Lipid nanoparticle for liver targeted combined delivery of CRISPR-Cas9 system and single-stranded DNA repair template

Abstract

The invention provides a lipid nanoparticle for the targeted combined delivery of a CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-CRISPR-Cas9) system and a single-stranded DNA (deoxyribonucleic acid) repair template of the liver, and the lipid nanoparticle is prepared from an ionizable lipid ALC-0315, a PC (polycarbonate) lipid DOPC (dioctyl-phthalate), cholesterol and DMG-PEG (dimethyl glycol-polyethylene glycol) (2000) according to a molar ratio of 50: 10: 38.5: 1.5. The lipid nanoparticles can simultaneously package Cas9 mRNA (messenger ribonucleic acid), sgRNA (small guide ribonucleic acid) and a single-stranded DNA (deoxyribonucleic acid) repair template required by homologous directional repair (HDR) gene editing according to a certain proportion to prepare All-in-one LNP. According to the All-in-one LNP, the three nucleic acids are successfully delivered in a liver-targeted combined manner, HDR editing is successfully performed on the liver of a young rat, and an accurate and efficient tool is provided for in-vivo editing.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a lipid nanoparticle for liver-targeted combined delivery of a CRISPR-Cas9 system and a single-stranded DNA repair template. Background Art

[0002] Gene editing technology, a revolutionary breakthrough in the life sciences, has opened new research opportunities in numerous fields, including disease treatment and biotechnology. CRISPR / Cas9, with its ability to precisely edit and modify any location in the genome, has emerged as one of the most popular and widely used technologies in the field. While CRISPR / Cas9 can precisely edit and modify any location in the genome, achieving efficient gene editing in a variety of cell lines, its in vivo delivery and clinical application still face challenges in safety and efficacy.

[0003] Among current gene delivery strategies, viral vectors are a common method for in vivo CRISPR delivery in preclinical disease models. Adeno-associated virus (AAV), a commonly used viral vector, while offering certain advantages, also has significant drawbacks. Its limited loading capacity makes it difficult to meet the delivery requirements of complex gene editing systems. Furthermore, AAV continuously expresses the Cas9 protein, significantly increasing the risk of off-target effects, potentially leading to the accidental editing of non-target genes. This, in turn, can trigger a range of unpredictable safety issues, such as gene mutations, cellular dysfunction, and even tumorigenesis, severely limiting its widespread clinical application.

[0004] As a non-viral vector, LNPs offer numerous advantages, including high delivery efficiency, non-integrating expression, low immunogenicity, and a large loading capacity. They hold great potential for in vivo delivery of CRISPR systems. Existing technologies only enable in vivo delivery of Cas9 mRNA and sgRNA using LNPs, but these still suffer from drawbacks such as an inability to deliver DNA repair templates and poor template stability, hindering subsequent gene editing. Therefore, a method is urgently needed that can simultaneously deliver Cas9 mRNA, sgRNA, and a DNA repair template, while stably and efficiently achieving HDR repair. Summary of the Invention

[0005] To address the above problems, the present invention provides a lipid nanoparticle (LNP) that can perform HDR (homologous-directed repair) gene editing on mouse liver.

[0006] To achieve the above objectives, the specific technical solutions provided by the present invention are as follows:

[0007] The first aspect of the present invention provides a lipid nanoparticle for liver-targeted combined delivery of a CRISPR-Cas9 system and a single-stranded DNA repair template, wherein the lipid nanoparticle comprises an ionizable lipid, a PC lipid, a PEG lipid, a structural lipid and an active ingredient.

[0008] The ionizable lipid is ALC-0315.

[0009] The PC lipid is DOPC.

[0010] Furthermore, the PEG lipid is DMG-PEG (2000); and the structural lipid is cholesterol.

[0011] In the present invention, ionizable lipids are a class of amphiphilic small molecules that undergo a charge change under specific pH conditions. They are the core components of lipid nanoparticles (LNPs) and are widely used in gene delivery, mRNA vaccine development, and RNA interference therapy. In some embodiments, ionizable lipids include DLin-MC3-DMA (MC3), ALC-0315, and SM-102. In specific embodiments of the present invention, the ionizable lipid is ALC-0315, an ionizable amino lipid that is responsible for mRNA compression, facilitating cellular delivery and cytoplasmic release of mRNA.

[0012] In the present invention, PC lipids refer to phosphatidylcholine, which are used to encapsulate and protect the core formed by the interaction of ionizable lipids and drugs in lipid nanoparticles, and bind to the phospholipid bilayer of target cells to promote cell membrane penetration and endosomal escape during intracellular drug delivery. In some embodiments, the PC phospholipids include distearoylphosphatidylcholine (DSPC), palmitoyloleoylphosphatidylcholine (POPC), egg phosphatidylcholine (EPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,2-docosanoyl-sn-glycero-phosphocholine (DUPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesteroyl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), and 1-hexadecyl-sn-glycero-3-phosphocholine (C16 LysoPC). In a specific embodiment of the present invention, the PC phospholipid is dioleoylphosphatidylcholine (DOPC).

[0013] In the present invention, structural lipids are used to give the lipid-loaded rigidity in the lipid nanoparticles in terms of morphology, and improve the stability of the nanoparticles by being dispersed in the core and surface of the nanoparticles. In certain embodiments, the structural lipids include cholesterol, cholestenol, spinasterol, coprosterol, sitosterol, ergosterol, ergosterenol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid and alpha-tocopherol. In a specific embodiment of the present invention, the structural lipid is cholesterol.

[0014] In the present invention, PEG lipids refer to lipids modified with polyethylene glycol (PEG), which contribute to the particle stability of the nanoparticles in serum within the lipid nanoparticles and serve as a barrier to inter-nanoparticle aggregation. In some embodiments, the PEG lipids include ALC-0159, PEG-ceramide, PEG-DMG, PEG-c-DOMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, DMG-PEG (2000), and PEG-DSPE. In specific embodiments of the present invention, the PEG lipid is DMG-PEG (2000).

[0015] Furthermore, the molar ratio of ionizable lipids, PC lipids, structural lipids, and PEG lipids in the lipid nanoparticles is 50:10:38.5:1.5.

[0016] In a specific embodiment of the present invention, the lipid nanoparticles are composed of ALC-0315, DOPC, cholesterol and DMG-PEG (2000) in a molar ratio of 50:10:38.5:1.5.

[0017] Furthermore, the active ingredient is a nucleic acid molecule, and the nucleic acid molecule includes at least one of mRNA, sgRNA, DNA, miRNA, siRNA, shRNA, rRNA, aptamer, tRNA, antisense oligonucleotide, tracrRNA, gRNA, ribozyme, PNA, and DNA enzyme.

[0018] Furthermore, the nucleic acid molecule is a combination of Cas9 mRNA, sgRNA, and DNA, and the DNA is a DNA repair template.

[0019] A second aspect of the present invention provides a method for preparing the lipid nanoparticles according to the first aspect of the present invention, comprising: dissolving an ionizable lipid, a PC lipid, a structured lipid, and a PEG lipid in anhydrous ethanol at a molar ratio of 50:10:38.5:1.5 to obtain an organic phase;

[0020] The acidified diluted Cas9 mRNA, sgRNA, and DNA repair template were mixed in a mass ratio of 2:1:2 to form the aqueous phase;

[0021] The organic phase and the aqueous phase were packaged into LNPs at a volume ratio of 3:1 and a flow rate of 12 mL / min, wherein the mass ratio of lipid to nucleic acid was 13.79:1 and the N / P ratio was 5.94.

[0022] In the present invention, the N / P ratio refers to the molar ratio of ionizable ammonium (N) in cationic lipids to phosphate (P) in nucleic acid molecules. This ratio affects the stability, potential and nucleic acid encapsulation efficiency of LNPs through electrostatic adsorption. It is a key parameter in LNP preparation and is calculated based on the ratio of the amount of nitrogen (N) in cationic lipids to the amount of phosphate (P) in nucleic acids.

[0023] The third aspect of the present invention provides a pharmaceutical composition, which comprises the lipid nanoparticles described in the first aspect of the present invention and a pharmaceutically acceptable carrier.

[0024] In the present invention, a pharmaceutical composition refers to a composition comprising at least one biologically active substance (such as the lipid nanoparticles described in the first aspect of the present invention). The pharmaceutical composition of the present invention can be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally, or via an implanted reservoir. In some embodiments, parenteral administration, such as injection, is preferred. The pharmaceutical composition of the present invention may contain any commonly used non-toxic, pharmaceutically acceptable carrier, excipient, or vehicle. In some cases, a pharmaceutically acceptable acid, base, or buffer may be used to adjust the pH of the formulation to enhance the stability of the formulated compound or its dosage form. The pharmaceutical composition of the present invention may take the form of granules, tablets, lyophilized powders, suppositories, capsules, sublingual tablets, liquid solutions, nasal drops, sprays, or metered dose sprays. The term parenteral as used herein includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may be administered to the recipient by any route that reaches the target tissue.

[0025] In the present invention, pharmaceutically acceptable carrier refers to any pharmaceutical carrier that does not induce the production of antibodies harmful to the individual receiving the composition and can be used without excessive toxicity. Suitable carriers can be large, slowly metabolized macromolecules, such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids and amino acid copolymers. Such carriers are well known to those of ordinary skill in the art. The pharmaceutically acceptable carrier in the pharmaceutical composition can include fluids, such as water, saline, glycerol and ethanol. Auxiliary substances, such as wetting agents or emulsifiers, pH buffer substances, etc., can also be present in such vehicles.

[0026] Furthermore, the pharmaceutically acceptable carrier includes at least one of a diluent, a filler, an excipient, a binder, a wetting agent, a disintegrant, an absorption promoter, a surfactant, an adsorption carrier, a lubricant and a flavoring agent.

[0027] The fourth aspect of the present invention provides the use of the lipid nanoparticles described in the first aspect of the present invention and / or the pharmaceutical composition described in the third aspect of the present invention, and the use includes any one of the following: 1) use in the preparation of gene therapy drugs for liver disease, wherein the gene therapy is homologous directed repair targeting the liver; 2) use in the preparation of personalized liver cancer vaccines, wherein the lipid nanoparticles are loaded with mRNA encoding patient-specific tumor neoantigens, and the patient-specific tumor neoantigens are screened from highly expressed mutant genes in the patient's tumor tissue.

[0028] In this invention, liver-targeted homology-directed repair refers to a technique that utilizes the homology-directed repair (HDR) mechanism to achieve precise gene sequence correction or gene knock-in in liver cells. HDR is a key mechanism for repairing DNA double-strand breaks (DSBs) in vivo through homologous recombination.

[0029] Furthermore, the liver disease is a hereditary liver disease in which liver function is impaired due to gene mutation and / or liver cancer carrying a gene mutation related to homology-directed repair.

[0030] In the present invention, the hereditary liver diseases resulting in impaired liver function due to gene mutations refer to diseases caused by liver metabolic disorders or structural abnormalities triggered by specific gene mutations, leading to impaired liver cell function. The core mechanism is that gene mutations lead to abnormal function of liver-related enzymes or proteins, which in turn causes metabolic disorders or tissue damage. In some embodiments, the hereditary liver diseases resulting in impaired liver function due to gene mutations include hepatolenticular degeneration (ATP7B mutation), non-alcoholic fatty liver disease (FTO mutation), hereditary hemochromatosis (HFE mutation, such as C282Y or H63D missense mutation), alpha-1 antitrypsin deficiency (SERPINA1 mutation), glycogen storage disease (G6PC mutation or AGL mutation), and congenital hepatic fibrosis (PKHD1 mutation).

[0031] Furthermore, the hereditary liver diseases that cause liver function impairment due to gene mutations include hepatolenticular degeneration and non-alcoholic fatty liver disease.

[0032] Hepatolenticular degeneration (HLD) was first described by Wilson in 1912, hence its nickname, Wilson disease (WD). The causative gene is ATP7B, which encodes a P-type ATPase that, under physiological conditions, participates in the synthesis of hepatic ceruloplasmin and promotes biliary copper excretion. Mutations in ATP7B can lead to decreased or ineffective function of the encoded protein, resulting in a decrease in the ability of hepatocytes to excrete copper through the biliary pathway. Ultimately, this leads to excessive copper deposition in the liver, brain, and other organs, resulting in a range of clinical manifestations.

[0033] Non-alcoholic fatty liver disease (NAFLD) is a clinicopathological syndrome characterized by excessive fat deposition within hepatocytes, unrelated to alcohol consumption. FTO gene expression levels are significantly elevated in NAFLD patients, and mutations in the gene are associated with an increased risk of NAFLD. Polymorphisms in the FTO gene may increase the risk of NAFLD by affecting the liver's regulation of lipid metabolism. The FTO gene (a fat mass and obesity-related gene) is a novel candidate gene recently identified as closely associated with obesity. Its single nucleotide polymorphisms (SNPs) can affect body mass index (BMI) in adults and children, increase body weight and body fat mass, and alter eating behavior. It is also associated with a variety of metabolic diseases, including metabolic syndrome, type 2 diabetes, and coronary heart disease.

[0034] The advantages and beneficial effects of the present invention are as follows: 1) The present invention uses the ALC-0315+DOPC formula for the first time to achieve an all-in-one LNP that simultaneously packages three nucleic acids: Cas9 mRNA, sgRNA, and single-stranded DNA repair template; 2) The LNP provided by the present invention can accurately and efficiently achieve homology-directed repair (HDR) editing in mouse liver. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 These are the results of in vivo optical imaging of small animals after injection of four types of LNPs (LNP-1 to LNP-4 in Example 1) into the temporal vein of suckling mice, where A is a representative optical imaging image of the four LNPs and B is a statistical graph of the results.

[0036] Figure 2 Statistical graph of the mRNA delivery efficiency test results of two LNPs (ALC-0315+DOPC, SM-102+DSPC) into Hela cells.

[0037] Figure 3 The figure shows the WB detection results of the efficiency of Cas9 protein expression by LNP-delivered Cas9 mRNA in the liver of young mice.

[0038] Figure 4Statistical graph of the efficiency of homology-directed repair of the FTO site in the liver of neonatal mice using two LNPs (ALC-0315+DOPC, SM-102+DSPC) to deliver Cas9 mRNA, sgRNA targeting the mouse FTO site, and a single-stranded DNA template that mediates homology-directed repair.

[0039] Figure 5 This is a statistical graph showing the homology-directed repair efficiency of ALC-0315+DOPC all-in-one LNP on the ATP7B site in mouse liver.

[0040] Figure 6 Schematic diagram of LNP for the combined delivery of CRISPR-Cas9 system and DNA repair template. DETAILED DESCRIPTION

[0041] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without making any creative efforts shall fall within the scope of protection of the present invention.

[0042] Example 1 Detection of liver-targeted delivery efficiency of different LNPs

[0043] 1. Experimental Materials

[0044] 1. LNP: The formula is shown in Table 1.

[0045] Table 1. Formulations of LNP-1 to LNP-4

[0046] 2. Nucleic acid: The luciferase mRNA packaged in the LNP is EZ Cap™ Firefly Luciferase mRNA (APExBIO, R1018).

[0047] 3. Mouse information: The mouse strain used in the experiment was wild-type C57 / BL6J. The mice were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. and housed in an SPF (special pathogen free) animal laboratory.

[0048] 2. Experimental Methods

[0049] 1. LNP packaging:

[0050] 1. Prepare the lipid ethanol solution (organic phase) by dissolving the following ingredients in anhydrous ethanol at the indicated ratios (molar ratios):

[0051] LNP-1:ALC-0315:cholesterol:DSPC:DMG-PEG-2K=50:38.5:10:1.5;

[0052] LNP-2: ALC-0315:cholesterol:DOPC:DMG-PEG-2K=50:38.5:10:1.5;

[0053] LNP-3:DLin-MC3-DMA:cholesterol:DSPC:DMG-PEG-2K=50:38.5:10:1.5;

[0054] LNP-4:DLin-MC3-DMA:cholesterol:DOPC:DMG-PEG-2K=50:38.5:10:1.5.

[0055] 2. Acidify the nucleic acid and dilute it with 25 mM sodium acetate buffer (pH 4.0) to a concentration of 0.44 mg / mL to prepare the nucleic acid solution (aqueous phase).

[0056] 3. The lipid ethanol solution (organic phase) and nucleic acid solution (aqueous phase) were mixed in the following proportions for LNP packaging to prepare four different LNP formulations.

[0057] Lipid:nucleic acid (mass ratio) = 40:1, N / P ratio is 3.

[0058] The volume of aqueous phase: the volume of organic phase = 3:1.

[0059] Add the organic phase (lipid ethanol solution) to the aqueous phase (nucleic acid solution) and pipette rapidly for 30-40 strokes to turn the solution into a turbid mixture. Incubate at room temperature for 15 minutes.

[0060] 4. Add PBS to a 500 μL volume of LNP solution, add to an ultrafiltration tube (10- or 30-kD MWCO, Merck), and centrifuge at 6000 × g for 15 min. Repeat the centrifugation process. The resulting LNP solution is dissolved in PBS at a concentration of 600.00 μg / mL.

[0061] 2. Administration: Following delivery of newborns from pre-partum mice, four LNPs (LNP-1, LNP-2, LNP-3, and LNP-4) containing 2 μg of luciferase mRNA were injected into the temporal vein of 1- to 2-day-old pups. Six hours after LNP injection, D-luciferin (150 mg / kg) was injected intraperitoneally. Luminescence imaging was then performed using the PerkinElmer IVIS Lumina Small Animal In vivo Optical Imaging System.

[0062] 3. Experimental Results

[0063] The results are as follows Figure 1 As shown, bioluminescence was detected in the head (LNP injection site) and liver of pups in the LNP-1, LNP-2, and LNP-4 groups, demonstrating that the LNPs successfully delivered luciferase mRNA to the liver, where it was expressed as firefly luciferase. The average luminescence intensity (Avg radiance) in the liver of mice in the LNP-2 group was the highest, significantly higher than that of the other three groups. This indicates that LNP-2 (ALC-0315+DOPC LNP) was significantly more efficient in delivering luciferase mRNA to the liver of pups and expressing firefly luciferase than the other three LNPs. Statistical significance was determined by one-way analysis of variance (ANOVA), and Dunnett's multiple comparison test was then used to compare the LNP-1, LNP-3, and LNP-4 groups with LNP-2.

[0064] Example 2 Detection of the intracellular targeted delivery efficiency of different LNPs

[0065] 1. Experimental Materials

[0066] 1. LNP: LNP was synthesized by Nanjing GenScript Biotechnology Co., Ltd. The formula is shown in Table 2.

[0067] Table 2. Formulations of ALC-0315+DOPC and SM-102+DSPC

[0068] 2. Nucleic acid: All nucleic acids packaged in the above-mentioned LNPs were synthesized by Nanjing GenScript Biotechnology Co., Ltd. The specific sequences are shown below.

[0069] 1) Cas9 mRNA is eSpCas9 mRNA (Cap1, m1Ψ), Catalog No. RP-A00018.

[0070] 2) SgATP7B sequence: 5'-GUGUUCCAGCCACCGUCCCA-3' (SEQ ID NO: 1). Note: Except for the seed sequence that complements the genome, all other sequences of the guide RNA are fixed and consistent.

[0071] 3) Single-stranded DNA repair template sequence: 5'-AACTCCCCCTCCATCATTCACTGTGAACGAAAGAACCCTTGAAGCTGTAGCTACCTTGGCCACGTGTTCCAGCCACCGTGCCAGGGCGATGAACACAAAGAGCATGGGGGGCGTGTCAAAGAAGGTCACG-3' (SEQ ID NO: 2).

[0072] 4) Cas9 qPCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The sequences are:

[0073] F: CTGCGCTGGAAAGCGAGTTC (SEQ ID NO:3);

[0074] R: AGTACTTGGCGGTAGCCTTG (SEQ ID NO: 4).

[0075] 5) GAPDH qPCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The sequences are as follows:

[0076] F: AAGGGTCATCATCTCTGCCC (SEQ ID NO:5);

[0077] R: CATGAGTCCTTCCACGATACC (SEQ ID NO: 6).

[0078] 3. Cells: HeLa cells used in this experiment were obtained from the Cell Resource Center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences. Culture medium used was DMEM + 10% FBS + 1% P / S at 37°C in 5% CO2.

[0079] 2. Experimental Methods

[0080] 1. LNP packaging

[0081] 1. Dissolve the following ingredients in anhydrous ethanol according to the proportions (molar ratios) shown below to form a lipid ethanol solution (organic phase):

[0082] SM-102+DSPC all-in-one LNP: SM-102:cholesterol:DSPC:DMG-PEG-2K=50:38.5:10:1.5;

[0083] ALC-0315+DOPC all-in-one LNP:ALC-0315:cholesterol:DOPC:DMG-PEG-2K=50:38.5:10:1.5.

[0084] 2. Acidify and dilute the nucleic acid with 25 mM sodium acetate buffer (pH 4.0) to a concentration of 0.138 mg / mL. Mix the three nucleic acids in the aqueous phase in the following ratio: Cas9:sgRNA:ssDNA (mass ratio) = 2:1:2.

[0085] 3. The organic phase and aqueous phase were packaged into LNPs according to the following ratios to prepare ALC-0315+DOPC all-in-one LNPs and SM-102+DSPC all-in-one LNPs.

[0086] The lipid:nucleic acid ratio is as follows:

[0087] ALC-0315: nucleic acid (mass ratio) = 13.79:1, N / P ratio 5.94;

[0088] SM-102: nucleic acid (mass ratio) = 13:1, N / P ratio is 6.

[0089] The volume of aqueous phase: the volume of organic phase = 3:1, the flow rate: 12 mL / min.

[0090] 4. The prepared LNPs were finally dissolved in 10% sucrose in PBS (pH 7.4, 10 mM) at a concentration of 200.00 μg / mL.

[0091] 2. Cells:

[0092] 1. Plate HeLa cells in 12-well plates, 1×10 5 After overnight attachment, two all-in-one LNPs containing 10 ng, 50 ng, and 150 ng of Cas9 mRNA were added directly to the cell culture medium, mixed, and incubated at 37°C in 5% CO2.

[0093] 2. After 4 h of LNP treatment, cells were washed three times with PBS and then 200 μl of TRIzol was added to each well to lyse the cells and extract RNA.

[0094] 3. Take 1 μg of RNA and reverse transcribe it using the Vazyme HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Cat. No. R312-01). Add 380 μl of double-distilled water to the resulting cDNA solution and dilute the total volume to 400 μl.

[0095] 4. Using 2 μl of cDNA as a template and GAPDH as an internal control, we designed primers specific for Cas9 mRNA amplification, and then tested the efficiency of LNP delivery of Cas9 mRNA by qPCR.

[0096] 3. Experimental Results

[0097] The ct value of Ca9 mRNA specific amplification minus the ct value of GAPDH specific amplification of the corresponding sample was used to obtain Δct, and 2 -Δct , used to detect the relative abundance of Cas9 mRNA delivered by the two LNPs into cells. Figure 2 As shown, ALC-0315+DOPC LNPs were significantly more efficient in delivering mRNA into Hela cells than SM-102+DSPC LNPs. The results were statistically significant using two-way ANOVA, followed by Sidak's multiple comparison test for analysis of differences between groups.

[0098] Example 3 Detection of protein expression efficiency after targeted delivery of LNP to mouse liver

[0099] 1. Experimental Materials

[0100] 1. LNP: LNP was synthesized by Nanjing GenScript Biotechnology Co., Ltd., and the formula was the same as in Example 2, as shown in Table 2.

[0101] 2. Nucleic acid: All nucleic acids packaged in LNPs are synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0102] 1) Cas9 mRNA is eSpCas9 mRNA (Cap1, m1Ψ), Catalog No. RP-A00018.

[0103] 2) SgFTO sequence: 5'- caugaagcgcguccagaccg -3' (SEQ ID NO: 7). Note: Except for the seed sequence that complements the genome, all other sequences of the guide RNA are fixed and consistent.

[0104] 3. Antibodies: GAPDH antibody was purchased from Cell Signaling Technology (Cat. No. 2118S); Cas9 antibody was purchased from Abcam (Cat. No. ab189380).

[0105] 4. Mice: The mouse strain used in the experiment was wild-type C57 / BL6J. The peripartum mice were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. and housed in an SPF (special pathogen free) animal laboratory.

[0106] 2. Experimental Methods

[0107] 1. LNP packaging: the method is the same as Example 2.

[0108] 2. Medication:

[0109] 1. After the birth of newborn mice, two LNPs, ALC-0315+DOPC and SM-102+DSPC, containing 2 μg of nucleic acid were injected into the temporal vein of one-day-old mice.

[0110] 2. 7 hours after injection, liver tissues were collected from suckling mice and total protein was extracted.

[0111] 3. Western blot was used to detect the efficiency of LNP-delivered Cas9 mRNA expressed as Cas9 protein in the liver of young mice.

[0112] 3. Experimental Results

[0113] Figure 3 The results are WB test results of the efficiency of Cas9 protein expression by LNP-delivered Cas9 mRNA in the liver of young mice. Figure 3 As shown in the figure, while the GAPDH bands were essentially identical, specific protein bands for Cas9 protein were detected in the livers of two mice injected with ALC-0315+DOPC LNPs, whereas no Cas9 protein expression was detected in the livers of two mice injected with SM-102+DSPC LNPs. This indicates that ALC-0315+DOPC LNPs are significantly more efficient than SM-102+DSPC LNPs in delivering Cas9 mRNA and expressing Cas9 protein in mouse livers.

[0114] Example 4 Detection of single delivery and combined delivery efficiency

[0115] 1. Experimental Materials

[0116] 1. LNP: LNP was synthesized by Nanjing GenScript Biotechnology Co., Ltd., and the formula was the same as in Example 2, as shown in Table 2.

[0117] 2. Nucleic acid: All nucleic acids packaged in LNPs are synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0118] 1) Cas9 mRNA is eSpCas9 mRNA (Cap1, m1Ψ), Catalog No. RP-A00018.

[0119] 2) SgFTO sequence: 5'- caugaagcgcguccagaccg -3' (SEQ ID NO: 7). Note: Except for the seed sequence that complements the genome, all other sequences of the guide RNA are fixed and consistent.

[0120] 3) Single-stranded DNA repair template sequence: 5'-cgcccggagccccacataccttagcttcccgctctcgttcctccgACTtctggacgcgcttcatgctgctactaaagccgccttcgccac-3' (SEQ ID NO: 8).

[0121] 3. Mice: The mouse strain used in the experiment was wild-type C57 / BL6J. The peripartum mice were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. and housed in an SPF (special pathogen free) animal laboratory.

[0122] 2. Experimental Methods

[0123] 1. LNP packaging:

[0124] 1) Packaging method: Same as Example 2 except for adding nucleic acid.

[0125] 2) Package Contents: 4 types of LNP. The specific package contents are as follows.

[0126] 1. ALC-0315+DOPC LNP-1: Only two nucleic acids, Cas9 mRNA and sgRNA, are injected, with a mass ratio of Cas9:sgRNA = 1:1.

[0127] 2. ALC-0315+DOPC LNP-2: Only single-stranded DNA repair template is input.

[0128] 3. SM-102+DSPC LNP-1: Only two nucleic acids, Cas9 mRNA and sgRNA, are injected, with a mass ratio of Cas9:sgRNA = 1:1.

[0129] 4. SM-102+DSPC LNP-2: Only single-stranded DNA repair template is input.

[0130] 3) ALC-0315+DOPC LNP-1 and LNP-2 were mixed at a ratio of 1:1 (nucleic acid mass ratio) to prepare the final ALC-0315+DOPC LNP for injection; SM-102+DSPC LNP-1 and LNP-2 were mixed at a ratio of 1:1 (nucleic acid mass ratio) to prepare the final SM-102+DSPC LNP for injection.

[0131] 2. Medication:

[0132] 1) After the birth of newborn mice, 10 μg of nucleic acid of two LNPs were injected into the temporal vein of three-day-old mice.

[0133] 2) Liver tissues were collected from suckling mice 72 hours after injection.

[0134] 3) The liver genome was extracted using the phenol-chloroform extraction method, and the editing sites were amplified by PCR (polymerase chain reaction) and the next-generation sequencing adapters were added.

[0135] 4) The gene sequence after gene editing is obtained through second-generation sequencing, and the target analysis software CRISPResso2 based on high-throughput sequencing is used to calculate its proportion to obtain the efficiency of completing precise gene editing.

[0136] 3. Experimental Results

[0137] The results are as follows Figure 4 The figure shows the efficiency of ALC-0315+DOPC and SM-102+DSPC LNPs in delivering Cas9 mRNA, sgRNA targeting the mouse FTO locus, and single-stranded DNA templates for homology-directed repair of the FTO locus in the livers of three-day-old rats. When delivering the same mass of nucleic acid, ALC-0315+DOPC LNPs showed significantly higher editing efficiency at the FTO locus in the livers of rats than did SM-102+DSPC LNPs.

[0138] Example 5 Detection of gene editing efficiency of homology-directed repair at the ATP7B site in mouse liver

[0139] 1. Experimental Materials

[0140] 1. LNP: The formulation and preparation method are the same as those of ALC-0315+DOPC all-in-one LNP in Example 2.

[0141] 2. Mice: The mouse strain used in the experiment was wild-type C57 / BL6J. The peripartum mice were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. and housed in an SPF (special pathogen free) animal laboratory.

[0142] 2. Experimental Methods

[0143] 1. Administer medication

[0144] 1) After delivery, newborns were injected with ALC-0315+DOPC all-in-one LNPs containing 8 μg of nucleic acid into the temporal vein of one-day-old mice, and with ALC-0315+DOPC all-in-one LNPs containing 10 μg of nucleic acid into the temporal vein of three-day-old mice.

[0145] 2) Liver tissue was collected from the suckling mice 3-7 days after injection.

[0146] 3) The liver genome was extracted using the phenol-chloroform extraction method, and the editing sites were amplified by PCR (polymerase chain reaction) and the next-generation sequencing adapters were added.

[0147] 4) The gene sequence after gene editing is obtained through second-generation sequencing, and the target analysis software CRISPResso2 based on high-throughput sequencing is used to calculate its proportion to obtain the efficiency of completing precise gene editing.

[0148] 3. Experimental Results

[0149] The results are as follows Figure 5 The results show the homology-directed repair efficiency of the ALC-0315+DOPC all-in-one LNP at the ATP7B locus in mouse liver, which was simultaneously packaged with Cas9 mRNA, sgATP7B, and a single-stranded DNA repair template at the ATP7B locus. The results show that the LNP packaged with three nucleic acids successfully performed homology-directed repair gene editing at the ATP7B locus in mouse liver.

[0150] In summary, the present invention provides a lipid nanoparticle (LNP) that can perform HDR (homology-directed repair) gene editing on mouse liver. The lipid nanoparticle uses ionizable lipid ALC-0315, neutral phospholipid DOPC, cholesterol, and DMG-PEG (2000) in a ratio of 50:10:38.5:1.5, and can be packaged separately or simultaneously in a certain ratio to package Cas9mRNA, sgRNA, and single-stranded DNA repair template required for HDR gene editing, as prepared as follows: Figure 6 The all-in-one LNP shown here successfully achieved liver-targeted co-delivery of the three nucleic acids described above and successfully performed HDR editing in the livers of young mice. The lipid nanoparticles provided by this invention lay the foundation for in vivo gene editing.

[0151] The above embodiments are only provided for understanding the method and core concept of the present invention. It should be noted that, without departing from the principles of the present invention, a number of improvements and modifications may be made to the present invention by a person skilled in the art, and such improvements and modifications shall fall within the scope of protection of the claims of the present invention.

Claims

1. A lipid nanoparticle for liver-targeted combined delivery of a CRISPR-Cas9 system and a single-stranded DNA repair template, characterized in that: The lipid nanoparticles comprise ionizable lipids, PC lipids, PEG lipids, structural lipids and active ingredients; The ionizable lipid is ALC-0315; The PC lipid is DOPC.

2. The lipid nanoparticle according to claim 1, characterized in that The PEG lipid is DMG-PEG (2000); the structural lipid is cholesterol.

3. The lipid nanoparticle according to claim 1, characterized in that The molar ratio of the ionizable lipid, PC lipid, structural lipid and PEG lipid in the lipid nanoparticles is 50:10:38.5:1.

5.

4. The lipid nanoparticle according to claim 1, characterized in that The active ingredient is a nucleic acid molecule, which includes at least one of mRNA, sgRNA, DNA, miRNA, siRNA, shRNA, rRNA, aptamer, tRNA, antisense oligonucleotide, tracrRNA, gRNA, ribozyme, PNA, and DNA enzyme.

5. The lipid nanoparticle according to claim 4, characterized in that The nucleic acid molecule is a combination of Cas9 mRNA, sgRNA, and DNA, and the DNA is a DNA repair template.

6. A method for preparing the lipid nanoparticles according to any one of claims 1 to 5, characterized in that: The method comprises the steps of: dissolving ionizable lipid, PC lipid, structural lipid, and PEG lipid in anhydrous ethanol at a molar ratio of 50:10:38.5:1.5 to obtain an organic phase; The acidified diluted Cas9 mRNA, sgRNA, and DNA repair template were mixed in a mass ratio of 2:1:2 to form the aqueous phase; The organic phase and the aqueous phase were packaged into LNPs at a volume ratio of 3:1 and a flow rate of 12 mL / min, wherein the mass ratio of lipid to nucleic acid was 13.79:1 and the N / P ratio was 5.

94.

7. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the lipid nanoparticles according to any one of claims 1 to 5 and a pharmaceutically acceptable carrier.

8. Use of the lipid nanoparticles according to any one of claims 1 to 5 and / or the pharmaceutical composition according to claim 7, characterized in that: The application includes any of the following: 1) Application in the preparation of gene therapy drugs for liver diseases, wherein the gene therapy is homologous directed repair targeting the liver; 2) Application in the preparation of personalized liver cancer vaccines, wherein the lipid nanoparticles are loaded with mRNA encoding patient-specific tumor neoantigens, and the patient-specific tumor neoantigens are screened from highly expressed mutant genes in the patient's tumor tissue.

9. The use according to claim 8, characterized in that The liver disease is a hereditary liver disease in which liver function is impaired due to gene mutation and / or liver cancer carrying a homology-directed repair-related gene mutation.

10. The use according to claim 9, characterized in that The hereditary liver diseases that cause liver function impairment due to gene mutations include hepatolenticular degeneration and non-alcoholic fatty liver disease.

Images