for the detection test. 2.5 μL of Buffer B and 8 μL of amplification template were added to each single-tube reaction system. After reacting at 37 °C for 30 minutes in a metal bath, the test strip was inserted into the reaction tube after the reaction ended, and the result of the test strip was read with the naked eye. The results are as Figure 7 shown. The positive predictive value of the test strip reading result was 95% (19 / 20), and the negative predictive value was 100%.

[0067] In summary, through the preparation of the detection components in Example 1, the selection of components and concentrations in Example 2, and the verification of the detection method under the preferred conditions in Example 3, it can be seen that the one-tube rapid detection method for HPV 16 of the present invention can achieve highly sensitive and highly specific detection of HPV 16 nucleic acid, with a sensitivity of 1.2 copies / μL, showing good performance in the evaluation of clinical samples and having great potential to realize home detection of HPV.

Claims

1. A set of reagents, characterized in that: It includes an RPA amplification primer pair, the sgRNA sequence of one-tube CRISPR / Cas12a, and a one-tube detection reaction system. The RPA amplification primer pair consists of two single-stranded DNAs of Sequence 2 and Sequence 3. The target sequences of the sgRNA are the 1st - 20th positions of Sequence 4 and the 42nd - 61st positions of Sequence 5 in the HPV 16 genome. Among them, Sequence 2 is AGGAACATCCAGACTACTTGCAGTTGGACA, Sequence 3 is CTAATGGCTGACCACGACCTACCTCAACAC, Sequence 4 is TAATACGACTCACTATAGGGTAATTTCTACTAAGTGTAGATAAAAACCTAACAATAACAAA, and Sequence 5 is TTTGTTATTGTTAGGTTTTTATCTACACTTAGTAGAAATTACCCTATAGTGAGTCGTATTA.

2. The kit of reagents according to claim 1, wherein: The sequence of the sgRNA is an RNA molecule obtained by annealing or PCR amplification of Sequence 4 and 5 followed by transcription and purification.

3. The kit of reagents according to claim 1, wherein: The set of reagents also includes Cas12a protein.

4. Use of the set of reagents according to any one of claims 1 - 3 in the preparation of a product for detecting or assisting in the detection of HPV.

5. The application according to claim 4, characterized in that: The product is a kit or a test strip.

6. A kit, characterized in that: It includes the set of reagents according to any one of claims 1 - 3, and other reagents for specifically amplifying the HPV target sequence and / or other reagents for detecting the amplification product of the RPA primer.

7. The kit according to claim 6, characterized in that: The other reagents for specifically amplifying the HPV target sequence are the reagents required for RPA. The other reagents for detecting the amplification product of the RPA primer include LbaCas12a protein, NTP Mix, T7 RNA polymerase, RNase inhibitor, MgCl2 solution, HEPES buffer, and reporter DNA. The reporter DNA consists of FAM-TTATTATT-BHQ1 / Biotin, with a fluorescent gene labeled at the 5' end and a quenching group labeled at the 3' end.

8. Use of the kit according to claim 6 or 7 in detecting or assisting in the detection of whether a test sample contains HPV.

9. The application according to claim 8, wherein: The test sample is one or more of cervical exfoliated cells, vaginal secretions, and cervical tissues.

10. A method for detecting HPV, characterized in that: It includes using the set of reagents according to any one of claims 1 - 3 to detect the test sample according to claim 8. The specific steps include: amplifying the target nucleic acid using the RPA primer pair, then detecting with the sgRNA, and judging whether it contains HPV by detecting the fluorescence signal. The detection is carried out at 37°C.